Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, June 1998, p. 1329-1333, Vol. 42, No. 6
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Alterations in PBP 1A Essential for High-Level
Penicillin Resistance in Streptococcus pneumoniae
Anthony M.
Smith* and
Keith P.
Klugman
MRC/SAIMR/WITS Pneumococcal Diseases Research
Unit, Department of Clinical Microbiology and Infectious Diseases,
South African Institute for Medical Research, Johannesburg, 2000, South
Africa
Received 13 October 1997/Returned for modification 5 January
1998/Accepted 25 February 1998
 |
ABSTRACT |
High-level penicillin resistance in pneumococci is due to
alterations in penicillin-binding proteins (PBPs) 2X, 2B, and 1A. We
have sequenced the penicillin-binding domain of PBP 1A from penicillin-resistant South African pneumococcal isolates and have identified amino acid substitutions which are common to all the resistant isolates analyzed. Site-directed mutagenesis was then used to
determine whether particular amino acid substitutions at specific
positions in PBP 1A mediate penicillin resistance. PCR was used to
isolate PBP 2X, 2B, and 1A genes from clinical isolate 8303 (penicillin
MIC, 4 µg/ml). These wild-type PBP genes were cloned into pGEM-3Zf
and were used as the transforming DNA. Susceptible strain R6 (MIC,
0.015 µg/ml) was first transformed with PBP 2X and 2B DNA, resulting
in PBP 2X/2B-R6 transformants for which MICs were 0.25 µg/ml. When
further transformed with PBP 1A DNA, 2X/2B/1A-R6 transformants for
which MICs were 1.5 µg/ml were obtained. Site-directed mutagenesis of
the PBP 1A gene from isolate 8303 was then used to reverse particular
amino acid substitutions, followed by transformation of PBP 2X/2B-R6
transformants with the mutagenized PBP 1A DNA. For PBP 2X/2B/1A-R6
transformants, the introduction of the reversal of Thr-371 by Ser or
Ala in PBP 1A decreased the MIC from 1.5 to 0.5 µg/ml, whereas the
reversal of four consecutive amino acid substitutions (Thr-574 by Asn, Ser-575 by Thr, Gln-576 by Gly, and Phe-577 by Tyr) decreased the MIC
from 1.5 to 0.375 µg/ml. These data reveal that amino acid residue
371 and residues 574 to 577 of PBP 1A are important positions in PBP 1A
with respect to the interaction with penicillin and the development of
resistance.
| |
INTRODUCTION |
Penicillin inhibits the growth of
pneumococci by the inactivation of penicillin-binding proteins (PBPs).
Pneumococcal resistance to penicillin is due to the production of
altered PBPs which have a decreased affinity for the antibiotic
(7, 8, 12, 24). Barcus and coworkers (2) revealed
that high-level penicillin resistance can be established by alterations
only in PBPs 2X, 2B, and 1A. They cloned PBP 2X, 2B, and 1A genes from
four clinical isolates (penicillin MICs, 1.5 to 16 µg/ml) and found
that these three genes could transform susceptible strains so that they
had full levels of penicillin resistance, identical to the resistance of the donor strains. PBPs 2X and 2B are primary PBP targets for penicillin (6, 17, 21, 24). We have investigated the role of
PBP 1A in penicillin resistance and confirm that selection of a
low-affinity PBP 1A requires the presence of low-affinity PBPs 2X and
2B and that alteration of PBP 1A plays a vital role in full penicillin
resistance development.
We have sequenced the penicillin-binding domain (PBD)-encoding region
of PBP 1A from 18 South African clinical pneumococcal isolates for
which penicillin MICs ranged from 0.015 to 8 µg/ml. These data were
used to identify amino acid alterations which are common to all
resistant isolates and which would appear to be essential to the
development of resistance. At present, the amino acid alterations in
PBP 1A that are responsible for decreased penicillin affinity in
clinical isolates are not well defined. We have used site-directed
mutagenesis (SDM) to study some amino acid positions in PBP 1A, and we
report on their importance for the interaction of PBP 1A with
penicillin and the development of resistance.
| |
MATERIALS AND METHODS |
Bacterial strains.
Clinical isolates of pneumococci were
obtained from the South African Institute for Medical Research, a
reference center for pneumococci in South Africa. Pneumococci were
routinely cultured at 37°C in 5% CO2 on Mueller-Hinton
agar (Difco Laboratories, Detroit, Mich.) supplemented with 5% lysed
horse blood.
Isolation and fingerprinting of PBP genes.
PBP genes were
amplified from the chromosomal DNAs by PCR and were fingerprinted by
methods that have been described previously (21). For PBP 2B
and PBP 2X PCR, primers Pn2B up and Pn2B down were used as described by
Dowson and coworkers (4), and primers Pn2X up and Pn2X down
were used as described by Munoz and coworkers (15). For PBP
1A PCR, the following primers were used: Pn1A up
(CGGCATTCGATTTGATTCGCTTCT; positions 786 to 809 on the
published PBP 1A gene sequence [14]) and Pn1A down
(GTCGTACTATTATTTGTGCTTGGAGTGGTT; positions 2994 to 3023).
DNA sequencing.
