Antimicrobial Agents and Chemotherapy, January 1998, p. 190-193, Vol. 42, No. 1
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cloning and Nucleotide Sequence of the DNA Gyrase
gyrA Gene from Serratia marcescens and
Characterization of Mutations in gyrA of Quinolone-Resistant
Clinical Isolates
Jeong Hoon
Kim,1
Eun Hee
Cho,2
Kwang Seo
Kim,3
Hak Yeop
Kim,1 and
Young Min
Kim3,*
Department of Pharmacology and Molecular
Biology, C&C Research Laboratories, Kyunggi-do
445-970,1
Department of Science
Education, Chosun University, Kwangju 501-759,2
and
Molecular Microbiology Laboratory, Department of
Biology, Yonsei University, Seoul 120-749,3
Korea
Received 27 May 1997/Returned for modification 7 August
1997/Accepted 24 October 1997
 |
ABSTRACT |
The sequence of the DNA gyrase gyrA gene of
Serratia marcescens ATCC 14756 was determined. An open
reading frame of 2,640 nucleotides coding for a polypeptide with a
calculated molecular mass of 97,460 was found, and its sequence
complemented the sequence of an Escherichia coli gyrA
temperature-sensitive mutation. Analysis of the PCR products of the
quinolone resistance-determining regions of gyrA genes from
six quinolone-resistant clinical isolates revealed a single amino acid
substitution, Ser-83 to Arg or Asp-87 to Tyr, in all six mutants,
suggesting that a mutational alteration in gyrA is a common
mechanism of quinolone resistance in S. marcescens.
 |
TEXT |
DNA gyrase, a type II DNA
topoisomerase, is an enzyme capable of transforming relaxed closed
circular DNA into a negatively supercoiled form (5). The
enzyme contains two protein subunits, subunits A and B. The A subunit,
coded for by the gyrA gene, is responsible for introducing
and rejoining double-stranded breaks in DNA, while the B subunit, coded
for by gyrB, mediates energy transduction and ATP hydrolysis
during the topological transformation of DNA (28, 40).
Fluoroquinolones are potent broad-spectrum antibacterial agents which
inhibit DNA gyrase activity (44). Mutations conferring high-level quinolone resistance have been mapped to a small region of
the 5' end of the gyrA gene, which has been designated the quinolone resistance-determining region (QRDR). Mutations in the Ser-83
and Asp-87 codons in particular have been found in the majority of
quinolone-resistant clinical isolates of Escherichia coli
(26, 38). Similar mutations were also identified in
quinolone-resistant strains from a diverse group of bacteria (1,
6, 7, 12, 14, 19, 21, 22, 24, 35, 39, 41, 47).
Serratia marcescens is recognized as a frequent cause of
extraintestinal human infections ranging from simple cystitis to life-threatening bloodstream and central nervous system infections (2, 15, 43). Several strains of S. marcescens
causing nosocomial infections were found to acquire resistance to
fluoroquinolones at higher frequencies than those for the E. coli strains (4, 30, 31, 42), but nothing has been
reported about the gyrA gene structure, the mutation in
gyrA responsible for quinolone resistance, or the genetic
basis of decreased susceptibility to quinolones in this bacterium. We
therefore carried out this study to characterize the wild-type
gyrA gene of S. marcescens and also to elucidate
the mutations in the gyrA genes of several
quinolone-resistant clinical isolates.
Cloning and sequencing of gyrA gene of S. marcescens ATCC 14756.
The type strain of S. marcescens, ATCC 14756, was purchased from the American Type
Culture Collection, Rockville, Md. The genomic restriction map for the
gyrA gene in ATCC 14756 was determined by Southern
hybridization with a randomly digoxigenin-labeled 582-bp
SacI-SmaI fragment of pDH24 (9) and a
2.8-kb HindIII fragment of pMK90 (18)
corresponding to the 5' and 3' ends of E. coli gyrA,
respectively (Fig. 1A). In addition, a
648-bp DNA probe which is specific for the 5' end of the S. marcescens gyrA gene comprising the putative QRDR was generated by
PCR and was also used in the hybridization studies. To generate the
648-bp probe, two primers, primers TACACCGGTCAACATTGAGG and
TTAATGATTGCCGCCGTCGG, the sequences of which are identical
to the nucleotide sequence from positions +24 to +43 of the E. coli gyrase gyrA gene and complementary to positions
+652 to +671 of the E. coli gyrA gene, respectively,
(26), were selected on the basis of the close genetic
relatedness of Serratia spp. to E. coli.
