Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, May 1998, p. 1295-1297, Vol. 42, No. 5
Division of Infectious
Diseases1 and
Department of Biochemistry
and Molecular Biology,3 Wayne State University
School of Medicine, Detroit, Michigan 48201, and
Public Health
Research Institute TB Center, New York, New York
100162
Received 26 June 1997/Returned for modification 19 December
1997/Accepted 25 February 1998
An A1400G mutation of the rrs gene was identified in
Mycobacterium tuberculosis (MTB) strain ATCC 35827 and in
13 MTB clinical isolates resistant to amikacin-kanamycin (MICs, >128
µg/ml). High-level cross-resistance may result from such a mutation
since MTB has a single copy of the rrs gene. Another
mechanism(s) may account for high-level amikacin-kanamycin resistance
in two mutants and lower levels of resistance in four clinical
isolates, all lacking the A1400G mutation.
We examined resistance in
Mycobacterium tuberculosis (MTB) to the deoxystreptamine
aminoglycosides amikacin (AK) and kanamycin (KM) in contrast to its
resistance to streptomycin (SM), a streptidine drug. In MTB
cross-resistance occurs between AK and KM (2) but not
between AK-KM and SM (21).
High-level SM resistance in MTB is associated with alterations of the
ribosomal target site resulting from mutations in the rpsL
gene of the S12 ribosomal protein or in the 530 or 915 region of the
rrs gene of the 16S rRNA (4, 6-9, 13, 16, 17). In Escherichia coli, ribosomal binding of KM is affected by
mutation in the 1400 region of the rrs gene (14),
and mutations in this region produce resistance to various
aminoglycosides (5). We had identified an A1400G mutation in
the rrs gene in a KM-resistant strain of MTB (ATCC 35827)
(1). To study further the mechanism(s) of AK-KM resistance,
we selected AK-resistant mutants of H37Rv (a standard susceptible
strain of MTB) and characterized the 1400 region of the rrs
gene in these mutants and in clinical isolates of MTB resistant to
AK-KM. A subsequent report (19) noted a similar mutation in
AK-resistant strains of Mycobacterium smegmatis, M. bovis, and MTB.
(This study was presented in part at the 36th Interscience Conference
on Antimicrobial Agents and Chemotherapy, New Orleans, La., September
15 to 18, 1996 [1].)
H37Rv served as the wild-type strain of MTB susceptible to all drugs.
ATCC 35827 is an in vitro mutant of H37Rv resistant to KM.
Aminoglycoside-resistant mutants of H37Rv were selected on Middlebrook
7H10 agar plates containing SM and AK at 1, 2, 4, and 8 µg/ml.
Inoculum titers were determined by plating diluted aliquots of cells
onto drug-free agar. Seventeen clinical isolates of MTB resistant to
various antituberculosis agents, including AK and KM, were obtained
from PHRI TB Center, New York, N.Y. Testing of susceptibility to AK,
KM, and SM was performed twice by the proportional method
(11). Susceptibilities of clinical isolates to other drugs
were determined in various clinical laboratories. Resistance to AK, KM,
or SM was defined as an MIC of >2 µg/ml. Resistance to other
antituberculosis agents was as described elsewhere (11, 20).
Chromosomal DNA from each MTB strain was genotyped by using a
standardized Southern blot hybridization method based on the insertion
sequence IS6110 (22). DNA fingerprint patterns were compared
by using a scanning densitometer with the BioImage Whole Band Analyzer
software (version 3.3), and the strains were catalogued as described
elsewhere (12). PCR amplification of the genomic DNA was
performed with primers ML51 and ML52 for the rpsL gene (306-bp product) (9). Flanking primers RRS30
(GGCTCCCTTTTCCAAAGGGAG) and RRS1539
(GGGGCGTTTTGCTGGTGCTCC) were used to amplify the entire rrs gene (1,589-bp product) (10), or primers
RRS1096 (GCGCAACCCTTGTCTCATGTTG) and RRS1539 were used to
amplify just the 1400 region (464-bp product) of this gene
(10). Amplification was carried out for 40 cycles (1 min at
94°C, 1 min at 60°C, and 1 min at 72°C) using Taq
polymerase. PCR products were cloned (18) with the pGEM-T vector system (Promega). Plasmid DNA of selected clones was sequenced by using T7 DNA polymerase (Sequenase 2.0; USB). Analysis of nucleotide sequences was performed with PC Gene software (IntelliGenetics). PCR
amplification of DNA from each isolate was done in duplicate, and each
product was sequenced. Numbering of nucleotides was based on the MTB
rpsL and rrs genes (9, 10).