Double-stranded DNA (PCR products and
plasmid DNA) were sequenced by the dideoxynucleotide method of DNA
sequencing of Sanger et al. (19) with incorporation of the
Sequenase enzyme (United States Biochemicals, Cleveland, Ohio). The
protocol for sequencing was performed as described by the manufacturer
of the Sequenase kit. The nucleotide sequences of both strands of the
PBP genes were determined by sequencing with a series of
oligonucleotides that primed at intervals of ±240 nucleotides along
each strand. When the PCR products were sequenced, a minimum of two
independent PCR products were sequenced in order to eliminate any
errors introduced by PCR. The approximate frequency of errors by PCR
with Taq DNA polymerase was <0.06%.
PBP 1A gene mutagenesis.
All SDM experiments were performed
with the PBP 1A gene isolated from isolate 8303 for which the
penicillin MIC was 4 µg/ml. The megaprimer method of PCR-based SDM
described by Smith and Klugman (20) was used to create
mutants of this "resistance" gene. This PCR incorporates three
primers and two amplification steps. The first PCR incorporates an
internal mutagenic primer and a reverse primer. In a second PCR, the
product of the first reaction is used as a megaprimer together with a
forward primer annealing upstream of the mutagenic site, resulting in
the amplification of the final mutagenic product. Pn1A up and Pn1A down
were the forward and reverse primers, respectively. Independent PCRs
were performed by incorporating mutagenic primer
1-GACTGGGGTTCTACTATGAAACCAA (positions 2044 to
2068) or mutagenic primer
2-AACCACATCAAGACCTCTCAATTTGTAGCTCCAGAT (positions 2653 to 2688) (underscores indicate the positions at which mutagenesis occurred). Fifty-microliter PCR mixtures were set up.
The first PCR contained 5 ng of PBP 1A DNA, 10 mM Tris-HCl (pH 8.85),
25 mM KCl, 5 mM (NH4)2SO4, 2 mM
MgSO4, 1 µM mutagenic primer, 1 µM reverse primer, 200 µM (each) deoxynucleoside triphosphates (Boehringer GmbH, Mannheim,
Germany), and 2 U of Pwo DNA polymerase (Boehringer). The
PCR was performed in a Perkin-Elmer DNA thermal cycler 480 (Perkin-Elmer Corporation, Norwalk, Conn.) with 25 cycles of
denaturation at 93°C for 1 min, primer annealing at 60°C for 1 min,
and primer extension at 72°C for 2 min. The PCR product (megaprimer)
was purified from agarose with Geneclean (Bio 101, Inc., La Jolla,
Calif.) and was resuspended in 10 mM Tris-1 mM EDTA (pH 7.5; TE
buffer). The second PCR contained 5 ng of PBP 1A DNA, 10 mM Tris-HCl
(pH 8.85), 25 mM KCl, 5 mM
(NH4)2SO4, 2 mM MgSO4,
200 µM (each) deoxynucleoside triphosphates, 2 µg of megaprimer
DNA, and 2 U of Pwo DNA polymerase, with five thermal cycles
of 93°C for 1 min and 72°C for 3 min. While at 72°C, 1 µM
forward primer was added and was gently mixed into the reaction mixture, and thermal cycling (25 times) was continued at 93°C for 1 min, 60°C for 1 min, and 72°C for 2 min. The mutagenic PCR product
was purified from agarose with Geneclean (Bio 101).
Cloning of PBP genes.
PBP 2B, 2X, and 1A genes were cloned
into the SmaI site of pGEM-3Zf(+) (Promega Corp., Madison,
Wis.) by standard techniques. Recombinant plasmid DNA was extracted
from transformed Escherichia coli JM109 by the alkaline
lysis method (18).
Transformation.
Nonencapsulated, penicillin-susceptible
pneumococcal strain R6 (a laboratory strain derived from Rockefeller
University strain R36A [1]) was used as the recipient
in transformation studies. Cloned PBP genes were used as transforming
DNA. Pneumococcal strain R6 was made competent as follows. Bacteria
were cultured in C medium (22) until the late exponential
phase (optical density at 620 nm, 0.25) and, after the addition of
glycerol to 10%, were frozen at 
70°C in 1-ml aliquots. For
transformation, 4 µg of recombinant plasmid DNA was added to 1 ml of
competent cells, which was then incubated at 30°C for 1 h and at
37°C for 2 h. Eighty-microliter amounts were then plated onto
Mueller-Hinton-blood agar containing increasing concentrations of
penicillin (0.03 to 4 µg/ml), and the plates were incubated at 37°C
for 48 h. Transformants were picked from the plates containing the
highest penicillin concentration possible. Transformation frequencies
were calculated as the number of resistant transformants per milliliter
of transformation mixture divided by the total number of cells per
milliliter of transformation mixture.
MIC determination.
The penicillin MICs for pneumococci were
determined by the agar dilution method specified by the National
Committee for Clinical Laboratory Standards (16).
Benzylpenicillin (Sigma Chemical Co., St. Louis, Mo.) was incorporated
into Mueller-Hinton agar supplemented with 5% horse blood, with plates
containing antibiotic at concentrations of 0.03, 0.06, 0.125, 0.25, 0.375, 0.5, 1, 1.5, 2, 3, and 4 µg/ml. The bacteria were cultured at
37°C in serum broth (South African Institute for Medical Research,
Johannesburg, South Africa) until a turbidity equivalent to that of a
McFarland 0.5 standard was obtained, and then 1- to 2-µl aliquots of
this inoculum were applied to an agar surface with an inoculum-plating device. The agar plates containing the different antibiotic
concentrations were inoculated, starting with the agar containing the
lowest antibiotic concentration. Once the inoculum had been absorbed into the agar, the plates were inverted and were incubated at 35°C
for 16 h. The MIC was recorded as the lowest concentration of
antibiotic that completely inhibited bacterial growth on the agar.
