INTRODUCTION

Top Abstract Introduction Materials & Methods Results & Discussion References

In mammalian proliferating cells, the deoxyribonucleoside salvage pathway is initiated by the cytosolic enzymes TK1 and dCK. The physiological roles of these two enzymes are to phosphorylate Thd and dCyd to the corresponding monophosphates, which can be further phosphorylated by other enzymes to di- and triphosphates for incorporation into DNA. In addition, these two enzymes can phosphorylate many pharmacologically important nucleoside analogs. The expression of TK1 is highly cell cycle dependent, while dCK is expressed in a tissue-specific fashion, and this leads to large variations among the capacities of different cells to phosphorylate deoxynucleosides and their analogs. Furthermore, there are considerable differences in the substrate specificity of dCKs from different mammalian species, making rodent cells a poor model for the development of nucleoside analogs intended for use in humans (1).

A number of animal viruses, e.g., the herpesvirus family, encode deoxynucleoside kinases which can accept a much broader spectrum of substrates than human enzymes, and this is the basis for the efficiency and selectivity of several of the most important antiviral drugs used today (4, 9, 14).

Deoxynucleoside salvage in prokaryotes shows large variations, especially with regard to activation of deoxyadenosine (dAdo), dGuo, and dCyd (30). Lactobacillus acidophilus contains three distinct deoxynucleoside kinases: a TK, a dCyd/dAdo kinase (dCK/dAK) and a dGuo/dAdo kinase (dGK/dAK), and the structure of the operon for the latter two enzymes has recently been elucidated (22, 23). Bacillus subtilis expresses a TK, a dCK/dAK, and a dGK and has a salvage pathway similar to that in animal cells (27, 28). Escherichia coli has only one deoxynucleoside kinase, i.e., TK. Due to the lack of dCK, E. coli metabolizes dCyd by deamination catalyzed by the inducible cytidine/dCyd deaminase. The product of this reaction, deoxyuridine (dUrd), is further metabolized either by TK or by thymidine phosphorylase. This explains the inability of E. coli to incorporate dCyd, in contrast to Thd, into its DNA (19).

The most popular systems for screening pharmacologically interesting nucleoside analogs include in vitro cell culture systems and direct assays with pure or partially purified target enzymes such as kinases, catabolic enzymes, and DNA/RNA polymerases (1, 26). Although these are reasonable and successful approaches, the difference between the species and cell types mentioned above and the variability and cost involved in cell culture study cause considerable problems. The purification of nucleoside metabolic enzymes is also costly and complicated, and in vitro assays are always subject to criticism of their in vivo relevance.

In this report, we describe a bacterial system based on genetically modified E. coli cells which may be used to determine the toxicity of nucleoside analogs to proliferating cells by monitoring the selective inhibition of bacterial growth caused by these analogs. Mutants of E. coli defective in the major deoxypyrimidine catabolic enzymes and, in one case, also in TK were constructed, and the cDNA for human dCK or TK1 under the control of the lac promoter/repressor was introduced. Degrees of growth inhibition of the bacteria caused by nucleoside analogs with and without the expression of the human enzymes were compared. A number of deoxynucleoside analogs were tested with this system, as well as with human T-lymphoblast CEM cells, which is a much-used model system in antiviral and antitumor research (33). Several cytostatic and antiviral analogs were shown to perform their inhibitory effects on the growth of engineered bacteria at levels similar to those at which human CEM cells were inhibited.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results & Discussion References

Abbreviations. AraC, 1--D-arabinofuranosylcytosine; AZT, 3'-azido-2',3'-dideoxythymidine; CAFdA, 2-chloro-2'-fluoroarabinosyl adenine; CdA, 2-chloro-2'-deoxyadenosine; ddC, 2',3'-dideoxycytidine; dFdC, 2',2'-difluoro-2'-deoxycytidine; EC₅₀, compound concentration at which bacterial growth is inhibited by 50%; FIAU, 1-(2'-deoxy-2'-fluoro--D-arabinofuranosyl)-5-iodouracil; FLT, 3'-fluoro-2'-deoxythymidine; FMAU, 1-(2'-deoxy-2'-fluoro--D-arabinofuranosyl)-5-methyluracil; HIV, human immunodeficiency virus; IPTG, isopropyl--D-thiogalactopyranoside. TK, thymidine kinase; dCK, deoxycytidine kinase; dCyd, deoxycytidine; dUrd, deoxyuridine; Thd, deoxythymidine; dAK, deoxyadenosine kinase; 5-F-dCyd, 5-fluorodeoxycytidine; dGuo, deoxyguanosine; 5-F-dUrd, 5-fluorodeoxyuridine; 5-Br-dUrd, 5-bromodeoxyuridine; 5-I-dUrd, 5-iododeoxyuridine; 5-Cl-dUrd, 5-chlorodeoxyuridine.

