This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pitout, J. D. D.
Right arrow Articles by Sanders, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pitout, J. D. D.
Right arrow Articles by Sanders, C. C.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, June 1998, p. 1350-1354, Vol. 42, No. 6
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

beta -Lactamases Responsible for Resistance to Expanded-Spectrum Cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis Isolates Recovered in South Africa

J. D. D. Pitout,dagger K. S. Thomson,* N. D. Hanson, A. F. Ehrhardt, E. S. Moland, and C. C. Sanders

Department of Medical Microbiology and Immunology, Creighton University School of Medicine, Omaha, Nebraska 68178

Received 21 August 1997/Returned for modification 15 December 1997/Accepted 28 March 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Although resistance to the expanded-spectrum cephalosporins among members of the family Enterobacteriaceae lacking inducible beta -lactamases occurs virtually worldwide, little is known about this problem among isolates recovered in South Africa. Isolates of Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis resistant to expanded-spectrum cephalosporins recovered from patients in various parts of South Africa over a 3-month period were investigated for extended-spectrum beta -lactamase production. Antibiotic susceptibility was determined by standard disk diffusion and agar dilution procedures. Production of extended-spectrum beta -lactamases was evaluated by using the double-disk test, and the beta -lactamases were characterized by spectrophotometric hydrolysis assays and an isoelectric focusing overlay technique which simultaneously determined isoelectric points and general substrate or inhibitor characteristics. DNA amplification and sequencing were performed to confirm the identities of these enzymes. The P. mirabilis and E. coli isolates were found to produce TEM-26-type, SHV-2, and SHV-5 extended-spectrum beta -lactamases. An AmpC-related enzyme which had a pI of 8.0 and which conferred resistance to cefoxitin as well as the expanded-spectrum cephalosporins was found in a strain of K. pneumoniae. This is the first study which has identified organisms producing different extended-spectrum beta -lactamases from South Africa and the first report describing strains of P. mirabilis producing a TEM-26-type enzyme. The variety of extended-spectrum beta -lactamases found among members of the family Enterobacteriaceae isolated from major medical centers in South Africa is troubling and adds to the growing list of countries where these enzymes pose a serious problem for antimicrobial therapy.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The production of beta -lactamases is an important mechanism of resistance to beta -lactam antibiotics among gram-negative bacteria. Expanded-spectrum cephalosporins have been specifically designed to resist degradation by the older broad-spectrum beta -lactamases such as TEM-1, TEM-2, and SHV-1. The response to the expanded-spectrum cephalosporins among members of the family Enterobacteriaceae lacking inducible beta -lactamases has been the production of mutant forms of the older beta -lactamases called extended-spectrum beta -lactamases (ESBLs). These enzymes are capable of hydrolyzing the newer cephalosporins and aztreonam (11). Studies by biochemical and molecular techniques indicate that many ESBLs are derivatives of older TEM-1, TEM-2, or SHV-1 beta -lactamases, some of which differ from the parent enzyme by only one or two amino acids (11). In addition, resistance to the expanded-spectrum cephalosporins has also arisen in Klebsiella pneumoiae and Escherichia coli via the acquisition of plasmids containing the chromosomally encoded AmpC beta -lactamase found in Enterobacter spp., Pseudomonas aeruginosa, and Citrobacter spp. (3, 25, 26).

Although ESBL-producing members of the family Enterobacteriaceae were first reported in Europe in 1983 and 1984, ESBLs have now been found in organisms recovered from patients on all continents except Antarctica (14, 27). The occurrence of organisms producing ESBLs varies widely, with some types more prevalent in Europe (TEM-3) and others more prevalent in the United States (TEM-10, TEM-12 and TEM-26), while others appear worldwide (SHV-2 and SHV-5) (30).

Reports concerning the existence of members of the family Enterobacteriaceae producing ESBLs in Africa have been limited to Saharan countries, and information from sub-Saharan Africa is scarce. Members of the family Enterobacteriaceae producing SHV-2 have been isolated from three different African countries, namely, Tunisia (6), Senegal (29), and Egypt (29), while TEM-3, TEM-20, and TEM-21 have also been recovered from Tunisia (6). K. pneumoniae strains resistant to the expanded-spectrum cephalosporins were the cause of a nosocomial outbreak in South Africa in the late 1980s, but the mechanism of resistance was not described (9). Resistance to the expanded-spectrum cephalosporins has also been observed in other species of the family Enterobacteriaceae such as E. coli and Proteus mirabilis. Therefore, a study was designed to characterize and describe the mechanisms responsible for resistance to the expanded-spectrum cephalosporins among clinical isolates of K. pneumoniae, E. coli, and P. mirabilis recovered from various medical centers in South Africa.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Bacterial strains. During a period of 3 months in 1993, 37 strains of K. pneumoniae (13 blood, 5 burn, 7 wound, and 11 tracheal isolates), 4 strains of P. mirabilis (all wound isolates), and 4 strains of E. coli (1 blood, 1 burn, and 2 wound isolates) were collected from patients at the following medical centers in South Africa: Tygerberg Hospital near Cape Town, King Edward VIII Hospital in Durban, Chris Hani Baragwanath Hospital in Soweto, and Pretoria Academic Hospital in Pretoria. The strains were provided in response to a request for all strains of the family Enterobacteriaceae that lacked inducible beta -lactamases and that were intermediate or resistant to cefotaxime or ceftazidime. The total number of strains screened is unknown, and at this time the referring hospitals did not perform more sensitive screening tests for ESBL detection. Therefore, accurate prevalence data were not obtained.

Thirty-four of the 43 patients involved (including all from whom isolates from blood were obtained) had received an expanded-spectrum cephalosporin during the 4 weeks prior to isolation of the organisms described above. Fifteen patients (including eight patients from whose blood isolates were obtained) were receiving either cefotaxime or ceftazidime at the time that the isolates were cultured and were considered not to be responding to these agents.

