INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The penicillin-binding proteins (PBPs) are membrane-bound serine transferases involved in wall peptidoglycan synthesis. Penicillin inactivates the PBPs in the form of stable serine ester-linked penicilloyl enzymes (14).

Resistance to penicillin in the absence of -lactamase production can be mediated by PBPs. Enterococci gain resistance either by the overproduction of a constitutive low-affinity PBP (11, 12) or by a further reduction of the affinity of that PBP (19, 41). In some resistant enterococcal strains, two low-affinity PBPs may be present at the same time (27, 38). Resistance among staphylococci occurs by acquisition of a single PBP which has a low affinity for all the usual -lactam antibiotics (5, 16) and has probably originated from another species within the genus Staphylococcus (39). The low-affinity PBPs confer penicillin resistance because they are able to perform the functions needed for wall peptidoglycan synthesis under conditions in which all the other PBPs are inactivated (5, 11, 16, 38).

Enterococcus hirae ATCC 9790 is moderately resistant to benzylpenicillin and produces a chromosome-encoded low-affinity PBP, PBP5 (9, 11). Overproduction of PBP5 in the highly penicillin-resistant laboratory mutant E. hirae R40 has been related to the inactivation of a negative regulatory gene psr that is located immediately upstream from pbp5 and that encodes a 33-kDa protein (20, 22).

E. hirae S185, a clinical isolate from pig intestine, produces two low-affinity PBPs, PBP5 and PBP3r (27, 28). Chemical mutagenesis of E. hirae S185 has led to the isolation of a penicillin hypersusceptible mutant, E. hirae SS22, which still produces very low levels of PBP5 but which has lost the capacity to produce PBP3r (28). Conversely, six successive passages of E. hirae S185 in broth containing benzylpenicillin (32 µg/ml) has led to the isolation of a penicillin-resistant mutant, E. hirae S185R, which selectively overproduces PBP3r (28). PBP5 and PBP3r of E. hirae S185 and S185R are structurally related to each other (78.5% amino acid sequence identity) and to the low-affinity PBP, PBP2', of methicillin-resistant Staphylococcus aureus (33% amino acid sequence identity). In addition, PBP3r is almost identical (99.8% amino acid sequence identity) to PBP5fm found in Enterococcus faecium strains (41).

Comparison of the E. hirae wild-type strains and mutants with respect to their susceptibilities to benzylpenicillin and erythromycin suggested that pbp3r, but not pbp5, might be linked to an erythromycin resistance determinant, erm (28). The aim of the study described in this paper is to show that E. hirae S185R possesses a plasmid-borne pbp3r gene linked to two resistance determinants, those for resistance to erythromycin and streptomycin, respectively.

(The work described in this paper is part of a dissertation presented by D.R. in partial fulfilment of a Ph.D. at the University of Liège.)

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Bacterial strains, plasmids, oligonucleotides, and enzymes. E. hirae S185, SS22, and S185R were grown as described previously (27, 28). Strain S185 was shown to belong to the E. hirae species by using the API 20 Strep and API Staph test kits (BioMérieux, Marcy l'Etoile, France) and by analyzing the PBP patterns in comparison with those of the type strains of different species. In all cases, strain S185 behaved exactly like the E. hirae type strain, ATCC 9790. By a similar approach, strains D63 and D63R were shown to belong to the species E. faecium.

DNA preparations. Plasmids of Escherichia coli were prepared as described previously (28) or by using the Nucleobond kit (Macherey and Nagel, Düren, Germany). Plasmids of E. hirae S185, SS22, and S185R each were prepared by using the method of Anderson and McKay (1), which was modified as follows. Cells were grown in 100 ml of brain heart medium for 4 to 5 h (optical density at 550 nm = 2), harvested by centrifugation, and resuspended in 5 ml of 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-25% (wt/vol) sucrose-7 mg of lysozyme per ml-1 µg of mutanolysin per ml, and the suspension was incubated at 37°C for 15 min. The lysate was centrifuged for 10 min at 9,000 × g, and the pellet was resuspended in 1.5 ml of Tris-EDTA buffer. The suspension was supplemented with 1 ml of a 5% (wt/vol) sodium dodecyl sulfate (SDS) solution in Tris-EDTA buffer. After gentle mixing, the solution was incubated for 20 min at 37°C. The alkaline denaturation was performed as described by Currier and Nester (8), followed by phenol-chloroform extractions and ethanol precipitation.

