This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marchese, A.
Right arrow Articles by Philippon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchese, A.
Right arrow Articles by Philippon, A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, February 1998, p. 464-467, Vol. 42, No. 2
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Characterization of FOX-3, an AmpC-Type Plasmid-Mediated beta -Lactamase from an Italian Isolate of Klebsiella oxytoca

Anna Marchese,1 Guillaume Arlet,2,* Gian Carlo Schito,1 Philippe H. Lagrange,2 and Alain Philippon2

Istituto Di Microbiologia, 16132 Genoa, Italy,1 and Service de Microbiologie, Hôpital Saint-Louis, 75475 Paris, France2

Received 10 April 1997/Returned for modification 12 August 1997/Accepted 24 November 1997

    ABSTRACT
Top
Abstract
Text
References

Klebsiella oxytoca 1731, which showed a wide spectrum of resistance to beta -lactams, including cefoxitin, was isolated in 1994 from a patient in Genoa, Italy. This strain contained a plasmid-mediated AmpC beta -lactamase with a pI of 7.25. Sequencing of the corresponding DNA of K. oxytoca 1731 revealed 96 and 97% identities of the deduced amino acid sequence with FOX-1 and FOX-2, respectively.

    TEXT
Top
Abstract
Text
References

Chromosomal group 1 beta -lactamases (class C of Ambler) produced by gram-negative bacteria such as Enterobacter spp., Serratia spp., Citrobacter spp., and Morganella spp. can hydrolyze many beta -lactam antibiotics, including cephamycins and extended broad-spectrum cephalosporins (8). In recent years ampC genes have been found mainly in conjugative plasmids and among Klebsiella pneumoniae isolates and occasionally among Escherichia coli isolates. ampC genes encode a variety of enzymes, including MIR-1 (20), CMY-1 (5), CMY-2 (4), BIL-1 (21, 28), MOX-1 (12), LAT-1 (25), FOX-1 (10), LAT-2 (9), FOX-2 (6), and ACT-1 (7); some of them are highly related to chromosomal AmpC of Citrobacter freundii, such as BIL-1, LAT-1, LAT-2, and CMY-2, or of Enterobacter cloacae, such as MIR-1 and ACT-1. Bacteria that harbor AmpC plasmids have antibiotic susceptibility patterns which are similar to those of strains overproducing chromosomally encoded beta -lactamase (15).

In this study we characterize an AmpC-type plasmid-mediated beta -lactamase isolated from Klebsiella oxytoca 1731 in Italy. This strain was isolated from a vaginal swab of one patient and was collected in 1994 during a European multicenter survey of the incidence of Klebsiella spp. carrying extended-spectrum beta -lactamases in intensive care units (16). Furthermore, a strain of K. pneumoniae 1734 with the same resistance pattern was isolated from a urine specimen of another patient. Both patients were admitted to the same intensive care unit at the University Hospital of Genoa at the end of 1994. For treatment these patients received piperacillin, and one patient received in addition imipenem.

The minimal inhibitory concentrations (MICs) of beta -lactams alone or in combination with clavulanate (4 µg/ml) were determined by the agar dilution technique recommended by the National Committee for Clinical Laboratory Standards (19). The antibiotic resistance phenotypes of the donor strains K. oxytoca 1731 and K. pneumoniae 1734 are shown in Table 1. The MICs of cefoxitin, cefotaxime, ceftazidime, and aztreonam remained unchanged despite the addition of clavulanate, whereas the MICs of the two penicillins (amoxicillin and ticarcillin) were substantially reduced.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   In vitro beta -lactam susceptibilities of K. oxytoca 1731 and K. pneumoniae 1734 and their transconjugants and the E. coli J53-2 recipient

Several E. coli J53-2 rif-R transconjugants were selected on MacConkey agar plates supplemented with rifampin (200 µg/ml) and cefoxitin (10 µg/ml) or ceftazidime (2 µg/ml) or ticarcillin (100 µg/ml). Because of the multiresistance profile of the two donor strains, plates supplemented with tetracycline (15 µg/ml) or kanamycin (25 µg/ml) were also prepared (18). All the transconjugants selected on these antibiotics showed a resistance phenotype similar to that of their respective donor strains. These profiles were characterized by resistance to expanded-spectrum cephalosporins and cefoxitin alone or in combination with clavulanate (Table 1) and to tetracycline and kanamycin.