Nucleotide sequence accession numbers.
The PBP 1A sequence
data for strain R6 appears in the EMBL, GenBank, and DDBJ nucleotide
sequence data libraries under the accession number M90527, while data
for the following resistant isolates, which are also listed in Table 1,
appear under the indicated accession numbers: Isolate 63509, AF046238;
isolate 8303, AF046230; isolate M11, AF046238; isolate 35193, AF046230; isolate 56739, AF046234; isolate 65654, AF046231; isolate N94,
AF046236; isolate 43, AF046232; isolate 64429, AF046233; isolate 7851, AF046235; and isolate 17619, AF046237.
| |
RESULTS AND DISCUSSION |
Analysis of PBP 1A sequence.
The PBD of high-molecular-weight
PBPs, such as PBP 1A, is believed to start ±60 amino acid residues
before the active-site serine residue that is acylated by penicillin
and ends ±60 residues after the conserved Lys-Thr-Gly motif
(10). We have sequenced the PBD-encoding region of PBP 1A
from 18 South African clinical pneumococcal isolates for which
penicillin MICs ranged from 0.015 to 8 µg/ml. The nucleotide sequence
of the PBP 1A gene from penicillin-susceptible reference strain R6,
which was determined and which was found to agree with the published
sequence (14), was used as the basis for comparison with
clinical isolates.
The PBD-encoding region of PBP 1A from isolates for which MICs were
<0.25 µg/ml revealed up to seven nucleotide substitutions and a
single amino acid substitution differing from that of strain R6.
Because this amino acid substitution (Glu-388 by Asp) also occurs in
susceptible strains, it probably does not confer penicillin resistance,
although it also occurs in proteins from all the resistant isolates
analyzed. Widespread alterations in the PBD-encoding region of PBP 1A
were seen only in isolates for which MICs were 
0.25 µg/ml (Table
1). Our sequence analysis therefore
suggests that an MIC of 0.25 to 0.5 µg/ml represents a breakpoint in
resistance. At this breakpoint PBP 1A starts participating in the
development of resistance as a result of significant alterations in its
PBD. These data can be compared to those from previous phenotypic
studies on PBPs. The disappearance of PBP 1A from PBP profiles
(fluorography) of transformants as they reach resistance levels of 0.4 µg of penicillin per ml has suggested that an altered PBP 1A with a decreased affinity for penicillin occurs only in isolates for which
MICs are approximately 0.4 µg/ml and higher (24). Studies with clinical isolates of pneumococci have revealed that PBP 1A is
absent from the fluorograms for isolates for which penicillin MICs are
0.25 µg/ml (13). Furthermore, Kell and coworkers
(11) transformed a penicillin- and cefotaxime-resistant
strain (MICs, 4 and 2 µg/ml, respectively) with inactivated PBP 1A
DNA and successfully obtained growth of the transformant, revealing the
tolerance of the pneumococcus to the loss of PBP 1A. The penicillin and
cefotaxime MICs for the transformant were reduced to 0.5 µg/ml. This
resultant decrease in the MIC accompanying the inactivation of PBP 1A
supports the idea that PBP 1A plays a role in the development of
penicillin and cefotaxime resistance when MICs are >0.5 µg/ml.
Figure
1 exhibits the prominent amino
acid substitutions identified in the PBD of PBP 1A from resistant
isolates. These substitutions
were found to be common to all isolates
and may therefore be essential
to the development of resistance. For
isolates for which MICs
were from 0.25 to 1 µg/ml, nucleotide and
amino acid alterations
were essentially confined to an area surrounding
the Lys-557-Thr-Gly
motif (from amino acid residue 533 to the end of
the PBD). This
included six amino acid substitutions which were common
among
all resistant isolates: Thr-574 by Asn, Ser-575 by Thr, Gln-576
by Gly, Phe-577 by Tyr (four consecutive residues), Leu-583 by
Met or
Thr, and Ala-585 by Val (Fig.
1, line B). As the level
of penicillin
resistance among isolates increased above MICs of
1 µg/ml, the number
of nucleotide and amino acid alterations also
increased, such that the
entire PBD was included. The PBD-encoding
region of PBP 1A from
high-level-resistant isolates (MICs,
2
µg/ml) revealed the most
extensive nucleotide sequence divergence
(up to 21%) from strain R6,
resulting in up to 43 amino acid alterations
which spanned the entire
PBD.
View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Prominent amino acid substitutions in the PBD of PBP 1A
from penicillin-resistant pneumococcal isolates compared to the
sequence of susceptible strain R6 (two or more consecutive
substitutions are boxed). The positions of the three conserved amino
acid sequence motifs (STMK, SRN, and KTG) are indicated. (A) Amino acid
sequence data for strain R6. (B) Amino acid substitutions for isolates
for which MICs were from 0.25 to 1 µg/ml. (C) Amino acid
substitutions for isolates for which MICs were 2 µg/ml. The data
are numbered according to the published sequence of Martin and
coworkers (14).
|
|
Only high-level-resistant isolates (MICs,
2 µg/ml) had amino acid
alterations within the locality of the Ser-370-Thr-Met-Lys
and
Ser-428-Arg-Asn motifs of PBP 1A (Fig.
