Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 1998, p. 3022-3023, Vol. 42, No. 11
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Antimicrobial Susceptibilities of
Porphyromonas gingivalis, Prevotella intermedia,
and Prevotella nigrescens spp. Isolated in
Spain
María T.
Andrés,1
Whasun O.
Chung,2
Marilyn C.
Roberts,2 and
José F.
Fierro1,3,*
Laboratory of Oral Microbiology, School of
Stomatology,1 and
Department of
Functional Biology (Microbiology), Faculty of
Medicine,3 University of Oviedo, Oviedo, Spain,
and
Department of Pathobiology, University of Washington,
Seattle, Washington2
Received 27 April 1998/Returned for modification 16 July
1998/Accepted 26 August 1998
 |
ABSTRACT |
The susceptibilities of 143 Porphyromonas gingivalis,
Prevotella intermedia, and Prevotella
nigrescens isolates to 18 antimicrobial agents were tested. All
P. gingivalis isolates were susceptible. In contrast, some
Prevotella spp. (17%) were resistant to 
-lactams, erythromycin, clindamycin, or tetracycline and carried resistance genes, ermF or tetQ, or -lactamases.
| |
TEXT |
Black-pigmented, gram-negative oral
anaerobes such as Porphyromonas gingivalis and the
Prevotella intermedia-Prevotella nigrescens group are
thought to be pathogens in adult periodontitis (11). In
addition, the P. intermedia-P. nigrescens group may be
involved in both oral and nonoral infections (7, 8).
Patients who do not respond to common surgical or mechanical
periodontal therapy are often administered antibiotics as a complement
to conventional treatment (12). However, limited
susceptibility data has been available for these bacteria and no
separate breakpoints have been established by the National
Committee for Clinical Laboratory Standards (NCCLS) (9).
The purpose of this study was to examine the susceptibilities of oral
isolates of P. gingivalis and P. intermedia-P.
nigrescens to 18 antimicrobial agents and to determine if there is
a correlation between the MIC and the presence of known antibiotic
resistance genes.
A total of 143 clinical isolates were obtained from different patients
diagnosed with adult periodontitis at the School of Stomatology of the
University of Oviedo, Oviedo, Spain, between 1995 and 1997. None of the
patients had been given antibiotic therapy within the previous 6 months. The isolates were the most prevalent anaerobic species from
oral samples collected from the supragingival plaque by means of
sterile cotton pledgets and subgingival samples collected by using two
sterile paper points, which were inserted at each study site. The API
Rapid ID32 A system (bioMérieux, Marcy-l'Étoile, France)
was used for initial identification. The P. intermedia-P.
nigrescens isolates were verified with a 16S rRNA-based PCR assay,
as described by Conrads et al. (4). P. gingivalis
was also verified by PCR, as previously described (1).
The antibiotics used for susceptibility testing were as follows:
benzylpenicillin and tetracycline (Antibióticos, S.A., Madrid, Spain); amoxicillin, ampicillin, and ticarcillin (Smith Kline & French,
S.A., Madrid, Spain); piperacillin (Lederle Laboratories, Pearl River,
N.Y.); cephalothin (Lilly, S.A., Madrid, Spain); cefuroxime (Glaxo
Group Research Ltd., Greenford, United Kingdom); cefotaxime (Hoechst
Farma, S.A., Madrid, Spain); cefoxitin and imipenem (Merck Sharp & Dohme de España, Madrid, Spain); erythromycin (C.E.P.A., Madrid,
Spain); cefamandole, cephaloridine, and oleandomycin (Sigma Chemical
Co., St. Louis, Mo.); metronidazole and spiramycin (Rhône-Poulenc
Rorer, S.A., Madrid, Spain); and clindamycin (Upjohn Farmoquímica, Madrid, Spain). MICs were determined under
anaerobic conditions at 37°C by the agar dilution method described by
the NCCLS using Wilkins-Chalgren agar (Difco Laboratories, Detroit, Mich.) supplemented with 5% sterile defibrinated sheep blood
(9). Serial dilutions of the antibiotics ranging from 128 to
0.125 µg/ml were prepared and used on the same day. The final
inoculum contained approximately 105 CFU per spot. Quality
control strains (Bacteroides fragilis ATCC 25285 and
Bacteroides thetaiotaomicron ATCC 29741) were included with
each run. Plates were read at 48 h. The MIC was defined as the
lowest antimicrobial concentration which prevented visible growth of bacteria.
All 31 P. gingivalis isolates were susceptible to all of the
antibiotics tested (Table 1), which is
similar to previous findings (10). In contrast, some of the
P. intermedia and P. nigrescens isolates were
resistant to various antibiotics. We found that 14% (14 P. intermedia and 2 P. nigrescens isolates) were resistant to -lactam antibiotics (penicillins and/or some cephalosporins). Cefinase disks (BBL Microbiology Systems, Cockeysville, Md.) were used
to examine -lactamase production. All 16 isolates had -lactamase activities and had high MICs to penicillins and/or cephalosporins (Table 1). The percentage of -lactamase-positive isolates observed in the P. intermedia-P. nigrescens group (14%) was lower
than the 26% that has been reported previously (2, 14). The
MICs for the cephalosporin-resistant strains of this study were similar to those exhibited for oral isolates of P. intermedia
encoding a 2e cephalosporinase that we characterized recently
(13).