Plasmid DNAs from K. oxytoca 1731 and two transconjugants were prepared by the alkaline extraction method (14). Analysis of plasmid DNA by electrophoresis in 0.8% agarose gels with Tris-borate-EDTA buffer revealed one large plasmid of about 130 kb common to all strains (data not shown). Analytical isoelectric focusing was performed in polyacrylamide gels with sonicated crude cell extracts as described previously (18). Two bands of beta -lactamase activity (pI 5.4 and 7.25, respectively) were detected in K. oxytoca 1731 and its transconjugants.

The molecular characterization of the pI 5.4 beta -lactamase produced by K. oxytoca 1731 was performed by PCR-restriction fragment length polymorphism, as previously described (3). With Sau3AI, BclI, BpmI, HpaII, HphI, and MseI as endonucleases, no point mutations were detected in comparison with the beta -lactamase tem-1 gene (pBR322). Therefore, this enzyme was identified as a TEM-1 beta -lactamase and was probably responsible for the resistance to ticarcillin and amoxicillin and explains the reduction of the MICs of these two penicillins observed in the presence of clavulanate.

The characterization of the beta -lactamase with a pI of 7.25 from the transconjugant EC1731 was determined after purification as described by Iaconis and Sanders (13). The substrate profile of the pI 7.25 beta -lactamase of the transconjugant EC1731 was assessed by the spectrophotometric method (26) by using a Biochrom 4060 spectrophotometer (Pharmacia LKB Biotechnology) at 37°C and freshly prepared antibiotic solutions in 0.05 M phosphate buffer (pH 7.0). The molecular extinction coefficients were calculated as previously described (24), and the maximum rate of hydrolysis (Vmax) was determined by the Lineweaver-Burk plot of initial velocity (v) at six different substrate concentrations. The maximal change in absorbance of the substrates was monitored as follows (in nm): cephaloridine, 260; cephalothin, 270; cefoxitin, 265; cefotaxime, 254; ceftazidime, 254; aztreonam, 292; benzylpenicillin, 232; and nitrocefin, 482. Specific activity was defined as micromoles of nitrocefin hydrolyzed per minute per microgram of protein. Protein concentration was determined by the method of Lowry et al. (17). The purified beta -lactamase of pI 7.25 from EC1731 showed high rates of hydrolysis for cephaloridine and cephalothin and low rates of hydrolysis for benzylpenicillin, cefoxitin, cefotaxime, ceftazidime, and aztreonam (Table 2). The susceptibility to inhibition was determined by preincubating the enzyme with various concentrations of inhibitors for 10 min. Nitrocefin was then added as the substrate, and residual enzyme activity was measured. The concentration of inhibitors required for 50% inhibition of enzyme activity was defined as the IC50. The purified beta -lactamase of pI 7.25 from EC1731 was strongly inhibited by cloxacillin (IC50 = 0.02 µM) and aztreonam (IC50 = 0.0015 µM) and by relatively high concentrations of clavulanate (IC50 = 3 µM). The enzyme from EC1731 had kinetic parameters (Km and Vmax values) that were very similar to those of FOX-1 variants (10). The Vmaxs for cefoxitin, cefotaxime, ceftazidime, and aztreonam were very low. However, the high affinity of the enzyme for these antibiotics might compensate for the slow hydrolysis rates, and this might result in resistance as observed with K. oxytoca 1731. Very low values of Vmax for cefoxitin (0.008 and 0.003) have also been described for FOX-1 variants (10). The IC50s of clavulanate, cloxacillin, and aztreonam were in agreement with values reported for other plasmid-mediated AmpC-type beta -lactamases (12, 20, 25) and were similar to values reported for FOX-1 (10).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Kinetic constants of the FOX-3 beta -lactamase produced by EC1731

To amplify the ampC gene of K. oxytoca 1731, degenerate oligonucleotide primers were designed from consensus sequences from the ampC genes of E. coli, E. cloacae, and C. freundii (A1, A2) and from the ampC genes of Serratia marcescens and those encoding MOX-1 and FOX-1 (B1, B2). The sequences of the primers are as follows: ampC A1, 5' GGAATTCCTWTGCTGCGCBCTGCTGCT 3'; ampC A2, 5' CGGGATCCCTGCCAGTTTTGATAAAA 3'; ampC B1, 5' GGAATTCCTCASCGAGCAGACSCTGTT 3'; and ampC B2, 5' CGGGATCCCCCGCACMTKAYRTAGGTGTGG 3' (W = A or T; B = C, G, or T; S = G or C; M = A or C; K = G or T; Y = C or T; R = A or G). DNA sequencing was performed by the procedure of Sanger et al. (23) by using oligonucleotide primers, fluorescent dye-labeled dideoxynucleotides, Taq polymerase, and an ABI 373A DNA sequencer (Applied Biosystems, Foster City, Calif.).