Mutants of parental strain H37Rv (MICs of AK, KM, and SM = 1 µg/ml) appeared at a frequency of 2 × 10 Strain ATCC 35827 (Table 1) and strains
A2B and A4B selected from H37Rv at 2 and 4 µg of AK per ml,
respectively, displayed resistance to both AK and KM, but only modest
cross-resistance to SM. The 17 clinical isolates (Table 1) included 14 strains differentiated on the basis of IS6110 DNA fingerprinting and
displayed either low-level (MIC, 4 to 64 µg/ml) (four isolates) or
high-level (MIC, >256 µg/ml) (13 isolates) cross-resistance to AK
and KM. All 17 isolates were resistant to SM. Phenotypic differences in drug susceptibility among isolates within strain designations W and W1
may indicate these isolates are possibly different strains.
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Mechanism of Resistance to Amikacin and Kanamycin
in Mycobacterium tuberculosis
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
6 on agar
containing 2 µg of AK or SM per ml. At 4 µg/ml of either drug, the
frequency was 2 × 108. No mutants
(<109) were obtained at 8 µg of AK or SM per ml.
TABLE 1.
Drug susceptibility profile of
amikacin-kanamycin-resistant laboratory strains and clinical isolates
of M. tuberculosis and their mutations in the
rrs gene
AK-resistant mutants A2B and A4B had no mutations in either the
rpsL or rrs gene. However, strain ATCC 35827, which is resistant to KM, displayed an A1400G mutation in the
rrs gene (10) and had the wild-type
rpsL gene. The same A1400G mutation was noted in all 13 clinical isolates with MICs of AK-KM of >256 µg/ml. None of our four
clinical isolates with MICs of AK-KM of 
64 µg/ml displayed any
mutation in the 1400 region.
Mutants of strain H37Rv resistant to SM or AK appeared at frequencies
of 2 × 106 and 2 × 108 at
concentrations two and four times the parental MICs, respectively. The
magnitude of frequencies for both SM (streptidine drug) and AK
(deoxystreptamine drug) suggests that resistance to each
subclass of aminoglycoside results from a single mutation. We found no mutants of H37Rv in the presence of SM and AK at 8 µg/ml, yet mutants
A2B and A4B, selected with 2 and 4 µg of AK per ml, respectively, displayed MICs of AK of 64 to >128 µg/ml. The reason for our failure to obtain mutants by using 8 µg of AK per ml is not clear.
Mutants and clinical isolates displayed cross-resistance to AK and KM. The fourfold rise in MICs of SM among the AK-KM-resistant mutants is comparable to that noted in KM-resistant MTB (21). The SM resistance in many of the clinical isolates is associated with a mutation in the rpsL gene that produces a Lys-43-Arg mutation in the S12 ribosomal protein (4). The presence of the A1400G mutation in these isolates might contribute in part to the observed SM resistance.
Strain ATCC 35827, with high-level resistance to only AK-KM, had an A1400G mutation of the rrs gene of the 16S rRNA (10) (corresponding to position 1408 in the E. coli rrs gene) (5, 15). All 13 clinical isolates (10 different strains) with MICs of AK-KM of >256 µg/ml had this mutation. Ribosomal binding of KM in E. coli occurs in the 1400 region (15), and methylation of adenine at this position (1408) in Streptomyces tenjimariensis results in resistance to KM and apramycin (3, 5). MTB has only a single copy of the rrs gene (10), so such a point mutation results in resistance to AK-KM. A recent report (19) supports these findings. The same A-to-G mutation at position 1408 (E. coli numbering) was present in in vitro mutants of M. smegmatis and M. bovis resistant to AK, gentamicin, and tobramycin (MICs, >500 µg/ml) and in eight AK-KM-resistant clinical isolates of MTB (19). Allelic exchange experiments in an M. smegmatis mutant harboring a single rRNA operon demonstrated that the A1408G mutation confers resistance to AK, gentamicin, and tobramycin (19). Therefore, it seems that high-level resistance to both AK and KM in our MTB isolates results from a point mutation in the 1400 position of the rrs gene.
Resistance to AK-KM apparently arises also from a mutation(s) in
another gene(s), as in mutants A2B and A4B (MICs of AK-KM of 64 to
>128 µg/ml). A similar mechanism or another mechanism(s) may account
for AK-KM resistance in the four clinical isolates with MICs of AK-KM
of 64 µg/ml and no mutations in the 1400 region of the
rrs gene, although we have not ruled out mutation in the other 73% of the nucleotide sequence of the gene that was not examined.
| |
ACKNOWLEDGMENTS |
|---|
We thank William Brown for use of the Mycobacteriology Laboratory of the Detroit Medical Center and Karen Eckert for secretarial assistance.