Susceptibility testing and antibiotics. Antibiotic susceptibility was determined by standard disk diffusion (21) and agar dilution (20) procedures. Standard powders of the following antimicrobial agents were kindly provided by the indicated companies: piperacillin and tazobactam, Lederle Laboratories (Wayne, N.J.); cefoxitin and imipenem, Merck (Rathway, N.J.); cefotaxime, Hoechst-Roussel Pharmaceuticals Inc. (Somerville, N.J.); ceftazidime, Glaxo Group Research Ltd. (Greenford, England); and aztreonam and cefepime, Bristol-Myers Squibb (Princeton, N.J.). Disks for the agar diffusion procedures were obtained from Becton Dickinson Microbiology Systems (Cockeysville, Md.). For quality control purposes, the following quality control strains were run simultaneously with the test organisms: E. coli ATCC 25922, P. aeruginosa ATCC 27853, E. coli ATCC 35218, and Staphylococcus aureus ATCC 29213. Throughout this study, results were interpreted by using the criteria of the National Committee for Clinical Laboratory Standards for disk diffusion (21) and broth dilution (20) procedures.

Double-disk test. All the strains were screened for the production of ESBLs by using the double-disk test as described by Jarlier et al. (15). A potentiation of the zones of cefotaxime, ceftriaxone, ceftazidime, or aztreonam by clavulanic acid represented a positive test result and was indicative of the possible presence of an ESBL.

beta -Lactamase characterization. Overnight cultures in 5 ml of Trypticase soy broth were diluted with 45 ml of fresh broth and were incubated with shaking for 4 h at 37°C. The cells were harvested by centrifugation at 4°C, washed with 1 M potassium-phosphate buffer (pH 7.0), suspended, and sonicated. After sonication, crude extracts were obtained by centrifugation at 5,858 × g for 1 h. One strain, K. pneumoniae Pit 68, with a suspected AmpC beta -lactamase, was induced with cefoxitin as described previously (28). The rates of hydrolysis of 100 µM solutions of nitrocephin, cephalothin, cefotaxime, ceftazidime, and aztreonam were determined by spectrophotometric assays with crude beta -lactamase extracts (23).

The beta -lactamases in the sonic extracts were assessed for pIs and general substrate and inhibitor characteristics in polyacrylamide gels (4, 18, 31). As controls, crude beta -lactamase preparations from the following organisms possessing different TEM and SHV enzymes were examined simultaneously with the K. pneumoniae, E. coli, and P. mirabilis strains: TEM-1 [from E. coli RTEM(R6K)], TEM-2 [from E. coli 1752E(RP1)], TEM-10 [from E. coli C600(pK2)], TEM-26 [from E. coli HB101(pJPQ101), SHV-1 [from E. coli J53(R1010)], SHV-2 (from Klebsiella ozaenae 2180), SHV-3 [from E. coli J53(pUD18)], SHV-4 [from E. coli J53-2(pUD21)], and SHV-5 [from E. coli ClaNal(pAFF2)].

DNA amplification by PCR. The organisms were inoculated into 5 ml of Luria-Bertani broth (Difco, Detroit, Mich.) and incubated for 20 h at 37°C with shaking. Cells from 1.5 ml of an overnight culture were harvested by centrifugation at 17,310 × g in a Hermle centrifuge for 5 min. After the supernatant was decanted, the pellet was resuspended in 500 µl of distilled water. The cells were lysed by heating at 95°C for 10 min, and cellular debris was removed by centrifugation at 17,310 × g for 5 min. The supernatant was used as a source of template for amplification.

The following oligonucleotide primers specific for the SHV and TEM genes were designed by using MacVector, version 4.5 (Kodak/IBI): for SHV genes, A [5'-(CACTCAAGGATGTATTGTG)-3'] and B [5'-(TTAGCGTTGCCAGTGCTCG)-3'] corresponding to nucleotide numbers 103 to 121 and 988 to 970, respectively, of Mercier and Levesque (19); for TEM genes, C [5'-(TCGGGGAA ATGTGCGCG)-3'] and D [5'-(TGCTTAATCAGTGAGGCACC)-3'] corresponding to nucleotide numbers 90 to 105 and 1062 to 1042, respectively, of Sutcliffe (34). Primers A and B amplified a 885-bp fragment, while primers C and D amplified a 971-bp fragment. The specificities of the SHV and TEM primers for amplification of SHV and TEM genes, respectively, were tested by using the following beta -lactamase controls; TEM-1 (pACYC177), MIR-1 (from K. pneumoniae 96D), and SHV-7 (pCLL3410).

PCR amplifications were carried out on a DNA Thermal Cycler 480 instrument (Perkin-Elmer, Cetus, Norwalk, Conn.) with the Gene Amp DNA amplification kit containing AmpliTaq polymerase (Perkin-Elmer, Roche Molecular Systems, Inc., Branchburg, N.J.). The composition of the reaction mixture was as follows: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, each of the four deoxynucleoside triphosphates at a concentration of 0.2 mM, and 1.2 U of AmpliTaq in a total volume of 49 µl. A total of 1 µl of sample lysate was added to the reaction mixture, and the mixture was centrifuged briefly before 50 µl of mineral oil was layered onto the surface. The PCR program consisted of an initial denaturation step at 96°C for 15 s, followed by 24 cycles of DNA denaturation at 96°C for 15 s, primer annealing at 50°C for 15 s, and primer extension at 72°C for 2 min. After the last cycle the products were stored at 4°C. The PCR products (1/10 volume) were analyzed by electrophoresis with 1.4% agarose gels in TAE buffer (0.04 M Tris-acetate, 0.002 M EDTA [pH 8.5]). The gels were stained with ethidium bromide, and the PCR products were visualized with UV light. A single band was observed for TEM amplified products with a single primer set. Two amplified products were observed with the SHV primer set. The larger product, which corresponded to the expected size of the SHV-specific product, was gel purified with a 1.4% agarose gel in TAE buffer, and the purified PCR product was used for sequence analysis.