Ninety percent of P. intermedia isolates were susceptible to
erythromycin (MIC90, 1 µg/ml), oleandomycin
(MIC90, 1 µg/ml), spiramycin (MIC90, 0.125 µg/ml), and clindamycin (MIC90, 
0.125 µg/ml). All
isolates of the P. intermedia-P. nigrescens group were
susceptible to spiramycin (MIC90, 0.125 µg/ml). Although no macrolide breakpoints are currently available for these anaerobes, we found high erythromycin, oleandomycin, and clindamycin MICs for two
strains of P. nigrescens (15.4%). PCR assays for the
ermF gene were performed with primers F1
(5' CGGGTCAGCACTTTACTATTG 3') and F2
(GGACCTACCTCATAGACAAG 3'), and the PCR products were confirmed by hybridization. Both resistant isolates were positive for
the ermF gene.
Tetracycline inhibited 90% of the P. intermedia isolates
(MIC90, 1 µg/ml) and was less effective against the
isolates of P. nigrescens (MIC90, 16 µg/ml).
By a previously described PCR assay for tetQ (7),
two tetracycline-resistant P. nigrescens isolates were shown
to carry the tetQ gene; one isolate also carried the ermF gene. The incidence of tetracycline resistance observed
in this study for the P. intermedia-P. nigrescens group
(3.6%) was much lower than the 26% reported previously for
Prevotella spp. from other areas (6).
Metronidazole was highly active with the P. intermedia-P.
nigrescens group (MIC90, 0.125 µg/ml). Resistance
(32 µg/ml) was found in three isolates of P. intermedia.
All isolates were susceptible to metronidazole-spiramycin (1:1.48),
which is a combination used commonly in Spain for treatment of a
variety of dental infections. The MIC90 of this combination
(0.032 µg/ml) was much lower than the MIC90 of each
antimicrobial agent tested separately, suggesting a synergistic effect
that has been reported previously (3).
We have been able to link three classes (-lactam,
macrolide-lincosamide, and tetracycline) of antibiotic resistance with known mechanisms of resistance (-lactamases, rRNA methylases encoded
by the ermF gene, or a ribosomal protection protein encoded by the tetQ gene) in the P. intermedia-P.
nigrescens group. All three types of genes have been associated
with conjugative elements in oral Prevotella spp. (5,
15), and gene transfer between different species has been
demonstrated in the laboratory (5, 15). Thus, the P. intermedia-P. nigrescens group may function as an antibiotic
resistance gene reservoir and may influence the success of antibiotic
therapy in the oral cavity.
| |
ACKNOWLEDGMENTS |
We thank M. C. Martín for technical support.
This work was supported in part by funds from the Sterilization
Monitoring Service (CN-96-133-B1), School of Stomatology, University of Oviedo.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Functional Biology (Microbiology), Faculty of Medicine, University of Oviedo, C/Julián Clavería, s.n., 33006 Oviedo, Spain.
Phone: 34-98-5103555. Fax: 34-98-5103534. E-mail:
ffr{at}sauron.quimica.uniovi.es.
| |
REFERENCES |
| 1.
|
Benkirane, R. M.,
E. Guillot, and C. Mouton.
1995.
Immunomagnetic PCR and DNA probe for detection and identification of Porphyromonas gingivalis.
J. Clin. Microbiol.
33:2908-2912[Abstract].
|
| 2.
|
Bernal, L. A.,
E. Guillot,
C. Paquet, and C. Mouton.
1998.
-Lactamase-producing strains in the species Prevotella intermedia and Prevotella nigrescens.
Oral Microbiol. Immunol.
13:36-40[Medline].
|
| 3.
| Brook, I. 1988. Synergy between spiramycin and
metronidazole in the treatment of polymicrobial infections. J. Antimicrob. Chemother. 22(Suppl. BP):77-85.
|
| 4.
|
Conrads, G.,
K. Pelz,
B. Hughes,
I. Seyfarth, and D. A. Devine.
1997.
Optimized oligonucleotides for the differentiation of Prevotella intermedia and Prevotella nigrescens.
Oral Microbiol. Immun.
12:117-120[Medline].
|
| 5.
|
Guiney, D., and K. Bouic.
1990.
Detection of conjugal transfer systems in oral, black-pigmented Bacteroides spp.
J. Bacteriol.
172:495-497[Abstract/Free Full Text].
|
| 6.
| Jacobus, N. V., F. W. Immermann, J. M. Gupte, and R. T. Testa. 1993. Susceptibility of anaerobes in
phase 3 clinical studies of piperacillin/tazobactam. Clin. Infect. Dis.
16(Suppl. 4):S344-S348.
|
| 7.
|
Leng, Z.,
D. E. Riley,
R. E. Berger,
J. N. Krieger, and M. C. Roberts.
1997.