The BLAST (1, 2) and FASTA programs were used to search databases for similar nucleotide and amino acid sequences. The Clustal V program (11) was used for the alignment of multiple protein sequences.

A fragment of 410 bp was obtained from K. oxytoca by PCR with ampC B1 and ampC B2 primers, and its sequence was determined. Comparison to sequences in the databases showed high sequence identities with the genes encoding FOX-1 and FOX-2 beta -lactamases. Subsequent DNA amplifications of the ampC gene of K. oxytoca 1731 were performed with the new primer UT7 FOX (5' TAATACGACTCACTATAGGGAAATGCAACAACGACGTGCG 3') and LT3 FOX (5' ATTAACCCTCACTAAAGGGAAATCACTCGGCCAACT GACT 3'). These primers contained the T7 (UT7 FOX) and the T3 (LT3 FOX) RNA polymerase promoter sequences. The DNA amplified by these primers encoded the entire mature protein of the FOX-1 beta -lactamase. Two different PCR products, obtained from two separate PCRs, were sequenced by using the T7 and T3 primers and revealed a 1,149-bp open reading frame that had 96% nucleotide sequence identity to the plasmid-mediated beta -lactamase FOX-1. The putative amino acid sequence was 96 and 97% identical to the amino acid sequences of plasmid-encoded FOX-1 and FOX-2, respectively (6, 10), and 75 to 74% identical to Aeromonas sobria chromosomal beta -lactamases (22, 27) (Table 3). Comparison with sequences of eight plasmid-mediated class C beta -lactamases revealed the presence of conserved motifs characteristic of serine beta -lactamases, such as the box II (SVSK) and the box VII with a KTG domain, and the class C typical motif YXN (Fig. 1). These results confirmed that this beta -lactamase was of the AmpC type and was homologous to the FOX-1 beta -lactamase isolated in Argentina (10) and the FOX-2 originating from Guatemala (6). We propose that this enzyme should be named FOX-3.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 3.   Amino acid sequence identities of FOX-3, eight plasmid-encoded beta -lactamases, and the A. sobria class C beta -lactamases AER14 and CEPSa


View larger version (31K):
[in this window]
[in a new window]
  		FIG. 1.   Alignment of the deduced amino acid sequences of FOX-1, FOX-2, and FOX-3 beta -lactamases. Only amino acid substitutions are reported for FOX-2 and FOX-3. Boldface letters indicate conserved amino acid motifs for the active site of serine beta -lactamases and AmpC beta -lactamases.

Because of the possibly related origins of such enzymes, the gene encoding the FOX-3 beta -lactamase was detected in K. pneumoniae 1734 by using the same degenerate oligonucleotides (ampC B1 and ampC B2 primers). One hundred percent identity (410 bp) was observed with the corresponding sequence of K. oxytoca. The two patients from which the bacteria were isolated had no contact with Argentina or Guatemala or with people from those countries.

Nucleotide sequence accession number. The EMBL accession number for the nucleotide sequence reported in this paper is Y11068.

    ACKNOWLEDGMENTS

This investigation was supported in part by a FATMA grant (17/93.00241) from the Italian National Research Council.

    FOOTNOTES

* Corresponding author. Mailing address: Hôpital Saint-Louis, Laboratoire de Microbiologie, 1 ave. Claude Vellefaux, 75475 Paris Cedex 10, France. Phone: 33 (0)1 42 49 94 87. Fax: 33 (0)1 42 49 94 86. E-mail: a.philippon{at}chu-stlouis.fr.