PCR products were sequenced by automated PCR cycle sequencing with dye-terminator chemistry by using a DNA stretch sequencer from Applied Biosystems.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Resistance phenotypes. All the strains except K. pneumoniae Pit 68 gave a positive disk potentiation when cefotaxime, ceftriaxone, aztreonam, and/or ceftazidime disks were used. The MICs of piperacillin, piperacillin-tazobactam, cefotaxime, ceftazidime, aztreonam, and cefoxitin revealed three different resistance phenotypes (Kpn1, Kpn2, and Kpn3) in the K. pneumoniae strains and two resistance phenotypes (Ec1 and Ec2) in E. coli strains (Table 1). The phenotypes Kpn1 and Ec1 involved high-level resistance to ceftazidime (MICs, >128 µg/ml) but susceptibility to cefotaxime (MIC range, 0.25 to 1 µg/ml), while Kpn2 and Ec2 involved decreased susceptibility to both cefotaxime (MIC range, 4 to 64 µg/ml) and ceftazidime (MIC range, 4 to 128 µg/ml). Kpn3, represented by K. pneumoniae Pit 68, involved resistance to cefoxitin (MIC, >128 µg/ml) and decreased susceptibility to cefotaxime, ceftazidime, and aztreonam (MICs >= 2 µg/ml) (Table 1). The P. mirabilis isolates showed decreased susceptibility to ceftazidime (MIC range, 16 to 64 µg/ml) and susceptibility to cefotaxime (MIC range, 0.25 to 0.5 µg/ml).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   MICs for the different resistance phenotypes observed in K. pneumoniae, E. coli, and P. mirabilis

beta -Lactamases. Strains representing the Kpn1 and Ec1 phenotypes produced beta -lactamases with pI values of 5.6 and 7.6 respectively, while phenotype Kpn2 and Ec2 involved enzymes with pIs of 5.4, 7.6, and 8.2 (Table 2). K. pneumoniae Pit 68, representing phenotype Kpn3, produced two beta -lactamases with pIs of 5.4 and 8.0, respectively. The P. mirabilis strains showed a single enzyme with a pI of 5.6 (Table 2). The enzymes with pIs of 5.4, 5.6, 7.6, and 8.2 aligned with TEM-1 (pI 5.4), TEM-10 or TEM-26 (pI 5.57), SHV-1, SHV-2, or SHV-8 (pI 7.6), and SHV-5 (pI 8.2) (Table 2). It was therefore necessary to investigate these enzymes further. On isoelectric focusing gels, all of the beta -lactamases except for the enzyme with a pI of 8.0 were inhibited by clavulanate, a characteristic of Bush group 2 enzymes (8). The enzyme with a pI of 8.0 was inhibited by cloxacillin, which correlates with Bush group 1 cephalosporinases (8). The substrate-based technique showed hydrolysis of 0.75 µg cefotaxime per ml at the bands focusing at pIs of 5.6, 8.0, and 8.2 and for some enzymes at the bands focusing at a pI of 7.6 (Table 2). Control enzymes of TEM-10, TEM-26, SHV-2, and SHV-5 showed hydrolysis of cefotaxime in this assay (Table 2).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Characteristics of beta -lactamases produced by different resistance phenotypes

Hydrolysis assays with nitrocefin, cefotaxime, ceftazidime, and aztreonam were performed with strains possessing single beta -lactamases. All the strains assayed hydrolyzed cefotaxime, ceftazidime, and aztreonam to some extent (Table 3).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 3.   Hydrolysis profiles of cell extracts containing a single beta -lactamase

DNA amplification and sequencing. The DNAs from organisms producing single beta -lactamases were amplified and sequenced. Strains producing ESBLs with pIs of 5.6, which aligned with TEM-10 and TEM-26, were amplified with the TEM primers (Table 4). The amino acids at positions 104, 164, and 240 (numbering of Ambler et al. [1]) were used to determine that this enzyme was more similar to TEM-26 (32). Amino acids deduced from amplicon sequences included lysine at position 104, serine at position 164, and glutamine at position 240 (Table 4). Strains producing ESBLs with pI values of 7.6 and 8.2, which aligned with SHV-2 and SHV-5, respectively, were amplified with SHV primers (Table 4). The amino acids at positions 205, 238, and 240 (numbering of Barthélémy et al. [2]) were used to identify the ESBL involved. The arginine at position 205, the serine at position 238, and the glutamic acid at position 240 of the deduced amino acid sequence of strains producing an ESBL with a pI of 7.6 indicated the presence of SHV-2 (13) (Table 4). K. pneumoniae Pit 82, producing an ESBL with a pI of 8.2, had a lysine at position 240, indicating the presence of SHV-5 (7) (Table 4).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 4.   Identification of extended-spectrum beta -lactamases occurring in South Africa

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Although members of the family Enterobacteriaceae producing ESBLs have been recovered from medical centers in South Africa since the late 1980s, little is known about the various types present or their prevalence (10). ESBL-producing K. pneumoniae strains have been involved in nosocomial outbreaks in intensive care units at several academic centers, leading to the temporary closure of one of the units. Furthermore, in Durban, a strain of K. pneumoniae producing an ESBL has been responsible for the failure of therapy with an expanded-spectrum cephalosporin (16).