Bacterial strains and growth media. The bacterial strains used were all derivatives of E. coli K-12 and are listed in Table 1. Strains SØ5110, SØ5282, and SØ5286 were constructed by P1-mediated transduction as described by Miller (24). Luria broth was used as rich medium (24). The minimal medium was AB medium (11) supplemented with 0.2% glucose, 0.2% vitamin-free Casamino Acids, and 1-µg/ml thiamine. When required, tryptophan was added at 50 µg/ml and uridine was added at 20 µg/ml (82 µM). Antibiotics were used at the following final concentrations: ampicillin, 100 µg/ml; tetracycline, 10 µg/ml; kanamycin, 30 µg/ml.

Nucleoside analogs. All of the analogs used in this study were purchased from Sigma, except FIAU and FMAU, which were synthesized and provided by J. Fox at the Memorial Sloan-Kettering Cancer Institute, and FLT, which was a gift from N. G. Johansson of Medivir AB, Huddinge, Sweden.

Plasmid constructions and expression. Plasmid pTrc99-A (Pharmacia) was used throughout as a cloning and expression vector.

(i) pTrcHUMdCK. The pET-3d expression vector containing the coding sequence of the human dCK cDNA was obtained from B. Mitchell at the Department of Pharmacology, University of North Carolina (10). It contained a unique NcoI site overlapping the dCK start codon and a unique BamHI site immediately 3' of the stop codon. The entire dCK coding region was recloned as a 780-bp NcoI/BamHI fragment into the multiple cloning site of pTrc99-A, yielding pTrcHUMdCK. In this construct, the dCK cDNA was transcribed from the vector-borne IPTG-inducible trc promoter, as the lacI^q gene encoding the lac repressor was also expressed from pTrc99-A. Translation of dCK was initiated from the lacZ ribosomal binding site located 6 bp upstream of the NcoI cloning site. Plasmid pTrcHUMdCK was transformed into cytidine deaminase (cdd)-negative E. coli SØ5110. As E. coli is naturally devoid of dCK, the expression from the plasmid was the sole source of this enzyme in the recombinant cells.

(ii) pTrcHUMTK1. The coding sequence of human TK1 cDNA was amplified by PCR using pTK11, obtained from Bradshaw and Deininger (3), as the template. The 5' sense primer, 5'CGGAATTCAAGGAGGCGTAATGAGCTGC, contained an EcoRI site (bold) and a good E. coli ribosome binding site (underlined) upstream of the TK1 start codon (italics), and the 3' reverse complement primer, 5'CGGGATCCTCAGTTGGCAGGGC, had a BamHI site (bold) immediately following the stop codon (italics) when read on the complementary sequence. Amplified DNA was digested with EcoRI and BamHI and cloned into the EcoRI/BamHI sites of pTrc99-A, yielding pTrcHUMTK1. As with pTrcHUMdCK, the transcription of the cloned cDNA was from the IPTG-inducible trc promoter in the vector, whereas translation was initiated from the ribosome binding site located within the 5' primer. pTrcHUMTK1 was introduced into SØ5286, yielding SØ5288. SØ5286 is unable to catabolize Thd and dUrd due to mutational inactivation of Thd phosphorylase (deoA) and uridine phosphorylase (udp). In addition, SØ5286 carries the tdk-1 mutation inactivating the endogenous E. coli TK (16).

Incorporation of dCyd and Thd by recombinant E. coli. Incorporation experiments were carried out as described by Karlström (19), with the following modifications. An overnight culture was diluted to an A₆₀₀ of 0.01 with fresh medium containing 1 mM IPTG, and the culture was grown with shaking at 37°C until an A₆₀₀ of 0.2 was reached. A final concentration of 5 µM radioactive dCyd or Thd was added, and the growth was continued for another 30 min. The incorporation was linear for up to 60 min, and 0.2 ml of the culture was withdrawn and mixed with ice-cold 5% trichloroacetic acid. After centrifugation, the pellets were resuspended in 1 M KOH and incubated at 37°C for 20 h. The samples were then transferred to glass fiber filters (Whatman) and washed, and the radioactivity was counted with Beckman liquid scintillation system LS3800 to determine the incorporation of labelled nucleoside into bacterial DNA.

Determination of dCK and TK activities in bacterial extracts. Enzyme levels in crude bacterial extracts were determined as follows. A 1.5-ml sample withdrawn from the culture for the in vivo incorporation experiments described above was centrifuged, and the cells were resuspended in 0.5 ml of buffer A (50 mM Tris [pH 7.6], 1 mM EDTA, 50 mM NaCl, 0.5 mM phenylmethylsulfonyl fluoride, 0.5% Nonidet P-40, 2 mM dithiothreitol, 1-mg/ml lysozyme). The samples were incubated at room temperature for 30 min, and after centrifugation (15,000 × g for 20 min), the supernatant was used for enzyme assays. The assays were performed as described previously (12).