1, line C). An interesting
substitution was that of Thr-371 by Ser or Ala which occurred
within
the Ser-370-Thr-Met-Lys motif adjacent to the active-site
serine
residue. This substitution was seen only in PBPs 1A from
isolates for
which MICs were
2 µg/ml. It would therefore appear
that this
substitution may be of particular importance in mediating
the higher
levels of resistance. The importance of this amino
acid position is
supported by previous studies. Hedge and Spratt
(
9) isolated
a number of cephalexin-resistant laboratory mutants
of
E. coli in which resistance was shown to be due to altered
PBP 3, the
major killing target for
-lactams in
E. coli. One
class
of mutants showing the highest levels of resistance (eightfold
increase
compared to that for the parental strain) revealed a
single amino acid
substitution of Thr-308 by Pro, which occurred
within the second
position of the active-site Ser-307-X-X-Lys
motif (
9). By
SDM, a threonine-to-serine mutation at the second
position of the
Ser-X-X-Lys motif of a TEM
-lactamase was shown
to significantly
decrease the catalytic activity of the enzyme
(
3).
Mutagenesis and transformation studies.
Penicillin-susceptible
pneumococcal strain R6 was used as the recipient in transformation
studies. Cloned PBP 2X, 2B, and 1A genes from penicillin-resistant
isolate 8303 were used as the transforming DNA. Strain R6 was
transformed with individual PBP genes as well as different combinations
of PBP 2X, 2B, and 1A genes. DNA fingerprinting and DNA sequencing were
used to confirm the introduction of these "resistance" genes into
strain R6. The results of these transformation experiments are
summarized in Table 2. When strain R6 was
transformed with PBP 2B DNA or PBP 1A DNA, or a combination of both,
mutants were selected on plates containing 0.03 µg of penicillin per
ml, with subsequent MICs calculated to be 0.03 µg/ml. Analysis of the
PBP genes of these R6 mutants revealed unaltered PBP 2B and 1A genes.
Identical mutants were selected in control (vector-only)
transformations. This finding of low-level penicillin resistance
associated with unaltered PBPs supports and extends previous studies
which have described non-PBP-related low-level cefotaxime and
piperacillin resistance in laboratory mutants obtained after several
selection steps on increasing concentrations of antibiotic (5,
23). Transformation of strain R6 with PBP 2X DNA or PBP 2X plus
PBP 1A DNA resulted in transformants (transformation frequency, 4 × 10
5) selected on plates containing 0.03 µg of
penicillin per ml, with subsequent MICs calculated to be 0.06 µg/ml.
These transformants revealed integrated PBP 2X "resistance" genes
only. This altered PBP 2X together with non-PBP-related mechanisms
would account for this low-level resistance. Transformants for which
MICs were greater than 0.06 µg/ml were obtained only when strain R6
was transformed with a combination of PBP 2X and PBP 2B DNA. These PBP
2X/2B-R6 transformants (frequency, 9 × 107) were
selected on plates containing 0.125 µg of penicillin per ml (MICs for
the transformants, 0.25 µg/ml) and showed integrated PBP 2X and 2B
"resistance" genes. Transformation with a combination of PBP 2X, 2B
and 1A DNA produced the same results as transformation with PBP 2X and
2B DNA. Further steps of transformation and selection were required for
the introduction of an altered PBP 1A. Therefore, an altered PBP 2X
appears to be essential to allow the selection of transformants with
altered PBPs 2X and 2B. Only within this genetic background of altered
PBPs 2X and 2B will the selection of transformants with an altered PBP
1A be possible. These results therefore confirm the ordered multistep
process of penicillin resistance development first suggested by
Zighelboim and Tomasz (24), which starts with an alteration
of PBP 2X, followed by alteration of PBP 2B and then PBP 1A.
All SDM experiments were performed with the PBP 1A gene isolated from
resistant isolate 8303. Strain R6 remained the recipient
in
transformation studies. For SDM of PBP 1A, we needed to obtain
the
correct genetic background with respect to PBPs 2X, 2B, and
1A.
Therefore, strain R6 was first transformed with the PBP 2X
and 2B
"resistance" genes isolated from isolate 8303, resulting
in
transformants for which penicillin MICs were 0.25 µg/ml. When
these
PBP 2X/2B-R6 transformants were further transformed with
the PBP 1A
gene from isolate 8303, transformants (frequency, 4
× 10
6) were selected on plates containing 1 µg of
penicillin per ml,
with MICs calculated to be 1.5 µg/ml. These
results confirmed
that an MIC of 0.25 to 0.5 µg/ml represents a
breakpoint in resistance,
a level at which PBP 1A starts to participate
in penicillin resistance
development. The MIC for the donor strain (4 µg/ml) was never
reached in the crosses described above. This
suggests that the
mechanism of high-level penicillin resistance may
still have new
elements to be discovered, such as the possible
participation
of PBPs 1B and 2A.