This is the first report to identify definitively the different types of ESBLs produced by members of the family Enterobacteriaceae isolated from major medical centers in South Africa. The following ESBLs, produced by K. pneumoniae, E. coli, and P. mirabilis, were identified: a TEM-26-type beta -lactamase, SHV-2, SHV-5, and an AmpC beta -lactamase with a pI of 8.0. This represents the major types of beta -lactamases found worldwide. K. pneumoniae and E. coli producing TEM-26 were first isolated from cancer patients in a children's hospital in Stanford, Calif. (22), and have subsequently been described in England (12) and France (33). This is the first report of K. pneumoniae and E. coli producing a TEM-26-type beta -lactamase outside the United States, Europe, and the United Kingdom. Members of the family Enterobacteriaceae producing SHV-2 and SHV-5 have been described worldwide (30), and South Africa has now been added to the list of countries where these enzymes are present.

The occurrence of an AmpC beta -lactamase encoded on a plasmid recovered from strains of K. pneumoniae resistant to cefoxitin, as well as the expanded-spectrum cephalosporins, was first reported from Providence, R.I. (25). These strains were involved in a nosocomial outbreak, and imipenem was the only beta -lactam antibiotic active against the strains involved. Since that initial report, E. coli and K. pneumoniae strains producing plasmid-mediated AmpC beta -lactamases have been isolated worldwide (35). These Bush group 1 beta -lactamases appear to originate from chromosomal genes of Enterobacter, Citrobacter freundii, and P. aeruginosa (5). This report of a South African strain adds another isolate of K. pneumoniae which appears to produce this type of beta -lactamase. The DNA responsible for encoding this enzyme needs to be cloned and sequenced to determine if this is a new type of plasmid-mediated AmpC beta -lactamase.

beta -Lactamases with extended-spectrum activities were first isolated from P. mirabilis in 1991 (36). This enzyme, FPM-1, was very similar to the chromosomal cephalosporinase of Proteus vulgaris. Subsequently, P. mirabilis strains producing TEM-3 have been isolated in France (17), and P. mirabilis producing TEM-10 have been isolated in the United States (24). This is the first report describing clinical isolates of P. mirabilis that produce TEM-26.

The variety of beta -lactamases present in South Africa is disconcerting and probably reflects the overuse of the newer expanded-spectrum cephalosporins by the medical community at large. Although this investigation did not address the issue of prevalence, there is not doubt that the widespread dissemination of organisms producing ESBLs and plasmid-mediated AmpC enzymes will severely limit the therapeutic options of physicians facing these organisms, because the carbapenems are the only beta -lactam drugs uniformly active against organisms producing these beta -lactamases. Organisms producing these enzymes pose a serious threat for the future treatment of infections at large, and if these problems are to be minimized, it is important that these newer antimicrobial agents be used sparingly and with discretion.

    ACKNOWLEDGMENTS

DNA sequencing was supported in part by UNMC/Eppley Cancer Center grant P30CA36727.

We thank the following individuals for provision of some of the clinical isolates of K. pneumoniae: K. P. Klugman and L. Saunders, Chris Hani Baragwanath Hospital; A. Brink, Pretoria Academic Hospital; and Y. Coovadia, King Edward VIII Hospital.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, Creighton University School of Medicine, 2500 California Plaza, Omaha, NE 68178. Phone: (402) 280-1881. Fax: (402) 280-1225. E-mail: kstaac{at}creighton.edu.