Preliminary data showed that the nucleotide sequence of the 648-bp
fragment was highly homologous to that of the 5' end region of the
E. coli gyrA gene.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Genomic restriction map for the gyrA
locus in S. marcescens ATCC 14756. The gyrA gene
is indicated by a thick line. (B) Detailed restriction map and
sequencing strategy for the gyrA gene. The open reading
frame (ORF) of the S. marcescens gyrA gene is shown by a
thick line. The 1.0-kb SalI fragment in pSC6-1 and the
3.2-kb SalI fragment in pSC6-2 are indicated by pSC6-1 and
pSC6-2, respectively. A strategy for nucleotide sequencing by the
dideoxy method (32) is shown under pSC6-1 and pSC6-2. Three
to five independent sequencing reactions were done for each arrow.
|
|
To construct a subgenomic library, genomic DNA digested with
BamHI was ligated into bacteriophage lambda EMBL3 and was
packaged by using Gigapack III gold packaging extracts (Stratagene
Cloning System, La Jolla, Calif.). Replicate plaques were screened with the PCR-amplified QRDR-containing 648-bp probe. Positive clones all
contained identical 14-kb BamHI inserts (Fig. 1A). When
E. coli KNK453 gyrA43(Ts) (13) was
transformed with pBluescript II KS(+) containing a 3.8-kb
BamHI-EcoRI fragment of the gyrA gene
from a positive clone, bacteriophage lambda clone 6, the bacterium
exhibited full growth at the nonpermissive temperature of 42°C.
E. coli KNK453 transformed with pBluescript II KS(+) containing no insert DNA grew well at 30°C but did not grow at 42°C, indicating that the complete gyrA gene is present in
the 3.8-kb insert DNA and that an S. marcescens
GyrA-E. coli GyrB holoenzyme complex is functionally active.
On the basis of the detailed restriction map of the bacteriophage
lambda clone 6 constructed by Southern hybridization ofWe are especially grateful to James C. Wang, Kenneth N. Kreuzer,
Martin Gellert, Mary H. O'Dea, and Nicholas R. Cozzarelli for
providing the E. coli strains and plasmids. We also thank Sang S. Han, Department of Clinical Microbiology, Dong Suwon Hospital, Suwon, Korea, for generously providing clinical isolates of S. marcescens.
| 1.
|
Belland, R. J.,
S. G. Morrison,
C. Ison, and W. M. Huang.
1994.
Neisseria gonorrhoeae acquires mutations in analogous regions of gyrA and parC in fluoroquinolone-resistant isolates.
Mol. Microbiol.
14:371-380[Medline].
|
| 2.
|
Bollmann, R.,
E. Halle,
W. Sokoslowska-Kohler,
E. L. Grauel,
P. Buchholz,
I. Klare,
H. Tschape, and W. Witte.
1989.
Nosocomial infections due to Serratia marcescens clinical findings, antibiotic susceptibility patterns and fine typing.
Infection
17:294-300[Medline].
|
| 3.
|
Dimri, G. P., and H. K. Das.
1990.
Cloning and sequence analysis of gyrA gene of Klebsiella pneumoniae.
Nucleic Acids Res.
18:151-156[Abstract/Free Full Text].
|
| 4.
|
Fujimaki, K.,
T. Fujii,
H. Aoyama,
K.-I. Sato,
Y. Inoue,
M. Inoue, and S. Mitauhashi.
1989.
Quinolone resistance in clinical isolates of Serratia marcescens.