Nucleotide sequencing. Nucleotide sequencing was carried out as described by Sanger et al. (33) with M13 universal and reverse oligonucleotides or oligonucleotides complementary to inserts as primers. Denaturation of double-stranded DNA was performed as described by Zhang et al. (40). Sequencing reactions were carried out by using the Sequenase kit (United States Biochemicals, Cleveland, Ohio), the T7 sequencing kit (Pharmacia Biotech, Brussels, Belgium) with [³⁵S]dATP labeling, or the Autoread sequencing kit (Pharmacia Biotech) with fluorescent primers or by the incorporation of fluorescent dUTP. For the sequencing reactions with the Autoread kit, electrophoresis was performed with an ALFexpress DNA sequencer (Pharmacia Biotech) (2).

Oligonucleotides and hybridization. The oligonucleotides were synthesized by Eurogentec (Seraing, Belgium). Their positions are indicated in Fig. 1A and B. Oligonucleotides GCAGGAATGGCATCGAAAAAGGCAG (O1) and GCGGAAATCAAAGAAAAACAGG (O2) started 193 and 1,861 bp from the ATG of pbp3r, respectively. Oligonucleotide CCGCTAGGTTCTGTTGCAAAGTT (O3), designated an IS1216 repeat, started 80 bp upstream from the ATG of the transposase-encoding gene, tnp. The boxed sequence followed by a T is the sequence of the 18-bp IS1216 repeats. Oligonucleotides GGGCATTTAACGACGAAACTGGCTA (O4) and ACCTCTGTTTGTTAGGGAATTGAAA (O5) started 120 and 283 bp from the ATG of the ermAM gene of Enterococcus faecalis pAM1, respectively. Oligonucleotide O5 was based on the sequence of the complementary strand.

Slot blot hybridization. Samples (62.5, 125, 250, and 500 ng) of DNA preparations (denatured at 95°C for 10 min) were deposited on a nylon membrane in a Bio-Dot SF blotting microfiltration unit (Bio-Rad, Richmond, Calif.). The DNA samples were bound to the membrane by exposure to UV light (312 nm) for 3 min. Hybridization with oligonucleotide O1 (pbp3r) was performed as described above. Quantification of the hybridization bands was done by two-dimensional densitometry of pictures taken with a video camera and processed with CAM software (Cybertech-Dalton, Berlin, Germany).

Homology searches. Searches of the protein and DNA sequence databases were performed as described by Pearson and Lipman (26) by using the FASTA and TFASTA software packages. Alignments of nucleotide and amino acid sequences were made with BESTFIT according to the algorithm of Smith and Waterman (36) (GCG package).

Nucleotide sequence accession number. The EMBL accession number for the sequence of the 4.5-kb NcoI insert of pDML501 is X69092, that for the sequence of IS1216 inserted in pDML501 is X81654, and that for the sequence of ermAMEH, the ermAM found in E. hirae S185, is X81655.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

The pbp3r-containing 4.5-kb DNA insert of pDML501 possesses a psr3r gene and an insertion module IS1216. It was previously shown that pbp3r is located in the middle of the 4.5-kb NcoI insert of pDML501 (28). Sequencing of the complete insert confirmed the restriction map shown in Fig. 1A. It also led to the identification, 417 bp upstream from pbp3r, of a 517-bp open reading frame (ORF) that was identical to the 597-bp psr gene of E. faecium D63R (psrfm) except that it lacked the first 80 bp (41). In all likelihood, the missing 80 bp at the 5' end of psr3r of the 4.5-kb NcoI fragment of pDML501 was lost by restriction during cloning since a complete 597-bp gene, called psr3r, was subsequently identified at one end of a 4.5-kb pbp3r-containing EcoRI fragment cloned in pDML510 from a genomic library of E. hirae S185R (28). The sequence of psr3r was identical to that of psrfm. In both cases, the ATG codons each occurred 10 bp downstream from the first nucleotide of the EcoRI site and 80 bp upstream from the first nucleotide of the NcoI site (41).