The technique of SDM is used to introduce mutations into DNA and can
therefore be used to investigate the importance of amino
acid
substitutions identified in altered PBPs. SDM of the altered
PBP 1A
gene from resistant strain 8303 was performed as follows.
Particular
mutations were inactivated (alterations were reversed
back to the
original sequence), the resistant strain was then
transformed with the
mutated gene, and then it was determined
whether the reversal of the
amino acid change resulted in transformants
with decreased levels of
resistance. This approach of SDM was
chosen because multiple amino acid
mutations have been identified
in altered PBP 1A, and therefore, when a
particular amino acid
mutation is being analyzed, it is probably
important that the
remaining genetic background of the altered PBP be
maintained.
The substitution of Thr-371 by Ser or Ala, which was
identified
only in PBP 1A from high-level penicillin-resistant
isolates,
was the first substitution to be reversed in the PBP 1A gene
from
isolate 8303. The megaprimer method of PCR-based SDM,
incorporating
mutagenic primer 1, was used to create the mutagenized
PBP 1A
DNA. PBP 2X/2B-R6 transformants (MICs, 0.25 µg/ml) were
transformed
with this mutagenized PBP 1A DNA, resulting in PBP
2X/2B/1A-R6
transformants (frequency, 2 × 10
5), and
were selected on plates containing 0.25 µg of penicillin
per ml; the
MICs for these transformants were 0.5 µg/ml. For PBP
2X/2B/1A-R6
transformants having the original wild-type PBP 1A
gene, MICs were 1.5 µg/ml; therefore, the reversal of Thr-371
by Ser or Ala in PBP 1A
accounted for a decrease in the MIC from
1.5 to 0.5 µg/ml. Our second
SDM experiment resulted in the reversal
of four consecutive amino acid
substitutions in PBP 1A (Thr-574
by Asn, Ser-575 by Thr, Gln-576 by
Gly, and Phe-577 by Tyr) which
were common among all resistant isolates
for which MICs were
0.25
µg/ml. Mutagenic primer 2 was used to
create the mutagenized PBP
1A DNA. When PBP 2X/2B-R6 transformants were
transformed with
the mutagenized PBP 1A DNA, the MICs for the resulting
PBP 2X/2B/1A-R6
transformants (frequency, 3 × 10
6),
selected on plates containing 0.25 µg of penicillin per ml,
were
0.375 µg/ml. The reversal of these four consecutive substitutions
in
PBP 1A therefore accounted for a decrease in the MIC from 1.5
to 0.375 µg/ml. For all PBP 2X/2B/1A-R6 transformants, DNA sequencing
confirmed the introduction of mutagenized PBP 1A genes.
Concluding remarks.
Our analysis has shown that amino acid
residue 371 and residues 574 to 577 of PBP 1A are important with
respect to the interaction with penicillin. Substitutions at residues
574 to 577 are common to all resistant isolates (MICs, 0.25 µg/ml)
and have been shown to be critical to the development of penicillin
resistance. In the presence of these four substitutions, an alteration
at residue 371 allows the development of full resistance.
| |
ACKNOWLEDGMENTS |
This work was supported by grants from the Medical Research
Council and the South African Institute for Medical Research.
We thank Maggie Daniels for kindly providing us with the formulation
for C medium.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: MRC/SAIMR/WITS
Pneumococcal Diseases Research Unit, Department of Clinical
Microbiology and Infectious Diseases, South African Institute for
Medical Research, P.O. Box 1038, Johannesburg, 2000, South Africa.
Phone: 27 011 4899335. Fax: 27 011 4899332. E-mail:
174ant{at}chiron.wits.ac.za.
| |
REFERENCES |
| 1.
|
Avery, O. T.,
C. M. MacLeod, and M. McCarty.
1944.
Studies on the chemical nature of the substance inducing transformation of pneumococcal types.
J. Exp. Med.
79:137-158[Abstract].
|
| 2.
|
Barcus, V. A.,
K. Ghanckar,
M. Yeo,
T. J. Coffey, and C. G. Dowson.
1995.
Genetics of high level penicillin resistance in clinical isolates of Streptococcus pneumoniae.
FEMS Microbiol. Lett.
126:299-303[Medline].
|
| 3.
|
Dalbadie-McFarland, G.,
L. W. Cohen,
A. D. Riggs,
C. Morin,
K. Itakura, and J. H. Richards.
1982.
Oligonucleotide-directed mutagenesis as a general and powerful method for studies of protein function.
Proc. Natl. Acad. Sci. USA
79:6409-6413[Abstract/Free Full Text].
|
| 4.
|
Dowson, C. G.,
A. Hutchison, and B. G. Spratt.
1989.
Extensive remodelling of the transpeptidase domain of penicillin-binding protein 2B of a South African isolate of Streptococcus pneumoniae.
Mol. Microbiol.
3:95-102[Medline].
|
| 5.
|
Grebe, T.,
J. Paik, and R. Hakenbeck.
1997.
A novel resistance mechanism against -lactams in Streptococcus pneumoniae involves CpoA, a putative glycosyltransferase.
J. Bacteriol.
179:3342-3349[Abstract/Free Full Text].
|
| 6.
|
Hakenbeck, R.,
T. Briese,
L. Chalkley,
H. Ellerbrok,
R. Kalliokoski,
C. Latorre,
M. Leinonen, and C. Martin.
1991.