dagger Present address: Department of Medical Microbiology, University of the Free State, Bloemfontein, South Africa 9300.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Ambler, R. P., A. F. W. Coulson, J. M. Frere, J. M. Ghuysen, B. Joris, M. Forsmann, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A beta -lactamases. Biochem. J. 276:269-270.
2. Barthélémy, M., J. Peduzzi, and R. Labia. 1988. Complete amino acid sequence of p453-plasmid-mediated PIT-2 beta -lactamase (SHV-1). Biochem. J. 251:73-79[Medline].
3. Bauernfeind, A., Y. Chong, and S. Schweighart. 1989. Extended broad-spectrum beta -lactamase in Klebsiella pneumoniae including resistance to cephamycins. Infection 17:316-321[Medline].
4. Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298[Medline].
5. Bauernfeind, A., I. Stemplinger, R. Jungwirth, R. Wilhelm, and Y. Chang. 1996. Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other beta -lactamase genes. Antimicrob. Agents Chemother. 40:1926-1930[Abstract].
6. Ben Hassen, A., G. Fournier, A. Kechrid, C. Fendri, S. Ben Redjeb, and A. Philippon. 1990. Résistance enzymatique au céfotaxime chez cinquante-six souches de Klebsiella spp., Escherichia coli et Salmonella spp. dans un hopital tunisien (1984-1988). Pathol. Biol. 38:464-469[Medline].
7. Billot-Klein, D., L. Gutmann, and E. Collatz. 1990. Nucleotide sequence of the SHV-5 beta -lactamase gene of Klebsiella pneumoniae plasmid. Antimicrob. Agents Chemother. 34:2439-2441[Abstract/Free Full Text].
8. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for beta -lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233[Medline].
9. Coovadia, Y. M., A. P. Johnson, B. H. Bhana, C. R. Hutchinson, R. C. George, and I. E. Haferjee. 1992. Multiresistant Klebsiella pneumoniae in a neonatal nursery: the importance of maintenance of infection control policies and procedures in prevention of outbreaks. J. Hosp. Infect. 22:197-205[Medline].
10. Derby, P., and J. Berens. 1997. Letter. South Afr. Med. J. 87:80[Medline].
11. DuBois, S. K., M. S. Marriott, and S. G. B. Amyes. 1995. TEM- and SHV-derived extended-spectrum beta -lactamases: relationship between selection, structure and function. J. Antimicrob. Chemother. 35:7-22[Abstract/Free Full Text].
12. Hibbert-Rodgers, L. C., J. Heritage, N. Todd, and P. M. Hawkey. 1994. Convergent evolution of TEM-26, a beta -lactamase with extended-spectrum activity. J. Antimicrob. Chemother. 33:707-720[Abstract/Free Full Text].
13. Huletsky, A., F. Coutre, and R. C. Levesque. 1990. Nucleotide sequence and phylogeny of SHV-2 beta -lactamase. Antimicrob. Agents Chemother. 34:1725-1732[Abstract/Free Full Text].
14. Jacoby, G. A., and A. A. Medeiros. 1991. More extended-spectrum beta -lactamases. Antimicrob. Agents Chemother. 35:1697-1704[Free Full Text].
15. Jarlier, V., M.-H. Nicolas, G. Fournier, and A. Philippon. 1988. Extended broad-spectrum beta -lactamases conferring transferable resistance to newer beta -lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 10:867-878[Medline].
16. Karas, J. A., D. G. Pillay, D. Muckart, and A. W. Sturm. 1996. Letter. J. Antimicrob. Chemother. 37:203-204[Free Full Text].
17. Mariotte, S., P. Nordmann, and M. H. Nicolas. 1994. Extended-spectrum beta -lactamase in Proteus mirabilis. J. Antimicrob. Chemother. 33:925-935[Abstract/Free Full Text].
18. Matthew, M. A., A. M. Harris, M. J. Marshall, and G. W. Ross. 1975. The use of analytical isoelectric focusing for detection and identification of beta -lactamases. J. Gen. Microbiol. 88:169-178[Medline].
19. Mercier, J., and R. C. Levesque. 1990. Cloning of SHV-2, OHIO-1, and OXA-6 beta -lactamases and cloning and sequencing of SHV-1 beta -lactamase. Antimicrob. Agents Chemother. 34:1577-1583[Abstract/Free Full Text].
20. National Committee for Clinical Laboratory Standards. 1994. Methods for dilution antimicrobial susceptibility for bacteria that grow aerobically, M7-T2, 4th ed. National Committee for Clinical Laboratory Standards, Villanova, Pa.
21. National Committee for Clinical Laboratory Standards. 1994. Performance standards for antimicrobial disk susceptibility tests, M2-T4, 4th ed. National Committee for Clinical Laboratory Standards, Villanova, Pa.
22. Naumovski, L., J. P. Quinn, D. Miyashiro, M. Patel, K. Bush, S. B. Singer, D. Graves, T. Palzkill, and A. M. Arvin. 1992. Outbreak of ceftazidime resistance due to extended-spectrum beta -lactamases in isolates from cancer patients. Antimicrob. Agents Chemother. 36:1991-1996[Abstract/Free Full Text].
23. O'Callaghan, C. H., P. W. Muggleton, S. M. Kirby, and D. M. Ryan. 1967. Inhibition of beta -lactamase decomposition of cephaloridine and cephalothin by other cephalosporins. Antimicrob. Agents Chemother. 11:337-343.
24. Palzkill, T., K. S. Thomson, C. C. Sanders, E. S. Moland, W. Huang, and T. W. Milligan. 1995. New variant of TEM-10 beta -lactamase gene produced by a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 39:1199-1200[Abstract].
25. Papanicolaou, G. A., A. A. Medeiros, and G. A. Jacoby. 1990. Novel plasmid-mediated beta -lactamase (MIR-1) conferring resistance to oxyimino- and alpha -methoxy beta -lactams in clinical isolates of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 34:2200-2209[Abstract/Free Full Text].
26. Payne, D. J., N. Woodford, and S. G. Amyes. 1992. Characterization of the plasmid mediated beta-lactamase BIL-1. J. Antimicrob. Chemother. 30:119-127[Abstract/Free Full Text].
27. Philippon, A., R. Labia, and G. A. Jacoby. 1989. Extended-spectrum beta -lactamases. Antimicrob. Agents Chemother. 33:1131-1136[Free Full Text].
28. Pitout, J. D. D., E. S. Moland, C. C. Sanders, K. S. Thomson, and S. R. Fitzsimmons. 1997. beta -Lactamases and detection of beta -lactam resistance in Enterobacter spp. Antimicrob. Agents Chemother. 41:35-39[Abstract].
29. Richard, C., A. Philippon, S. M'Boup, and J. F. Vieu. 1989. Epidemiologie des infections pediatriques a Klebsiella dans deux hopitaux de Dakar. Production de beta -lactamases a spectre elargi (1987-1988). Med. Mal. Infect. 19:753-759.
30. Sanders, C. C., and W. E. Sanders, Jr. 1992. beta -Lactam resistance in gram-negative bacteria: global trends and clinical impact. Clin. Infect. Dis. 15:824-839[Medline].
31. Sanders, C. C., W. E. Sanders, Jr., and E. S. Moland. 1986. Characterization of beta -lactamases in situ on polyacrylamide gels. Antimicrob. Agents Chemother. 30:951-952[Abstract/Free Full Text].
32. Sirot, D. 1995. Extended-spectrum plasmid-mediated beta -lactamases. J. Antimicrob. Chemother. 36(Suppl. A):19-34.
33. Soilleux, M. J., A. M. Morand, G. J. Arlet, M. R. Scavizzi, and R. Labia. 1996. Survey of Klebsiella pneumoniae producing extended-spectrum beta -lactamases: prevalence of TEM-3 and first identification of TEM-26 in France. Antimicrob. Agents Chemother. 40:1027-1029[Abstract].
34. Sutcliffe, J. G. 1978. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc. Natl. Acad. Sci. USA 75:3737-3741[Abstract/Free Full Text].
35. Thomson, K. S., A. M. Prevan, and C. C. Sanders. 1996. Novel plasmid-mediated beta -lactamases in Enterobacteriaceae: emerging problems for new beta -lactam antibiotics. Curr. Clin. Top. Infect. Dis. 16:151-163[Medline].
36. Watanabe, Y., T. Yokota, Y. Higashi, Y. Wakai, and Y. Mine. 1991. In-vitro and in-vivo transferable beta -lactam resistance due to new plasmid-mediated oxyiminocephalosporinase from a clinical isolate of Proteus mirabilis. Microbiol. Immunol. 35:87-97[Medline].