    REFERENCES
Top
Abstract
Text
References

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
2. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].
3. Arlet, G., G. Brami, D. Decré, A. Flippo, O. Gaillot, P. H. Lagrange, and A. Philippon. 1995. Molecular characterisation by PCR-RFLP of TEM beta -lactamases. FEMS Microbiol. Lett. 134:203-208[Medline].
4. Bauernfeind, A., I. Stemplinger, R. Jungwirth, and H. Giamarellou. 1996. Characterization of the plasmidic beta -lactamase CMY-2, which is responsible for cephamycin resistance. Antimicrob. Agents Chemother. 40:221-224[Abstract].
5. Bauernfeind, A., I. Stemplinger, R. Jungwirth, R. Wilhelm, and Y. Chong. 1996. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta -lactamase genes. Antimicrob. Agents Chemother. 40:1926-1930[Abstract].
6. Bauernfeind, A., S. Wagner, R. Jungwirth, I. Schneider, and D. Meyer. 1997. A novel class C beta -lactamase (FOX-2) in Escherichia coli conferring resistance to cephamycins. Antimicrob. Agents Chemother. 41:2041-2046[Abstract].
7. Bradford, P. A., C. Urban, N. Mariano, S. J. Projan, J. J. Rahal, and K. Bush. 1997. Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta -lactamase, and the loss of an outer membrane protein. Antimicrob. Agents Chemother. 41:563-569[Abstract].
8. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for beta -lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233[Medline].
9. Gazouli, M., L. S. Tzouvelekis, E. Prinarakis, V. Miriagou, and E. Tzelepi. 1996. Transferable cefoxitin resistance in enterobacteria from Greek hospitals and characterization of a plasmid-mediated group 1 beta -lactamase (LAT-2). Antimicrob. Agents Chemother. 40:1736-1740[Abstract].
10. Gonzalez Leiza, M., J. C. Perez-Diaz, J. Ayala, J. M. Casellas, J. Martinez-Beltran, K. Bush, and F. Baquero. 1994. Gene sequence and biochemical characterization of FOX-I from Klebsiella pneumoniae, a new AmpC-type plasmid-mediated beta -lactamase with two molecular variants. Antimicrob. Agents Chemother. 38:2150-2157[Abstract/Free Full Text].
11. Higgins, D. G., A. J. Bleasby, and R. Fuchs. 1992. Clustal V: improved software for multiple alignments. Cabios 8:189-191[Abstract/Free Full Text].
12. Horii, T., Y. Arakawa, M. Ohta, S. Ichiyama, R. Wacharotayankun, and N. Kato. 1993. Plasmid-mediated AmpC-type beta -lactamase isolated from Klebsiella pneumoniae confers resistance to broad-spectrum beta -lactams, including moxalactam. Antimicrob. Agents Chemother. 37:984-990[Abstract/Free Full Text].
13. Iaconis, J. P., and C. C. Sanders. 1990. Purification and characterization of inducible lactamases in Aeromonas spp. Antimicrob. Agents Chemother. 34:44-51[Abstract/Free Full Text].
14. Kado, C. I., and S. T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365-1373[Abstract/Free Full Text].
15. Lawrence, E. B., and A. J. Godfrey. 1991. beta -lactam antibiotics: mode of action and bacterial resistance, p. 646. In V. Lorian (ed.), Antibiotics in laboratory medicine. Williams and Wilkins, Baltimore, Md.
16. Livermore, D. M., and M. Yuan. 1996. Antibiotic resistance and production of extended spectrum beta -lactamases amongst Klebsiella spp. from intensive care units in Europe. J. Antimicrob. Chemother. 38:409-424[Abstract/Free Full Text].
17. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275[Free Full Text].
18. Marchese, A., G. Arlet, G. C. Schito, P. H. Lagrange, and A. Philippon. 1996. Detection of SHV-5 extended-spectrum beta-lactamase in Klebsiella pneumoniae strains isolated in Italy. Eur. J. Clin. Microbiol. Infect. Dis. 15:245-248[Medline].
19. National Committee for Clinical Laboratory Standards. 1995. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 3rd ed. Approved standard M7-A3. National Committee for Clinical Laboratory Standards, Villanova, Pa.
20. Papanicolaou, G. A., A. A. Medeiros, and G. A. Jacoby. 1990. Novel plasmid-mediated beta -lactamase (MIR-1) conferring resistance to oxyimino- and alpha -methoxy beta -lactams in clinical isolates of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 34:2200-2209[Abstract/Free Full Text].
21. Payne, D. J., N. Woodford, and S. G. B. Amyes. 1992. Characterization of the plasmid-mediated beta -lactamase BIL-1. J. Antimicrob. Chemother. 30:119-127[Abstract/Free Full Text].
22. Rasmussen, B. A., D. Keeney, Y. Yang, and K. Bush. 1994. Cloning and expression of a cloxacillin-hydrolyzing enzyme and a cephalosporinase from Aeromonas sobria AER 14M in Escherichia coli: requirement for an E. coli chromosomal mutation for efficient expression of the class D enzyme. Antimicrob. Agents Chemother. 38:2078-2085[Abstract/Free Full Text].
23. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
24. Seeberg, A. H., R. M. Tolxdorff-Neutzling, and B. Wiedemann. 1983. Chromosomal beta -lactamases of Enterobacter cloacae are responsible for resistance to third-generation cephalosporins. Antimicrob. Agents Chemother. 23:918-925[Abstract/Free Full Text].
25. Tzouvelekis, L. S., E. Tzelepi, A. F. Mentis, and A. Tsakris. 1993. Identification of a novel plasmid-mediated beta -lactamase with chromosomal cephalosporinase characteristics from Klebsiella pneumoniae. J. Antimicrob. Chemother. 31:645-654[Abstract/Free Full Text].
26. Waley, S. 1984. A spectrophotometric assay of beta -lactamase action on penicillins. Biochem. J. 139:789-790.
27. Walsh, T. R., L. Hall, A. P. MacGowan, and P. M. Bennett. 1995. Sequence analysis of two chromosomally mediated inducible beta-lactamases from Aeromonas sobria, strain 163a, one a class D penicillinase, the other an AmpC cephalosporinase. J. Antimicrob. Chemother. 36:41-52[Abstract/Free Full Text].
28. Woodford, N., D. J. Payne, A. P. Johnson, M. J. Weinbren, R. M. Perinpanayagam, R. C. George, B. D. Cookson, and S. G. B. Amyes. 1990. Transferable cephalosporin resistance not inhibited by clavulanate in Escherichia coli. Lancet 336:253[Medline].