Antigenic variation of penicillin-binding proteins from penicillin-resistant clinical strains of Streptococcus pneumoniae.
J. Infect. Dis.
164:313-319[Medline].
|
| 7.
|
Hakenbeck, R.,
H. Ellerbrok,
T. Briese,
S. Handwerger, and A. Tomasz.
1986.
Penicillin-binding proteins of penicillin-susceptible and -resistant pneumococci: immunological relatedness of altered proteins and changes in peptides carrying the -lactam binding site.
Antimicrob. Agents Chemother.
30:553-558[Abstract/Free Full Text].
|
| 8.
|
Hakenbeck, R.,
M. Tarpay, and A. Tomasz.
1980.
Multiple changes of penicillin-binding proteins in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
17:364-371[Abstract/Free Full Text].
|
| 9.
|
Hedge, P. J., and B. G. Spratt.
1985.
Amino acid substitutions that reduce the affinity for penicillin-binding protein 3 of Escherichia coli for cephalexin.
Eur. J. Biochem.
151:111-121[Medline].
|
| 10.
|
Joris, B.,
J.-M. Ghuysen,
G. Dive,
A. Renard,
O. Dideberg,
P. Charlier,
J.-M. Frere,
J. A. Kelly,
J. C. Boyington,
P. C. Moews, and J. R. Knox.
1988.
The active-site serine penicillin-recognizing enzymes as members of the Streptomyces R61 DD-peptidase family.
Biochem. J.
250:313-324[Medline].
|
| 11.
|
Kell, C. M.,
U. K. Sharma,
C. G. Dowson,
C. Town,
T. S. Balganesh, and B. G. Spratt.
1993.
Deletion analysis of the essentiality of penicillin-binding proteins 1A, 2B, and 2X of Streptococcus pneumoniae.
FEMS Microbiol. Lett.
106:171-176[Medline].
|
| 12.
|
Laible, G.,
B. G. Spratt, and R. Hakenbeck.
1991.
Interspecies recombinational events during the evolution of altered PBP 2X genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Mol. Microbiol.
5:1993-2002[Medline].
|
| 13.
|
Markiewicz, Z., and A. Tomasz.
1989.
Variation in penicillin-binding protein patterns of penicillin-resistant clinical isolates of pneumococci.
J. Clin. Microbiol.
27:405-410[Abstract/Free Full Text].
|
| 14.
|
Martin, C.,
T. Briese, and R. Hakenbeck.
1992.
Nucleotide sequences of genes encoding penicillin binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin binding proteins 1A and 1B.
J. Bacteriol.
174:4517-4523[Abstract/Free Full Text].
|
| 15.
|
Munoz, R.,
T. J. Coffey,
M. Daniels,
C. G. Dowson,
G. Laible,
J. Casal,
R. Hakenbeck,
M. Jacobs,
J. M. Musser,
B. G. Spratt, and A. Tomasz.
1991.
Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae.
J. Infect. Dis.
164:302-306[Medline].
|
| 16.
|
National Committee for Clinical Laboratory Standards.
1997.
Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A4, 4th ed.
National Committee for Clinical Laboratory Standards, Wayne, Pa.
|
| 17.
|
Reichmann, P.,
A. Konig,
A. Marton, and R. Hakenbeck.
1996.
Penicillin-binding proteins as resistance determinants in clinical isolates of Streptococcus pneumoniae.
Microb. Drug Resist.
2:177-181.
[Medline] |
| 18.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 19.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 20.
|
Smith, A. M., and K. P. Klugman.
1997.
"Megaprimer" method of PCR-based mutagenesis: the concentration of megaprimer is a critical factor.
BioTechniques
22:438-442[Medline].
|
| 21.
|
Smith, A. M.,
K. P. Klugman,
T. J. Coffey, and B. G. Spratt.
1993.
Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.
Antimicrob. Agents Chemother.
37:1938-1944[Abstract/Free Full Text].
|
| 22.
|
Tomasz, A., and R. D. Hotchkiss.
1964.
Regulation of the transformability of pneumococcal cultures by macromolecular cell products.
Proc. Natl. Acad. Sci. USA
51:480-487[Free Full Text].
|
| 23.
|
Zahner, D.,
T. Grebe,
E. Guenzi,
J. Kraub,
M. Van Der Linden,
K. Terhune,
J. B. Stock, and R. Hakenbeck.
1996.
Resistance determinants for -lactam antibiotics in laboratory mutants of Streptococcus pneumoniae that are involved in genetic competence.
Microb. Drug Resist.
2:187-191.
[Medline] |
| 24.
|
Zighelboim, S., and A. Tomasz.
1980.
Penicillin-binding proteins of multiply antibiotic-resistant South African strains of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
17:434-442[Abstract/Free Full Text].
|
Antimicrobial Agents and Chemotherapy, June 1998, p. 1329-1333, Vol. 42, No. 6
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kosowska-Shick, K., Ednie, L. M., McGhee, P., Appelbaum, P. C.
(2009). Comparative Antipneumococcal Activities of Sulopenem and Other Drugs. Antimicrob. Agents Chemother.
53: 2239-2247
[Abstract]
[Full Text]
-
McGee, L., Biek, D., Ge, Y., Klugman, M., du Plessis, M., Smith, A. M., Beall, B., Whitney, C. G., Klugman, K. P.