Antimicrobial Agents and Chemotherapy, June 1998, p. 1350-1354, Vol. 42, No. 6
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Radhouani, H., Poeta, P., Igrejas, G., Goncalves, A., Vinue, L., Torres, C. (2009). Antimicrobial resistance and phylogenetic groups in isolates of Escherichia coli from seagulls at the Berlengas nature reserve. Vet Rec. 165: 138-142 [Abstract] [Full Text]  
  • Schmidtke, A. J., Hanson, N. D. (2008). Role of ampD Homologs in Overproduction of AmpC in Clinical Isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 52: 3922-3927 [Abstract] [Full Text]  
  • Savini, V., Catavitello, C., Talia, M., Di Berardino, F., Manna, A., Balbinot, A., Febbo, F., Carlino, D., Fioritoni, F., Di Bonaventura, G., D'Antonio, D. (2008). Ulcer Infection by ES{beta}L-Producing Proteus mirabilis: A Case Report. INT J LOW EXTREM WOUNDS 7: 99-101 [Abstract]  
  • Pitout, J. D. D., Church, D. L., Gregson, D. B., Chow, B. L., McCracken, M., Mulvey, M. R., Laupland, K. B. (2007). Molecular Epidemiology of CTX-M-Producing Escherichia coli in the Calgary Health Region: Emergence of CTX-M-15-Producing Isolates. Antimicrob. Agents Chemother. 51: 1281-1286 [Abstract] [Full Text]  
  • Kadlec, K., Wiegand, I., Kehrenberg, C., Schwarz, S. (2007). Studies on the mechanisms of {beta}-lactam resistance in Bordetella bronchiseptica. J Antimicrob Chemother 59: 396-402 [Abstract] [Full Text]  
  • Schmidtke, A. J., Hanson, N. D. (2006). Model System To Evaluate the Effect of ampD Mutations on AmpC-Mediated {beta}-Lactam Resistance.. Antimicrob. Agents Chemother. 50: 2030-2037 [Abstract] [Full Text]  
  • Hanson, N. D., Hossain, A., Buck, L., Moland, E. S., Thomson, K. S. (2006). First Occurrence of a Pseudomonas aeruginosa Isolate in the United States Producing an IMP Metallo-{beta}-Lactamase, IMP-18.. Antimicrob. Agents Chemother. 50: 2272-2273 [Full Text]  
  • Sidjabat, H. E., Townsend, K. M., Hanson, N. D., Bell, J. M., Stokes, H. W., Gobius, K. S., Moss, S. M., Trott, D. J. (2006). Identification of blaCMY-7 and associated plasmid-mediated resistance genes in multidrug-resistant Escherichia coli isolated from dogs at a veterinary teaching hospital in Australia. J Antimicrob Chemother 57: 840-848 [Abstract] [Full Text]  
  • Gray, K. J., Wilson, L. K., Phiri, A., Corkill, J. E., French, N., Hart, C. A. (2006). Identification and characterization of ceftriaxone resistance and extended-spectrum {beta}-lactamases in Malawian bacteraemic Enterobacteriaceae. J Antimicrob Chemother 57: 661-665 [Abstract] [Full Text]  
  • Paterson, D. L., Bonomo, R. A. (2005). Extended-Spectrum {beta}-Lactamases: a Clinical Update. Clin. Microbiol. Rev. 18: 657-686 [Abstract] [Full Text]  
  • Zarnayova, M., Siebor, E., Pechinot, A., Duez, J.-M., Bujdakova, H., Labia, R., Neuwirth, C. (2005). Survey of Enterobacteriaceae Producing Extended-Spectrum {beta}-Lactamases in a Slovak Hospital: Dominance of SHV-2a and Characterization of TEM-132. Antimicrob. Agents Chemother. 49: 3066-3069 [Abstract] [Full Text]  
  • Pitout, J. D. D., Gregson, D. B., Church, D. L., Elsayed, S., Laupland, K. B. (2005). Community-Wide Outbreaks of Clonally Related CTX-M-14 {beta}-Lactamase-Producing Escherichia coli Strains in the Calgary Health Region. J. Clin. Microbiol. 43: 2844-2849 [Abstract] [Full Text]  
  • Ohana, S., Leflon, V., Ronco, E., Rottman, M., Guillemot, D., Lortat-Jacob, S., Denys, P., Loubert, G., Nicolas-Chanoine, M.-H., Gaillard, J.-L., Lawrence, C. (2005). Spread of a Klebsiella pneumoniae Strain Producing a Plasmid- Mediated ACC-1 AmpC {beta}-Lactamase in a Teaching Hospital Admitting Disabled Patients. Antimicrob. Agents Chemother. 49: 2095-2097 [Abstract] [Full Text]  
  • Mortensen, J. E., Bernier, M., Gray, L. D., Dolan, S., Hanson, N. D., Moland, E. S., Abdalhamid, B. (2005). New Quality Control Strain for Use in Routine Testing for Production of Extended-Spectrum Beta-Lactamases by Enterobacteriaceae. J. Clin. Microbiol. 43: 2545-2545 [Full Text]  
  • Brinas, L., Moreno, M. A., Teshager, T., Saenz, Y., Porrero, M. C., Dominguez, L., Torres, C. (2005). Monitoring and Characterization of Extended-Spectrum {beta}-Lactamases in Escherichia coli Strains from Healthy and Sick Animals in Spain in 2003. Antimicrob. Agents Chemother. 49: 1262-1264 [Abstract] [Full Text]  