Antimicrobial Agents and Chemotherapy, February 1998, p. 464-467, Vol. 42, No. 2
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Ruppe, E., Bidet, P., Verdet, C., Arlet, G., Bingen, E. (2006). First Detection of the Ambler Class C 1 AmpC {beta}-Lactamase in Citrobacter freundii by a New, Simple Double-Disk Synergy Test. J. Clin. Microbiol. 44: 4204-4207 [Abstract] [Full Text]  
  • Jacoby, G. A., Walsh, K. E., Walker, V. J. (2006). Identification of Extended-Spectrum, AmpC, and Carbapenem- Hydrolyzing {beta}-Lactamases in Escherichia coli and Klebsiella pneumoniae by Disk Tests.. J. Clin. Microbiol. 44: 1971-1976 [Abstract] [Full Text]  
  • Reisbig, M. D., Hanson, N. D. (2004). Promoter Sequences Necessary for High-Level Expression of the Plasmid-Associated ampC {beta}-Lactamase Gene blaMIR-1. Antimicrob. Agents Chemother. 48: 4177-4182 [Abstract] [Full Text]  
  • Jeong, S. H., Bae, I. K., Lee, J. H., Sohn, S. G., Kang, G. H., Jeon, G. J., Kim, Y. H., Jeong, B. C., Lee, S. H. (2004). Molecular Characterization of Extended-Spectrum Beta-Lactamases Produced by Clinical Isolates of Klebsiella pneumoniae and Escherichia coli from a Korean Nationwide Survey. J. Clin. Microbiol. 42: 2902-2906 [Abstract] [Full Text]  
  • Brinas, L., Zarazaga, M., Saenz, Y., Ruiz-Larrea, F., Torres, C. (2002). {beta}-Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals. Antimicrob. Agents Chemother. 46: 3156-3163 [Abstract] [Full Text]  
  • Raskine, L., Borrel, I., Barnaud, G., Boyer, S., Hanau-Bercot, B., Gravisse, J., Labia, R., Arlet, G., Sanson-Le-Pors, M.-J. (2002). Novel Plasmid-Encoded Class C {beta}-Lactamase (MOX-2) in Klebsiella pneumoniae from Greece. Antimicrob. Agents Chemother. 46: 2262-2265 [Abstract] [Full Text]  
  • Sabate, M., Miro, E., Navarro, F., Verges, C., Aliaga, R., Mirelis, B., Prats, G. (2002). {beta}-Lactamases involved in resistance to broad-spectrum cephalosporins in Escherichia coli and Klebsiella spp. clinical isolates collected between 1994 and 1996, in Barcelona (Spain). J Antimicrob Chemother 49: 989-997 [Abstract] [Full Text]  
  • Perez-Perez, F. J., Hanson, N. D. (2002). Detection of Plasmid-Mediated AmpC {beta}-Lactamase Genes in Clinical Isolates by Using Multiplex PCR. J. Clin. Microbiol. 40: 2153-2162 [Abstract] [Full Text]  
  • Lee, S. H., Kim, J. Y., Lee, G. S., Cheon, S. H., An, Y. J., Jeong, S. H., Lee, K. J. (2002). Characterization of blaCMY-11, an AmpC-type plasmid-mediated {beta}-lactamase gene in a Korean clinical isolate of Escherichia coli. J Antimicrob Chemother 49: 269-273 [Abstract] [Full Text]  
  • Philippon, A., Arlet, G., Jacoby, G. A. (2002). Plasmid-Determined AmpC-Type {beta}-Lactamases. Antimicrob. Agents Chemother. 46: 1-11 [Full Text]  
  • Zhang, Z., Yu, Y., Musser, J. M., Palzkill, T. (2001). Amino Acid Sequence Determinants of Extended Spectrum Cephalosporin Hydrolysis by the Class C P99 beta -Lactamase. J. Biol. Chem. 276: 46568-46574 [Abstract] [Full Text]  