Growth inhibition by nucleoside analogs. A fresh overnight culture, prepared by inoculating a single colony from a petri plate into 10 ml of minimal medium containing antibiotics, was diluted into fresh minimal medium supplemented with antibiotics and 1 mM IPTG to achieve an initial A₆₀₀ of 0.01. This culture was subsequently divided into tubes, 1 ml in each, and 20 µl of analog solution was added to each tube. The tubes were cultured at 37°C with shaking for 3 to 4 h, until the control tube, to which no analog was added, reached an A₆₀₀ of about 0.6. The A₆₀₀s of all of the tubes were measured, and the relative growth of each sample was calculated by comparing its A₆₀₀ to that of the control tubes, which was set as 100%.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials & Methods Results & Discussion References

TK and dCK activities in extracts of engineered bacteria and in vivo incorporation of Thd and dCyd into bacterial DNA. To demonstrate that human dCK and TK1 were successfully expressed in E. coli, we determined the levels of dCK and TK in the crude extracts of the recombinant strains. As shown in Table 2, strain SØ5218, which contains cDNA for human dCK, exhibited significant dCK activity in the presence of IPTG, while parental strain SØ5110 had no detectable dCK activity. The dCK level in the induced bacteria is close to that in human CEM cell extracts (33). Both SØ5110 and SØ5218 demonstrated a low level of TK activity due to the endogenous enzyme, while SØ5288, harboring the cDNA for human TK1, expressed a 200-fold higher TK level when IPTG was added. As expected, there was no detectable TK activity in TK-deficient E. coli SØ5292, the parental bacterium of SØ5288 (Table 2). The large difference between the levels of recombinant dCK and TK1 in induced bacteria may be due partially to the higher specific activity of human TK1 protein than dCK (1). Furthermore, there might be a difference in the regulation of human TK1 and dCK expression in E. coli, since the specific activity of dCK in noninduced SØ5218 was approximately 40% of that in induced bacteria, whereas the presence of IPTG resulted in a 34-fold increased TK level in SØ5288 (results not shown).

Growth inhibition of SØ5218 by dCyd analogs. As mentioned above, E. coli does not express dCK but has the ability to deaminate dCyd through the activity of cytidine deaminase (cdd). To increase the capacity of the bacteria to salvage dCyd, as well as its analogs, cdd-deficient strain SØ5110 was used as the host for the plasmid carrying cDNA for human dCK. A number of dCyd analogs were tested with this system. All growth experiments were carried out with IPTG-induced bacteria so that maximal expression of recombinant human dCK was achieved. It was shown that the introduction of human dCK cDNA made the cells sensitive to compounds such as dFdC (Fig. 1) and AraC (Fig. 2), both of which analogs are known to be toxic to animal cells (32, 35). Several other pyrimidine analogs have also been tested with this system, and the results showed that dFdC (C-2), a much-used anti-tumor drug (32, 33a), had the most potent inhibitory effect (Table 3). 5-Azacytidine (C-4), which also is a known cytostatic ribocytidine analog (2), showed an inhibitory effect on both SØ5218 and the control strain, most likely as a result of the activity of the bacterial cytidine-uridine kinase. Only minor inhibition of growth was observed with ddC (C-1), which is an effective anti-HIV compound (8, 26).

View larger version (13K): [in this window] [in a new window]   FIG. 1.   Sensitivity to dFdC of E. coli expressing human dCK. Symbols: , growth of SØ5110 in the presence of 1 mM IPTG; , growth of SØ5218 in the presence of 1 mM IPTG.

View larger version (14K): [in this window] [in a new window]   FIG. 2.   Sensitivity to AraC of E. coli expressing human dCK. Symbols: , growth of SØ5110 in the presence of 1 mM IPTG; , growth of SØ5218 in the presence of 1 mM IPTG.

Growth inhibition of SØ5288 by Thd analogs. Wild-type E. coli metabolizes Thd and dUrd either anabolically through the action of TK (tdk) or catabolically through phosphorolytic cleavage catalyzed by Thd phosphorylase (deoA) and, less efficiently, by uridine phosphorylase (udp) (31). Thus, SØ5286, in which all three of the enzymes mentioned above were eliminated by mutagenesis, was used as a host for human TK1 cDNA. It was expected that SØ5286 or its derivative SØ5292, which contains the vector pTrc99-A with no insertion, would be resistant to 5-F-dUrd, but this was not the case (Fig. 3a). A possible reason for this is that uridine kinase may phosphorylate 5-F-dUrd sufficiently to cause the toxicity. Accordingly, addition of uridine to the culture made the bacteria resistant to this analog, presumably by competing with 5-F-dUrd for uridine kinase. When the cDNA for human TK1 was introduced into SØ5286, on the other hand, the resulting strain, SØ5288, was sensitive to 5-F-dUrd, irrespective of the presence of uridine (Fig. 3b). This shows that human TK was expressed in SØ5288 and that the enzyme was able to activate 5-F-dUrd to the toxic form 5-fluorodeoxy-UMP (15).

View larger version (19K): [in this window] [in a new window]   FIG. 3.   Sensitivity of E. coli strains to 5-F-dUrd in the presence of 1 mM IPTG. a, growth of SØ5292; b, growth of SØ5288. Symbols: , with 5-F-dUrd only; , with 0 to 500 nM 5-F-dUrd and 82 µM uridine.

View larger version (15K): [in this window] [in a new window]   FIG. 4.   Sensitivity to AZT of human TK1- and bacterial TK-expressing E. coli strains in the presence of 1 mM IPTG. Symbols: , growth of SØ5292; , growth of SØ5288; , growth of SØ5110; , growth of SØ5218.