Antimicrob. Agents Chemother.
33:785-787[Abstract/Free Full Text].
|
| 5.
|
Gellert, M.,
K. Mizuuchi,
M. H. O'Dea, and H. A. Nash.
1976.
DNA gyrase: an enzyme that introduces superhelical turns into DNA.
Proc. Natl. Acad. Sci. USA
73:3872-3876[Abstract/Free Full Text].
|
| 6.
|
Georgiou, M.,
R. Muñoz,
F. Román,
R. Cantón,
R. Gómez-Lus,
J. Campos, and A. G. de la Campa.
1996.
Ciprofloxacin-resistant Haemophilus influenzae strains possess mutations in analogous positions of GyrA and ParC.
Antimicrob. Agents Chemother.
40:1741-1744[Abstract].
|
| 7.
|
Griggs, D. J.,
K. Gensberg, and L. J. V. Piddock.
1996.
Mutations in gyrA gene of quinolone-resistant Salmonella serotypes isolated from humans and animals.
Antimicrob. Agents Chemother.
40:1009-1013[Abstract].
|
| 8.
|
Grimont, P. A. D., and F. Grimont.
1984.
Genus Serratia, p. 477-484.
In
N. R. Krieg, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. The Williams & Wilkins Co., Baltimore, Md.
|
| 9.
|
Horowitz, D. S., and J. C. Wang.
1987.
Mapping the active site tyrosine of Escherichia coli DNA gyrase.
J. Biol. Chem.
262:5339-5344[Abstract/Free Full Text].
|
| 10.
|
Horowitz, M. S. Z., and L. A. Loeb.
1988.
An E. coli promoter that regulates transcription by DNA superhelix-induced cruciform extrusion.
Science
241:703-705[Abstract/Free Full Text].
|
| 11.
|
Jackson, D. P.,
J. D. Hayden, and P. Quirke.
1991.
Extraction of nucleic acid from fresh and archival material, p. 29-50.
In
M. J. McPherson, P. Quirke, and G. R. Taylor (ed.), PCR: a practical approach, vol. 1. Oxford University Press, New York, N.Y.
|
| 12.
|
Korten, V.,
W. M. Huang, and B. E. Murray.
1994.
Analysis by PCR and direct DNA sequencing of gyrA mutations associated with fluoroquinolone resistance in Enterococcus faecalis.
Antimicrob. Agents Chemother.
38:2091-2094[Abstract/Free Full Text].
|
| 13.
|
Kreuzer, K. N., and N. R. Cozzarelli.
1979.
Escherichia coli mutants thermosensitive for DNA gyrase subunit A: effects on DNA replication, transcription, and bacteriophage growth.
J. Bacteriol.
140:424-435[Abstract/Free Full Text].
|
| 14.
|
Kureishi, A.,
J. M. Diver,
B. Beckthold,
T. Schollaardt, and L. E. Bryan.
1994.
Cloning and nucleotide sequence of Pseudomonas aeruginosa DNA gyrase gyrA gene from strain PAO1 and quinolone-resistant clinical isolates.
Antimicrob. Agents Chemother.
38:1944-1952[Abstract/Free Full Text].
|
| 15.
|
Lewis, A. M.,
J. R. Stephenson,
J. Garner,
F. Afshar, and S. Tabagchall.
1989.
A hospital outbreak of Serratia marcescens in neurosurgical patients.
Epidemiol. Infect.
102:69-74[Medline].
|
| 16.
|
Masecar, B. L., and N. J. Robillard.
1991.
Spontaneous quinolone resistance in Serratia marcescens due to a mutation in gyrA.
Antimicrob. Agents Chemother.
35:898-902[Abstract/Free Full Text].
|
| 17.
|
Menzel, R., and M. Gellert.
1987.
Modulation of transcription by DNA supercoiling: a deletion analysis of the Escherichia coli gyrA and gyrB promoters.
Proc. Natl. Acad. Sci. USA
84:4185-4189[Abstract/Free Full Text].
|
| 18.
|
Mizuuchi, K.,
M. Mizuuchi,
M. H. O'Dea, and M. Gellert.
1984.