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Restriction maps of the 4.5-kb insert of pDML501 (A) and the 14-kb NcoI insert of pDML508 (B). The restriction and probe hybridization sites shown are only those necessary to understand the products generated by restriction and PCR experiments. The brackets above the maps represent the PCR products. The restriction sites are indicated by the following letters: A, AccI; C, ClaI; H, HindIII; and S, ScaI. Broken arrows identify the DNA regions whose sequences are known.

View larger version (9K): [in this window] [in a new window]   FIG. 2.   Comparison of the pbp3r and pbp5fm loci in E. hirae S185R and E. faecium D63R, respectively. The scheme highlights the genes and DNA regions that are identical in both strains. The 1.2-kb insert of E. faecium D63R is hatched.

The 14-kb DNA insert of pDML508 has a pbp3r gene adjacent to a transposon-like structure that carries erythromycin and streptomycin resistance markers. The 14-kb insert of pDML508, the restriction map of which is also shown in Fig. 1B, comprises three regions, as described below.

View larger version (11K): [in this window] [in a new window]   FIG. 3.   Comparison of the 30-bp sequences identified immediately upstream and downstream from each of the IS1216 elements.

Amplification of the sequence pbp3r-IS1216 of E. hirae S185R. As described below, restriction digestions of a plasmid-enriched preparation of E. hirae S185R led to the identification of two EcoRI fragments of 4.5 and 6.6 kb, respectively, and two NcoI fragments of 4.5 and 14 kb, respectively. The four fragments each hybridized with oligonucleotide O1 (pbp3r), indicating that E. hirae S185R contained at least two copies of pbp3r. However, the intensities of the 4.5-kb bands were higher than those of the 6.6- and 14-kb bands, respectively, suggesting that the 4.5-kb fragments occurred at a higher copy number (data not shown).

The antibiotic resistance determinants are plasmid borne. E. hirae S185, SS22, and S185R (see the Introduction) were examined with respect to their susceptibilities to antibiotics and their plasmid patterns. In comparison with the wild-type strain S185, which was moderately susceptible to gentamicin, resistant to benzylpenicillin, and highly resistant to erythromycin and streptomycin, strain SS22, which was derived from strain S185 after chemical mutagenesis (28), had greatly increased susceptibilities to benzylpenicillin, erythromycin, and streptomycin (MICs, 0.1, 1, and 50 µg/ml, respectively), while strain S185R was sixfold more resistant to benzylpenicillin (MIC, 100 µg/ml) and had the same high levels of resistance to erythromycin (MIC, >360 µg/ml) and streptomycin (MIC, >2,000 µg/ml). Expression of erythromycin resistance in E. hirae S185 was inducible by a 1-h pretreatment with a low concentration of the antibiotic (0.5 µg/ml). Pretreated and control cells were grown in the presence of a high concentration of erythromycin (500 µg/ml). The antibiotic did not inhibit the pretreated cells, which grew as well as untreated control cells, but it retarded the growth of control cells.

View larger version (53K): [in this window] [in a new window]   FIG. 4.   Plasmid patterns. Agarose gel electrophoresis of plasmid preparations of E. hirae S185R, S185, and SS22. (A and C) Detection with ethidium bromide on 0.8 and 1% (wt/vol) agarose gels, respectively. (B) Southern blot of the gel described in panel A with oligonucleotide O1 (pbp3r). Controls were pDML501 with a 4.5-kb NcoI insert containing pbp3r and pDML540 with a 7-kb EcoRI insert containing pbp5. The upper bands observed in the pDML501 preparation are probably another form and dimers of pDML501, because restrictions yielded only the 4.5-kb insert and the pBR325 vector. Standards were linear bacteriophage  HindIII fragments and supercoiled pIP964 (a generous gift from T. Horaud, Pasteur Institute, Paris, France). Ch, linearized chromosomal DNA contaminant.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

E. hirae S185R carries several copies of the insertion module IS1216 and penicillin resistance marker pbp3r, as well as the streptomycin resistance marker aadEEH and the erythromycin resistance marker ermAMEH. These elements are plasmid borne, although some IS1216 modules also seem to be present on the chromosome. Most likely, aadEEH, ermAMEH, and the two IS1216 modules form a transposon-like structure: IS1216L-aadEEH-ermAMEH-IS1216R. Since the unknown portion of the plasmid replicon may contain additional insertion sequence modules and markers, this putative transposon only has been numbered Tn5466.