  • Linscott, A. J., Brown, W. J. (2005). Evaluation of Four Commercially Available Extended-Spectrum Beta-Lactamase Phenotypic Confirmation Tests. J. Clin. Microbiol. 43: 1081-1085 [Abstract] [Full Text]  
  • Hammond, D. S., Schooneveldt, J. M., Nimmo, G. R., Huygens, F., Giffard, P. M. (2005). blaSHV Genes in Klebsiella pneumoniae: Different Allele Distributions Are Associated with Different Promoters within Individual Isolates. Antimicrob. Agents Chemother. 49: 256-263 [Abstract] [Full Text]  
  • Literacka, E., Empel, J., Baraniak, A., Sadowy, E., Hryniewicz, W., Gniadkowski, M. (2004). Four Variants of the Citrobacter freundii AmpC-Type Cephalosporinases, Including Novel Enzymes CMY-14 and CMY-15, in a Proteus mirabilis Clone Widespread in Poland. Antimicrob. Agents Chemother. 48: 4136-4143 [Abstract] [Full Text]  
  • Reisbig, M. D., Hanson, N. D. (2004). Promoter Sequences Necessary for High-Level Expression of the Plasmid-Associated ampC {beta}-Lactamase Gene blaMIR-1. Antimicrob. Agents Chemother. 48: 4177-4182 [Abstract] [Full Text]  
  • Kruger, T., Szabo, D., Keddy, K. H., Deeley, K., Marsh, J. W., Hujer, A. M., Bonomo, R. A., Paterson, D. L. (2004). Infections with Nontyphoidal Salmonella Species Producing TEM-63 or a Novel TEM Enzyme, TEM-131, in South Africa. Antimicrob. Agents Chemother. 48: 4263-4270 [Abstract] [Full Text]  
  • Abdalhamid, B., Pitout, J. D. D., Moland, E. S., Hanson, N. D. (2004). Community-Onset Disease Caused by Citrobacter freundii Producing a Novel CTX-M {beta}-Lactamase, CTX-M-30, in Canada. Antimicrob. Agents Chemother. 48: 4435-4437 [Abstract] [Full Text]  
  • Leflon-Guibout, V., Jurand, C., Bonacorsi, S., Espinasse, F., Guelfi, M. C., Duportail, F., Heym, B., Bingen, E., Nicolas-Chanoine, M.-H. (2004). Emergence and Spread of Three Clonally Related Virulent Isolates of CTX-M-15-Producing Escherichia coli with Variable Resistance to Aminoglycosides and Tetracycline in a French Geriatric Hospital. Antimicrob. Agents Chemother. 48: 3736-3742 [Abstract] [Full Text]  
  • Saenz, Y., Brinas, L., Dominguez, E., Ruiz, J., Zarazaga, M., Vila, J., Torres, C. (2004). Mechanisms of Resistance in Multiple-Antibiotic-Resistant Escherichia coli Strains of Human, Animal, and Food Origins. Antimicrob. Agents Chemother. 48: 3996-4001 [Abstract] [Full Text]  
  • Giles, W. P., Benson, A. K., Olson, M. E., Hutkins, R. W., Whichard, J. M., Winokur, P. L., Fey, P. D. (2004). DNA Sequence Analysis of Regions Surrounding blaCMY-2 from Multiple Salmonella Plasmid Backbones. Antimicrob. Agents Chemother. 48: 2845-2852 [Abstract] [Full Text]  
  • Burall, L. S., Harro, J. M., Li, X., Lockatell, C.V., Himpsl, S. D., Hebel, J. R., Johnson, D. E., Mobley, H. L. T. (2004). Proteus mirabilis Genes That Contribute to Pathogenesis of Urinary Tract Infection: Identification of 25 Signature-Tagged Mutants Attenuated at Least 100-Fold. Infect. Immun. 72: 2922-2938 [Abstract] [Full Text]  
  • Schwaber, M. J., Raney, P. M., Rasheed, J. K., Biddle, J. W., Williams, P., McGowan, J. E. Jr., Tenover, F. C. (2004). Utility of NCCLS Guidelines for Identifying Extended-Spectrum {beta}-Lactamases in Non-Escherichia coli and Non-Klebsiella spp. of Enterobacteriaceae. J. Clin. Microbiol. 42: 294-298 [Abstract] [Full Text]  
  • Pitout, J. D. D., Reisbig, M. D., Mulvey, M., Chui, L., Louie, M., Crowe, L., Church, D. L., Elsayed, S., Gregson, D., Ahmed, R., Tilley, P., Hanson, N. D. (2003). Association between Handling of Pet Treats and Infection with Salmonella enterica Serotype Newport Expressing the AmpC {beta}-Lactamase, CMY-2. J. Clin. Microbiol. 41: 4578-4582 [Abstract] [Full Text]  
  • Pitout, J. D. D., Reisbig, M. D., Venter, E. C., Church, D. L., Hanson, N. D. (2003). Modification of the Double-Disk Test for Detection of Enterobacteriaceae Producing Extended-Spectrum and AmpC {beta}-Lactamases. J. Clin. Microbiol. 41: 3933-3935 [Abstract] [Full Text]  
  • Brinas, L., Moreno, M. A., Zarazaga, M., Porrero, C., Saenz, Y., Garcia, M., Dominguez, L., Torres, C. (2003). Detection of CMY-2, CTX-M-14, and SHV-12 {beta}-Lactamases in Escherichia coli Fecal-Sample Isolates from Healthy Chickens. Antimicrob. Agents Chemother. 47: 2056-2058 [Abstract] [Full Text]  