Cloning and simplified purification of Escherichia coli DNA gyrase.
J. Biol. Chem.
259:9199-9201[Abstract/Free Full Text].
|
| 19.
|
Moore, R.,
B. Beckthold,
S. Wong,
A. Kureishi, and L. E. Bryan.
1995.
Nucleotide sequence of the gyrA gene and characterization of ciprofloxacin-resistant mutations of Helicobacter pylori.
Antimicrob. Agents Chemother.
39:107-111[Abstract].
|
| 20.
|
Moriya, S.,
N. Ogasawara, and H. Yoshikawa.
1985.
Structure and function of the region of the replication origin of the Bacillus subtilis chromosome. III. Nucleotide sequence of some 10,000 base pairs in the origin region.
Nucleic Acids Res.
13:2251-2262[Abstract/Free Full Text].
|
| 21.
|
Muñoz, R., and A. G. de la Campa.
1996.
ParC subunit of DNA topoisomerase IV of Streptococcus pneumoniae is a primary target of fluoroquinolones and cooperates with DNA gyrase A subunit in forming resistant phenotype.
Antimicrob. Agents Chemother.
40:2252-2257[Abstract].
|
| 22.
|
Musso, D.,
M. Drancourt,
S. Osscini, and D. Raoult.
1996.
Sequence of quinolone resistance-determining region of gyrA gene for clinical isolates and for an in vitro-selected quinolone-resistant strain of Coxiella burnetii.
Antimicrob. Agents Chemother.
40:870-873[Abstract].
|
| 23.
|
National Committee for Clinical Laboratory Standards.
1989.
Methods for antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A2, 2nd ed.
National Committee for Clinical Laboratory Standards, Villanova, Pa.
|
| 24.
|
Oppegaard, H., and H. Sørum.
1994.
gyrA mutations in quinolone-resistant isolates of the fish pathogen Aeromonas salmonicida.
Antimicrob. Agents Chemother.
38:2460-2464[Abstract/Free Full Text].
|
| 25.
|
Oppegaard, H., and H. Sørum.
1996.
Cloning and nucleotide sequence of the DNA gyrase gyrA gene from the fish pathogen Aeromonas salmonicida.
Antimicrob. Agents Chemother.
40:1126-1133[Abstract].
|
| 26.
|
Oram, M., and L. M. Fisher.
1991.
4-Quinolone resistance mutations in the DNA gyrase of Escherichia coli clinical isolates identified by using the polymerase chain reaction.
Antimicrob. Agents Chemother.
35:387-389[Abstract/Free Full Text].
|
| 27.
|
Parales, R. E., and C. S. Harwood.
1990.
Nucleotide sequencing of the gyrB gene of Pseudomonas putida.
Nucleic Acids Res.
18:5880[Free Full Text].
|
| 28.
|
Reece, R. J., and A. Maxwell.
1991.
DNA gyrase: structure and function.
Crit. Rev. Biochem. Mol. Biol.
26:335-375[Medline].
|
| 29.
|
Rosanas, A.,
J. Barbé, and I. Gibert.
1995.
Cloning and sequencing of the gyrA gene from the plant pathogen Erwinia carotovora.
Gene
161:11-14[Medline].
|
| 30.
|
Sanders, C. C., and C. Watankunakorn.
1986.
Emergence of resistance to -lactams, aminoglycosides, and quinolones during combination therapy for infection due to Serratia marcescens.
J. Infect. Dis.
153:617-619[Medline].
|
| 31.
|
Sanders, C. C.,
W. E. Sanders, Jr.,
R. V. Goering, and V. Werner.
1984.
Selection of multiple antibiotic resistance by quinolones, -lactams, and aminoglycosides with special reference to cross-resistance between unrelated drug classes.
Antimicrob. Agents Chemother.
26:797-801[Abstract/Free Full Text].
|
| 32.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1979.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467.
|
| 33.
|
Straney, R.,
R. Krah, and R. Menzel.
1994.