(2009). In Vitro Evaluation of the Antimicrobial Activity of Ceftaroline against Cephalosporin-Resistant Isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
53: 552-556
[Abstract]
[Full Text]
-
Nagano, N., Nagano, Y., Kimura, K., Tamai, K., Yanagisawa, H., Arakawa, Y.
(2008). Genetic Heterogeneity in pbp Genes among Clinically Isolated Group B Streptococci with Reduced Penicillin Susceptibility. Antimicrob. Agents Chemother.
52: 4258-4267
[Abstract]
[Full Text]
-
Fukushima, K. Y., Yanagihara, K., Hirakata, Y., Sugahara, K., Morinaga, Y., Kohno, S., Kamihira, S.
(2008). Rapid Identification of Penicillin and Macrolide Resistance Genes and Simultaneous Quantification of Streptococcus pneumoniae in Purulent Sputum Samples by Use of a Novel Real-Time Multiplex PCR Assay. J. Clin. Microbiol.
46: 2384-2388
[Abstract]
[Full Text]
-
Izdebski, R., Rutschmann, J., Fiett, J., Sadowy, E., Gniadkowski, M., Hryniewicz, W., Hakenbeck, R.
(2008). Highly Variable Penicillin Resistance Determinants PBP 2x, PBP 2b, and PBP 1a in Isolates of Two Streptococcus pneumoniae Clonal Groups, Poland23F-16 and Poland6B-20. Antimicrob. Agents Chemother.
52: 1021-1027
[Abstract]
[Full Text]
-
Job, V., Carapito, R., Vernet, T., Dessen, A., Zapun, A.
(2008). Common Alterations in PBP1a from Resistant Streptococcus pneumoniae Decrease Its Reactivity toward {beta}-Lactams: STRUCTURAL INSIGHTS. J. Biol. Chem.
283: 4886-4894
[Abstract]
[Full Text]
-
Davies, T. A., Shang, W., Bush, K.
(2006). Activities of Ceftobiprole and Other {beta}-Lactams against Streptococcus pneumoniae Clinical Isolates from the United States with Defined Substitutions in Penicillin-Binding Proteins PBP 1a, PBP 2b, and PBP 2x.. Antimicrob. Agents Chemother.
50: 2530-2532
[Abstract]
[Full Text]
-
Granger, D., Boily-Larouche, G., Turgeon, P., Weiss, K., Roger, M.
(2006). Molecular characteristics of pbp1a and pbp2b in clinical Streptococcus pneumoniae isolates in Quebec, Canada. J Antimicrob Chemother
57: 61-70
[Abstract]
[Full Text]
-
Smith, A. M., Klugman, K. P.
(2005). Amino Acid Mutations Essential to Production of an Altered PBP 2X Conferring High-Level {beta}-Lactam Resistance in a Clinical Isolate of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
49: 4622-4627
[Abstract]
[Full Text]
-
Smith, A. M., Feldman, C., Massidda, O., McCarthy, K., Ndiweni, D., Klugman, K. P.
(2005). Altered PBP 2A and Its Role in the Development of Penicillin, Cefotaxime, and Ceftriaxone Resistance in a Clinical Isolate of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
49: 2002-2007
[Abstract]
[Full Text]
-
Kobayashi, R., Konomi, M., Hasegawa, K., Morozumi, M., Sunakawa, K., Ubukata, K.
(2005). In Vitro Activity of Tebipenem, a New Oral Carbapenem Antibiotic, against Penicillin-Nonsusceptible Streptococcus pneumoniae. Antimicrob. Agents Chemother.
49: 889-894
[Abstract]
[Full Text]
-
Macheboeuf, P., Di Guilmi, A. M., Job, V., Vernet, T., Dideberg, O., Dessen, A.
(2005). Active site restructuring regulates ligand recognition in class A penicillin-binding proteins. Proc. Natl. Acad. Sci. USA
102: 577-582
[Abstract]
[Full Text]
-
Kosowska, K., Jacobs, M. R., Bajaksouzian, S., Koeth, L., Appelbaum, P. C.
(2004). Alterations of Penicillin-Binding Proteins 1A, 2X, and 2B in Streptococcus pneumoniae Isolates for Which Amoxicillin MICs Are Higher than Penicillin MICs. Antimicrob. Agents Chemother.
48: 4020-4022
[Abstract]
[Full Text]
-
Hauser, C., Aebi, S., Muhlemann, K.
(2004). An Internationally Spread Clone of Streptococcus pneumoniae Evolves from Low-Level to Higher-Level Penicillin Resistance by Uptake of Penicillin-Binding Protein Gene Fragments from Nonencapsulated Pneumococci. Antimicrob. Agents Chemother.
48: 3563-3566
[Abstract]
[Full Text]
-
Sanbongi, Y., Ida, T., Ishikawa, M., Osaki, Y., Kataoka, H., Suzuki, T., Kondo, K., Ohsawa, F., Yonezawa, M.
(2004). Complete Sequences of Six Penicillin-Binding Protein Genes from 40 Streptococcus pneumoniae Clinical Isolates Collected in Japan. Antimicrob. Agents Chemother.
48: 2244-2250
[Abstract]
[Full Text]
-
Trzcinski, K., Thompson, C. M., Lipsitch, M.
(2004). Single-Step Capsular Transformation and Acquisition of Penicillin Resistance in Streptococcus pneumoniae. J. Bacteriol.