This study was supported in part by the Wayne State University Research and Development Fund (S.A.L.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Infectious Diseases, Wayne State University, School of Medicine, Suite 2140, 4160 John R, Detroit, MI 48201. Phone: (313) 745-9131. Fax: (313) 993-0302. E-mail: galangaden{at}oncgate.roc.wayne.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Alangaden, G. J., F. R. Igno, N. M. Zvonok, E. K. Manavathu, and S. A. Lerner. 1996. Mechanism(s) of amikacin and streptomycin resistance in Mycobacterium tuberculosis, abstr. C136, p. 58. In Program and abstracts of the 36th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C. |
| 2. | Allen, B. W., D. A. Mitchison, Y. C. Chan, W. W. Yew, W. G. L. Allan, and D. J. Girling. 1983. Amikacin in the treatment of pulmonary tuberculosis. Tubercle 64:111-118[Medline]. |
| 3. | Beauclerk, A. A. D., and E. Cundliffe. 1987. Sites of action of two ribosomal RNA methylases responsible for resistance to aminoglycosides. J. Mol. Biol. 193:661-671[Medline]. |
| 4. | Cooksey, R. C., G. P. Morlock, A. McQueen, S. E. Glickman, and J. T. Crawford. 1996. Characterization of streptomycin resistance mechanisms among Mycobacterium tuberculosis isolates from patients in New York City. Antimicrob. Agents Chemother. 40:1186-1188[Abstract]. |
| 5. | DeStasio, E. A., D. Moazed, H. F. Noller, and A. E. Dahlberg. 1989. Mutations in 16S ribosomal RNA disrupt antibiotic-RNA interactions. EMBO J. 8:1213-1216[Medline]. |
| 6. | Douglass, J., and L. M. Steyn. 1993. A ribosomal gene mutation in streptomycin-resistant Mycobacterium tuberculosis isolates. J. Infect. Dis. 167:1505-1506[Medline]. |
| 7. | Finken, M., P. Kirschner, A. Meier, A. Wrede, and E. C. Böttger. 1993. Molecular basis of streptomycin resistance in Mycobacterium tuberculosis alterations of the ribosomal protein S12 gene and point mutations within a functional 16S ribosomal RNA pseudoknot. Mol. Microbiol. 9:1239-1246[Medline]. |
| 8. | Heym, B., N. Honoré, C. Truffot-Pernot, A. Banerjee, C. Schurra, W. R. Jacobs, Jr., J. O. A. Van Embden, J. H. Grosset, and S. T. Cole. 1994. Implications of multidrug resistance for the future of short-course chemotherapy of tuberculosis: a molecular study. Lancet 344:293-298[Medline]. |
| 9. |
Honoré, N., and S. T. Cole.
1994.
Streptomycin resistance in mycobacteria.
Antimicrob. Agents Chemother.
38:238-242 |
| 10. | Kempsell, K. E., Y. E. Ji, I. C. E. Estrada-G, M. J. Colston, and R. A. Cox. 1992. The nucleotide sequence of the promoter, 16S & RNA and spacer region of the ribosomal RNA operon of Mycobacterium tuberculosis and comparison with Mycobacterium leprae precursor rRNA. J. Gen. Microbiol. 938:1717-1727. |
| 11. | Kent, P. T., and G. P. Kubica. 1985. Public health mycobacteriology: a guide for level III laboratory. Centers for Disease Control, Atlanta, Ga. |
| 12. | Kreiswirth, B. N., and A. Moss. 1996. Genotyping multidrug-resistant M. tuberculosis in New York City, p. 199-209. In W. N. Rom, and S. M. Garay (ed.), Tuberculosis. Little, Brown and Company, New York, N.Y. |
| 13. |
Meier, A.,
P. Kirschner,
F.-C. Bange,
U. Vogel, and E. C. Böttger.
1994.
Genetic alterations in streptomycin-resistant Mycobacterium tuberculosis: mapping of mutations conferring resistance.
Antimicrob. Agents Chemother.