Mutations in the 10 TATAAT sequence of the gyrA promoter affect both promoter strength and sensitivity to DNA supercoiling.
J. Bacteriol.
176:5999-6006[Abstract/Free Full Text].
|
| 34.
|
Swanberg, S. L., and J. C. Wang.
1987.
Cloning and sequencing of the Escherichia coli gyrA gene coding for the A subunit of DNA gyrase.
J. Mol. Biol.
197:729-736[Medline].
|
| 35.
|
Takiff, H.,
L. Salazzar,
C. Guerrero,
W. Philipp,
W. M. Huang,
B. Kreiswirth,
S. T. Cole,
W. R. Jacobs, Jr., and A. Telenti.
1994.
Cloning and nucleotide sequence of Mycobacterium tuberculosis gyrA and gyrB genes and detection of quinolone resistance mutations.
Antimicrob. Agents Chemother.
38:773-780[Abstract/Free Full Text].
|
| 36.
|
Tankovic, J.,
F. Maahjoubi,
P. Courvalin,
J. Duval, and R. Leclercq.
1996.
Development of fluoroquinolone resistance in Enterococcus faecalis and role of mutations in the DNA gyrase gyrA gene.
Antimicrob. Agents Chemother.
40:2558-2561[Abstract].
|
| 37.
|
Traub, W. H.
1985.
Incomplete cross-resistance of nalidixic and pipemidic acid-resistant variants of Serratia marcescens against ciprofloxacin, enoxacin, and norfloxacin.
Chemotherapy (Basel)
31:34-39.
|
| 38.
|
Vila, J.,
J. Ruiz,
F. Marco,
A. Barcelo,
P. Goni,
E. Giralt, and T. J. de Anta.
1994.
Association between double mutation in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs.
Antimicrob. Agents Chemother.
38:2477-2479[Abstract/Free Full Text].
|
| 39.
|
Vila, J.,
J. Ruiz,
P. Goni,
A. Marcos, and T. J. de Anta.
1995.
Mutation in the gyrA gene of quinolone-resistant clinical isolates of Acinetobacter baumannii.
Antimicrob. Agents Chemother.
39:1201-1203[Abstract].
|
| 40.
|
Wang, J. C.
1985.
DNA topoisomerases.
Annu. Rev. Biochem.
54:665-697[Medline].
|
| 41.
|
Wang, Y.,
W. M. Huang, and D. E. Taylor.
1993.
Cloning and nucleotide sequence of the Campylobacter jejuni gyrA gene and characterization of quinolone resistance mutations.
Antimicrob. Agents Chemother.
37:457-463[Abstract/Free Full Text].
|
| 42.
| Watanabe, M., Y. Kotera, K. Yosue, M. Inoue, and S. Mitsuhashi. 1990. In vitro emergence of quinolone-resistant
mutations of Escherichia coli, Enterobacter
cloacae, and Serratia marcescens.
34:173-175.
|
| 43.
|
Wilfert, J. N.,
F. F. Barrett, and E. H. Kass.
1968.
Bacteremia due to Serratia marcescens.
N. Engl. J. Med.
279:286-289.
|
| 44.
|
Wolfson, J. S., and D. C. Hooper.
1985.
The fluoroquinolones: structures, mechanisms of action and resistance, and spectra of activity in vitro.
Antimicrob. Agents Chemother.
28:581-586[Free Full Text].
|
| 45.
|
Wood, D. O., and R. T. Waite.
1994.
Sequencing analysis of the Rickettsia prowazekii gyrA gene.
Gene
151:191-196[Medline].
|
| 46.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272[Abstract/Free Full Text].
|
| 47.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura,
S. Nakamura,
H. Narita,
T. Matsunaga,
H. Igarashi,
M. Kawahara, and S. Onodera.
1996.
DNA gyrase gyrA mutations in quinolone-resistant clinical isolates of Staphylococcus haemolyticus.
Antimicrob. Agents Chemother.
40:1065-1066[Medline].
|