186: 3447-3452
[Abstract]
[Full Text]
-
Ubukata, K., Chiba, N., Hasegawa, K., Kobayashi, R., Iwata, S., Sunakawa, K.
(2004). Antibiotic Susceptibility in Relation to Penicillin-Binding Protein Genes and Serotype Distribution of Streptococcus pneumoniae Strains Responsible for Meningitis in Japan, 1999 to 2002. Antimicrob. Agents Chemother.
48: 1488-1494
[Abstract]
[Full Text]
-
Bennett, D., Lennon, B., Humphreys, H., Cafferkey, M.
(2003). Penicillin Susceptibility and Epidemiological Typing of Invasive Pneumococcal Isolates in the Republic of Ireland. J. Clin. Microbiol.
41: 3641-3648
[Abstract]
[Full Text]
-
Smith, A. M., Klugman, K. P.
(2003). Site-Specific Mutagenesis Analysis of PBP 1A from a Penicillin-Cephalosporin-Resistant Pneumococcal Isolate. Antimicrob. Agents Chemother.
47: 387-389
[Abstract]
[Full Text]
-
Leach, A. J., Morris, P. S., Smith-Vaughan, H., Mathews, J. D.
(2002). In Vivo Penicillin MIC Drift to Extremely High Resistance in Serotype 14 Streptococcus pneumoniae Persistently Colonizing the Nasopharynx of an Infant with Chronic Suppurative Lung Disease: a Case Study. Antimicrob. Agents Chemother.
46: 3648-3649
[Abstract]
[Full Text]
-
Nichol, K. A., Zhanel, G. G., Hoban, D. J.
(2002). Penicillin-Binding Protein 1A, 2B, and 2X Alterations in Canadian Isolates of Penicillin-Resistant Streptococcus pneumoniae. Antimicrob. Agents Chemother.
46: 3261-3264
[Abstract]
[Full Text]
-
du Plessis, M., Bingen, E., Klugman, K. P.
(2002). Analysis of Penicillin-Binding Protein Genes of Clinical Isolates of Streptococcus pneumoniae with Reduced Susceptibility to Amoxicillin. Antimicrob. Agents Chemother.
46: 2349-2357
[Abstract]
[Full Text]
-
Nagai, K., Davies, T. A., Jacobs, M. R., Appelbaum, P. C.
(2002). Effects of Amino Acid Alterations in Penicillin-Binding Proteins (PBPs) 1a, 2b, and 2x on PBP Affinities of Penicillin, Ampicillin, Amoxicillin, Cefditoren, Cefuroxime, Cefprozil, and Cefaclor in 18 Clinical Isolates of Penicillin-Susceptible, -Intermediate, and -Resistant Pneumococci. Antimicrob. Agents Chemother.
46: 1273-1280
[Abstract]
[Full Text]
-
McAvin, J. C., Reilly, P. A., Roudabush, R. M., Barnes, W. J., Salmen, A., Jackson, G. W., Beninga, K. K., Astorga, A., McCleskey, F. K., Huff, W. B., Niemeyer, D., Lohman, K. L.
(2001). Sensitive and Specific Method for Rapid Identification of Streptococcus pneumoniae Using Real-Time Fluorescence PCR. J. Clin. Microbiol.
39: 3446-3451
[Abstract]
[Full Text]
-
Smith, A. M., Botha, R. F., Koornhof, H. J., Klugman, K. P.
(2001). Emergence of a Pneumococcal Clone with Cephalosporin Resistance and Penicillin Susceptibility. Antimicrob. Agents Chemother.
45: 2648-2650
[Abstract]
[Full Text]
-
FERRONI, A., BERCHE, P.
(2001). Alterations to penicillin-binding proteins 1A, 2B and 2X amongst penicillin-resistant clinical isolates of Streptococcus pneumoniae serotype 23F from the nasopharyngeal flora of children. J Med Microbiol
50: 828-832
[Abstract]
[Full Text]
-
Smith, A. M., Klugman, K. P.
(2001). Alterations in MurM, a Cell Wall Muropeptide Branching Enzyme, Increase High-Level Penicillin and Cephalosporin Resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
45: 2393-2396
[Abstract]
[Full Text]
-
Doern, G. V., Heilmann, K. P., Huynh, H. K., Rhomberg, P. R., Coffman, S. L., Brueggemann, A. B.
(2001). Antimicrobial Resistance among Clinical Isolates of Streptococcus pneumoniae in the United States during 1999-2000, Including a Comparison of Resistance Rates since 1994-1995. Antimicrob. Agents Chemother.
45: 1721-1729
[Abstract]
[Full Text]
-
Asahi, Y., Takeuchi, Y., Ubukata, K.
(1999). Diversity of Substitutions within or Adjacent to Conserved Amino Acid Motifs of Penicillin-Binding Protein 2X in Cephalosporin-Resistant Streptococcus pneumoniae Isolates. Antimicrob. Agents Chemother.
43: 1252-1255
[Abstract]
[Full Text]
-
du Plessis, M., Smith, A. M., Klugman, K. P.
(1999). Application of pbp1A PCR in Identification of Penicillin-Resistant Streptococcus pneumoniae. J. Clin. Microbiol.
37: 628-632
[Abstract]
[Full Text]
Top
Abstract
Introduction