38:228-233 |
| 14. | Moazed, D., and H. F. Noller. 1987. Interaction of antibiotics with functional sites in 16S ribosomal RNA. Nature 327:389-394[Medline]. |
| 15. | Moazed, D., S. Stem, and H. F. Noller. 1986. Rapid chemical probing of conformation in 16S ribosomal RNA and 30S ribosomal subunits using primer extension. J. Mol. Biol. 187:399-416[Medline]. |
| 16. | Morris, S., A. H. Bai, P. Suffys, L. Porbillo-Gomez, M. Fairchok, and D. Rouse. 1995. Molecular mechanisms of multiple drug resistance in clinical isolates of Mycobacterium tuberculosis. J. Infect. Dis. 171:954-960[Medline]. |
| 17. | Nair, J., D. A. Rouse, G.-H. Bai, and S. L. Morris. 1993. The rpsL gene and streptomycin resistance in single and multiple drug-resistant strains of Mycobacterium tuberculosis. Mol. Microbiol. 10:521-527[Medline]. |
| 18. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 19. | Sander, P., T. Prammananan, and E. C. Böttger. 1996. Introducing mutations into a chromosomal rRNA gene using genetically modified eubacterial host with a single rRNA operon. Mol. Microbiol. 22:841-848[Medline]. |
| 20. | Siddiqui, S. H. 1995. Radiometric (BACTEC) tests for slowly growing mycobacteria, p. 5.14.1-5.14.14. In H. Isenberg (ed.), Clinical microbiology procedures handbook. American Society for Microbiology, Washington, D.C. |
| 21. |
Tsukamura, M., and S. Mizuno.
1975.
Cross-resistance relationships among the aminoglycoside antibiotics in Mycobacterium tuberculosis.
J. Gen. Microbiol.
88:269-274 |
| 22. |
van Embden, J. D. A.,
D. M. Cave,
J. T. Crawford, et al.
1993.
Strain identification of Mycobacterium tuberculosis by DNA fingerprinting. Recommendations for a standardized methodology.
J. Clin. Microbiol.
31:406-409 |
Antimicrobial Agents and Chemotherapy, May 1998, p. 1295-1297, Vol. 42, No. 5
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jugheli, L., Bzekalava, N., de Rijk, P., Fissette, K., Portaels, F., Rigouts, L.
(2009). High Level of Cross-Resistance between Kanamycin, Amikacin, and Capreomycin among Mycobacterium tuberculosis Isolates from Georgia and a Close Relation with Mutations in the rrs Gene. Antimicrob. Agents Chemother.
53: 5064-5068
[Abstract] [Full Text] -
Zaunbrecher, M. A., Sikes, R. D. Jr., Metchock, B., Shinnick, T. M., Posey, J. E.
(2009). Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA
106: 20004-20009
[Abstract] [Full Text] -
Louw, G. E., Warren, R. M., Gey van Pittius, N. C., McEvoy, C. R. E., Van Helden, P. D., Victor, T. C.
(2009). A Balancing Act: Efflux/Influx in Mycobacterial Drug Resistance. Antimicrob. Agents Chemother.
53: 3181-3189
[Full Text] -
Feuerriegel, S., Cox, H. S., Zarkua, N., Karimovich, H. A., Braker, K., Rusch-Gerdes, S., Niemann, S.
(2009). Sequence Analyses of Just Four Genes To Detect Extensively Drug-Resistant Mycobacterium tuberculosis Strains in Multidrug-Resistant Tuberculosis Patients Undergoing Treatment. Antimicrob. Agents Chemother.
53: 3353-3356
[Abstract] [Full Text] -
Hillemann, D., Rusch-Gerdes, S., Richter, E.
(2009). Feasibility of the GenoType MTBDRsl Assay for Fluoroquinolone, Amikacin-Capreomycin, and Ethambutol Resistance Testing of Mycobacterium tuberculosis Strains and Clinical Specimens. J. Clin. Microbiol.
47: 1767-1772
[Abstract] [Full Text] -
Sekiguchi, J.-i., Miyoshi-Akiyama, T., Augustynowicz-Kopec, E., Zwolska, Z., Kirikae, F., Toyota, E., Kobayashi, I., Morita, K., Kudo, K., Kato, S., Kuratsuji, T., Mori, T., Kirikae, T.
(2007). Detection of Multidrug Resistance in Mycobacterium tuberculosis. J. Clin. Microbiol.
45: 179-192
[Abstract] [Full Text] -
Maus, C. E., Plikaytis, B. B., Shinnick, T. M.
(2005). Molecular Analysis of Cross-Resistance to Capreomycin, Kanamycin, Amikacin, and Viomycin in Mycobacterium tuberculosis. Antimicrob. Agents Chemother.
49: 3192-3197
[Abstract] [Full Text] -
Maus, C. E., Plikaytis, B. B., Shinnick, T. M.
(2005). Mutation of tlyA Confers Capreomycin Resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother.
49: 571-577
[Abstract] [Full Text] -
Kruuner, A., Jureen, P., Levina, K., Ghebremichael, S., Hoffner, S.
(2003). Discordant Resistance to Kanamycin and Amikacin in Drug-Resistant Mycobacterium tuberculosis. Antimicrob. Agents Chemother.
47: 2971-2973
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»