The enterococcal IS1216 and the S. aureus IS257 are highly similar. They belong to the ISS1 family (32). Members of this family are known to be involved in cointegration and recombination processes in L. lactis (29).

Recently, IS1216-like modules were found to be associated with antibiotic resistance determinants in other enterococcal strains. IS1216V was proposed to mediate the horizontal spread of the vancomycin resistance transposon Tn5506 in E. faecium (17). IS1216V modules were also described in another vancomycin resistance transposon, Tn5482 (15). A similar module was found on the chromosome of E. faecalis CX19 downstream from the -lactamase gene (30).

IS257 is probably involved in the integration of the low-affinity PBP2'-encoding mecA in the chromosomes of methicillin-resistant S. aureus strains, in the amplification phenomena observed in highly resistant mutants, and in the evolution of the mec locus (23). In the multidrug-resistant methicillin-resistant S. aureus strains, mecA is surrounded by Tn554 or Tn544, by the heavy metal resistance determinant mer, and/or by an integrated plasmid, pUB110 or pT181. All of these elements except the transposons are flanked by IS257 copies, and the transposons and plasmids each carry additional antibiotic resistance genes (3, 37), suggesting that IS257 is involved in the clustering of the resistance genes. IS257 also facilitates the cointegration of plasmids in staphylococci (24).

The IS1216 modules of E. hirae lack adjacent direct target sequences, a situation which is reminiscent of IS257 in the mec region of the chromosome of S. aureus (37). Yet, by analogy with IS257 and ISS1, the E. hirae IS1216 modules might be responsible for the transposition of pbp3r in E. hirae S185R and for the emergence of other plasmids. Further studies are needed to understand how IS1216 elements mediate DNA rearrangements and exchanges leading to an increase in the pbp3r copy number. However, because of the almost complete overlap of the 6.6-kb EcoRI fragment and the 14-kb NcoI fragment in strain S185 and probably in strain S185R, it is highly probable that both the EcoRI and the NcoI sites at the 5' ends of these fragments are separated only by a 90-bp sequence identical to that found in pDML510. Assuming that transposition occurred during selection and led to the formation of a repetitive DNA structure on one plasmid, restriction with NcoI or EcoRI could produce only the 4.5-kb fragments, in addition to either the 14-kb fragment or the 6.6-kb fragment. Thus, one of the plasmids, at least in strain S185R, might have a repetitive DNA organization.

In addition to DNA rearrangements, an increase in the copy number of the pbp3r bearing plasmids might also have occurred due to a mutation that modified the regulatory mechanism of the copy number. Copy numbers were not determined during this work mainly because the yields of the plasmid preparations of E. hirae S185 and S185R were not highly reproducible.

By analogy with mecA in methicillin-resistant S. aureus strains, pbp3r in E. hirae S185R (and probably S185) occurs next to Tn5466. An answer to the question of whether pbp3r could be transferred with the help of Tn5466 or a larger Tn5466-containing composite transposon requires further investigation. At variance with the location of integration of mecA in the naturally occurring MRSA strains, pbp3r is integrated into a large plasmid, not in the chromosome. E. hirae is the first known bacterial species in which a low-affinity PBP-encoding gene that confers penicillin resistance is plasmid borne.

The origins of pbp3r and psr3r are still unknown. Because both genes are inserted in a 3.2-kb DNA portion whose sequence is 99% homologous to the sequence of a fragment cloned from the E. faecium D63R chromosome (41), one may hypothesize that a DNA fragment of at least 3.2 kb was derived from an E. faecium strain and inserted directly in a plasmid of E. hirae or in a plasmid of E. faecium which was then transferred to E. hirae.

The elements so far identified highlight the strong potential for the spread of resistance to penicillin (mediated by PBP3r), erythromycin, and streptomycin among enterococci and other bacteria by transposition and/or cointegration.

Finally, one may note that as observed in most of the enterococcal species except E. faecalis, E. hirae has an L-Lys-D-Asp type of peptidoglycan (6, 7, 10, 34). Given that PBP3r must function as a transpeptidase, it is highly probable that the spread of PBP3r-mediated penicillin resistance remains limited to bacterial species whose peptidoglycan is structurally related to that of E. hirae.