  • Queenan, A. M., Jenkins, S., Bush, K. (2001). Cloning and Biochemical Characterization of FOX-5, an AmpC-Type Plasmid-Encoded beta -Lactamase from a New York City Klebsiella pneumoniae Clinical Isolate. Antimicrob. Agents Chemother. 45: 3189-3194 [Abstract] [Full Text]  
  • Navarro, F., Perez-Trallero, E., Marimon, J. M., Aliaga, R., Gomariz, M., Mirelis, B. (2001). CMY-2-producing Salmonella enterica, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis and Escherichia coli strains isolated in Spain (October 1999-December 2000). J Antimicrob Chemother 48: 383-389 [Abstract] [Full Text]  
  • Petrella, S., Clermont, D., Casin, I., Jarlier, V., Sougakoff, W. (2001). Novel Class A {beta}-Lactamase Sed-1 from Citrobacter sedlakii: Genetic Diversity of {beta}-Lactamases within the Citrobacter Genus. Antimicrob. Agents Chemother. 45: 2287-2298 [Abstract] [Full Text]  
  • Bou, G., Oliver, A., Ojeda, M., Monzón, C., Martínez-Beltrán, J. (2000). Molecular Characterization of FOX-4, a New AmpC-Type Plasmid-Mediated beta -Lactamase from an Escherichia coli Strain Isolated in Spain. Antimicrob. Agents Chemother. 44: 2549-2553 [Abstract] [Full Text]  
  • Woodford, N., Palepou, M.-F. I., Babini, G. S., Holmes, B., Livermore, D. M. (2000). Carbapenemases of Chryseobacterium (Flavobacterium) meningosepticum: Distribution of blaB and Characterization of a Novel Metallo-beta -Lactamase Gene, blaB3, in the Type Strain, NCTC 10016. Antimicrob. Agents Chemother. 44: 1448-1452 [Abstract] [Full Text]  
  • Bou, G., Martínez-Beltrán, J. (2000). Cloning, Nucleotide Sequencing, and Analysis of the Gene Encoding an AmpC beta -Lactamase in Acinetobacter baumannii. Antimicrob. Agents Chemother. 44: 428-432 [Abstract] [Full Text]  
  • Bauernfeind, A., Schneider, I., Jungwirth, R., Sahly, H., Ullmann, U. (1999). A Novel Type of AmpC beta -Lactamase, ACC-1, Produced by a Klebsiella pneumoniae Strain Causing Nosocomial Pneumonia. Antimicrob. Agents Chemother. 43: 1924-1931 [Abstract] [Full Text]  
  • Trépanier, S., Knox, J. R., Clairoux, N., Sanschagrin, F., Levesque, R. C., Huletsky, A. (1999). Structure-Function Studies of Ser-289 in the Class C beta -Lactamase from Enterobacter cloacae P99. Antimicrob. Agents Chemother. 43: 543-548 [Abstract] [Full Text]  
  • Barnaud, G., Arlet, G., Verdet, C., Gaillot, O., Lagrange, P. H., Philippon, A. (1998). Salmonella enteritidis: AmpC Plasmid-Mediated Inducible beta -Lactamase (DHA-1) with an ampR Gene from Morganella morganii. Antimicrob. Agents Chemother. 42: 2352-2358 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marchese, A.
Right arrow Articles by Philippon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchese, A.
Right arrow Articles by Philippon, A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»