Distribution and mobility of the tetracycline resistant determinant tetQ.
J. Antimicrob. Chemother.
40:551-559[Abstract/Free Full Text].
|
| 8.
| Mättö, J., S. Asikainen, M.-L.
Väisänen, M. Rautio, M. Saarela, P. Summanen, S. Finegold,
and H. Jousimies-Somer. 1997. Role of Porphyromonas
gingivalis, Prevotella intermedia, and Prevotella
nigrescens in extraoral and some odontogenic infections. Clin.
Infect. Dis. 25(Suppl. 2):S194-S198.
|
| 9.
|
National Committee for Clinical Laboratory Standards.
1997.
Methods for antimicrobial susceptibility testing of anaerobic bacteria, 4th ed. Approved standard M11-A4.
National Committee for Clinical Laboratory Standards, Wayne, Pa.
|
| 10.
|
Pajukanta, R.,
S. Asikainen,
B. Forsblom,
M. Saarela, and H. Jousimies-Somer.
1993.
-Lactamase production and in vitro antimicrobial susceptibility of Porphyromonas gingivalis.
FEMS Immunol. Med. Microbiol.
6:241-244[Medline].
|
| 11.
|
Socransky, S. S.
1970.
Relationship of bacteria to the etiology of periodontal disease.
J. Dent. Res.
49:203-208[Free Full Text].
|
| 12.
|
Slots, J., and T. E. Rams.
1990.
Antibiotics in periodontal therapy: advantages and disadvantages.
J. Clin. Periodontol.
17:479-493[Medline].
|
| 13.
|
Valle, G.,
L. M. Quirós,
M. T. Andrés, and J. F. Fierro.
1998.
A -lactamase belonging to group 2e from oral clinical isolates of Prevotella intermedia.
FEMS Microbiol. Lett.
158:191-194[Medline].
|
| 14.
|
van Winkelhoff, A. J.,
E. G. Winkel,
D. Barendregt,
N. Dellemijn-Kippuw,
A. Stijne, and U. van der Velden.
1997.
-Lactamase producing bacteria in adult periodontitis.
J. Clin. Periodontol.
24:538-543[Medline].
|
| 15.
| Walker, C. B., and L. C. Bueno. 1997. Antibiotic resistance in an oral isolate of Prevotella
intermedia. Clin. Infect. Dis. 25(Suppl.
2):S281-S283.
|
Antimicrobial Agents and Chemotherapy, November 1998, p. 3022-3023, Vol. 42, No. 11
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liu, C.-Y., Huang, Y.-T., Liao, C.-H., Yen, L.-C., Lin, H.-Y., Hsueh, P.-R.
(2008). Increasing Trends in Antimicrobial Resistance among Clinically Important Anaerobes and Bacteroides fragilis Isolates Causing Nosocomial Infections: Emerging Resistance to Carbapenems. Antimicrob. Agents Chemother.
52: 3161-3168
[Abstract]
[Full Text]
-
Nagano, K., Murakami, Y., Nishikawa, K., Sakakibara, J., Shimozato, K., Yoshimura, F.
(2007). Characterization of RagA and RagB in Porphyromonas gingivalis: study using gene-deletion mutants. J Med Microbiol
56: 1536-1548
[Abstract]
[Full Text]
-
Sweeney, L. C., Dave, J., Chambers, P. A., Heritage, J.
(2004). Antibiotic resistance in general dental practice--a cause for concern?. J Antimicrob Chemother
53: 567-576
[Abstract]
[Full Text]
-
Whittle, G., Whitehead, T. R., Hamburger, N., Shoemaker, N. B., Cotta, M. A., Salyers, A. A.
(2003). Identification of a New Ribosomal Protection Type of Tetracycline Resistance Gene, tet(36), from Swine Manure Pits. Appl. Environ. Microbiol.
69: 4151-4158
[Abstract]
[Full Text]
-
Handal, T., Caugant, D. A., Olsen, I.
(2003). Antibiotic Resistance in Bacteria Isolated from Subgingival Plaque in a Norwegian Population with Refractory Marginal Periodontitis. Antimicrob. Agents Chemother.
47: 1443-1446
[Abstract]
[Full Text]
-
Teng, L.-J., Hsueh, P.-R., Tsai, J.-C., Liaw, S.-J., Ho, S.-W., Luh, K.-T.
(2002). High Incidence of Cefoxitin and Clindamycin Resistance among Anaerobes in Taiwan. Antimicrob. Agents Chemother.
46: 2908-2913
[Abstract]
[Full Text]
-
Madinier, I., Fosse, T., Giudicelli, J., Labia, R.
(2001). Cloning and Biochemical Characterization of a Class A {beta}-Lactamase from Prevotella intermedia. Antimicrob. Agents Chemother.
45: 2386-2389
[Abstract]
[Full Text]
-
Chopra, I., Roberts, M.
(2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev.
65: 232-260
[Abstract]
[Full Text]
Top
Abstract
Text