  • Mahlen, S. D., Morrow, S. S., Abdalhamid, B., Hanson, N. D. (2003). Analyses of ampC gene expression in Serratia marcescens reveal new regulatory properties. J Antimicrob Chemother 51: 791-802 [Abstract] [Full Text]  
  • Cao, V., Lambert, T., Nhu, D. Q., Loan, H. K., Hoang, N. K., Arlet, G., Courvalin, P. (2002). Distribution of Extended-Spectrum {beta}-Lactamases in Clinical Isolates of Enterobacteriaceae in Vietnam. Antimicrob. Agents Chemother. 46: 3739-3743 [Abstract] [Full Text]  
  • Brinas, L., Zarazaga, M., Saenz, Y., Ruiz-Larrea, F., Torres, C. (2002). {beta}-Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals. Antimicrob. Agents Chemother. 46: 3156-3163 [Abstract] [Full Text]  
  • Carattoli, A., Tosini, F., Giles, W. P., Rupp, M. E., Hinrichs, S. H., Angulo, F. J., Barrett, T. J., Fey, P. D. (2002). Characterization of Plasmids Carrying CMY-2 from Expanded-Spectrum Cephalosporin-Resistant Salmonella Strains Isolated in the United States between 1996 and 1998. Antimicrob. Agents Chemother. 46: 1269-1272 [Abstract] [Full Text]  
  • Pagani, L., Migliavacca, R., Pallecchi, L., Matti, C., Giacobone, E., Amicosante, G., Romero, E., Rossolini, G. M. (2002). Emerging Extended-Spectrum {beta}-Lactamases in Proteus mirabilis. J. Clin. Microbiol. 40: 1549-1552 [Abstract] [Full Text]  
  • Philippon, A., Arlet, G., Jacoby, G. A. (2002). Plasmid-Determined AmpC-Type {beta}-Lactamases. Antimicrob. Agents Chemother. 46: 1-11 [Full Text]  
  • Bradford, P. A. (2001). Extended-Spectrum {beta}-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clin. Microbiol. Rev. 14: 933-951 [Abstract] [Full Text]  
  • Essack, S. Y., Hall, L. M. C., Pillay, D. G., McFadyen, M. L., Livermore, D. M. (2001). Complexity and Diversity of Klebsiella pneumoniae Strains with Extended-Spectrum {beta}-Lactamases Isolated in 1994 and 1996 at a Teaching Hospital in Durban, South Africa. Antimicrob. Agents Chemother. 45: 88-95 [Abstract] [Full Text]  
  • Dunne, E. F., Fey, P. D., Kludt, P., Reporter, R., Mostashari, F., Shillam, P., Wicklund, J., Miller, C., Holland, B., Stamey, K., Barrett, T. J., Rasheed, J. K., Tenover, F. C., Ribot, E. M., Angulo, F. J. (2000). Emergence of Domestically Acquired Ceftriaxone-Resistant Salmonella Infections Associated With AmpC {beta}-Lactamase. JAMA 284: 3151-3156 [Abstract] [Full Text]  
  • Teshager, T., Domínguez, L., Moreno, M. A., Saénz, Y., Torres, C., Cardeñosa, S. (2000). Isolation of an SHV-12 beta -Lactamase-Producing Escherichia coli Strain from a Dog with Recurrent Urinary Tract Infections. Antimicrob. Agents Chemother. 44: 3483-3484 [Full Text]  
  • Naas, T., Benaoudia, F., Massuard, S., Nordmann, P. (2000). Integron-located VEB-1 extended-spectrum {beta}-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J Antimicrob Chemother 46: 703-711 [Abstract] [Full Text]  
  • Villa, L., Pezzella, C., Tosini, F., Visca, P., Petrucca, A., Carattoli, A. (2000). Multiple-Antibiotic Resistance Mediated by Structurally Related IncL/M Plasmids Carrying an Extended-Spectrum beta -Lactamase Gene and a Class 1 Integron. Antimicrob. Agents Chemother. 44: 2911-2914 [Abstract] [Full Text]  
  • Rasheed, J. K., Anderson, G. J., Yigit, H., Queenan, A. M., Doménech-Sánchez, A., Swenson, J. M., Biddle, J. W., Ferraro, M. J., Jacoby, G. A., Tenover, F. C. (2000). Characterization of the Extended-Spectrum beta -Lactamase Reference Strain, Klebsiella pneumoniae K6 (ATCC 700603), Which Produces the Novel Enzyme SHV-18. Antimicrob. Agents Chemother. 44: 2382-2388 [Abstract] [Full Text]  
  • Chanal, C., Bonnet, R., De Champs, C., Sirot, D., Labia, R., Sirot, J. (2000). Prevalence of beta -Lactamases among 1,072 Clinical Strains of Proteus mirabilis: a 2-Year Survey in a French Hospital. Antimicrob. Agents Chemother. 44: 1930-1935 [Abstract] [Full Text]  
  • Fey, P. D., Safranek, T. J., Rupp, M. E., Dunne, E. F., Ribot, E., Iwen, P. C., Bradford, P. A., Angulo, F. J., Hinrichs, S. H. (2000). Ceftriaxone-Resistant Salmonella Infection Acquired by a Child from Cattle. NEJM 342: 1242-1249 [Abstract] [Full Text]  
  • BEECHING, N.J., HART, C.A., DUERDEN, B.I. (2000). Tropical and exotic infections: Proceedings of the fifth Liverpool Tropical School Bayer Symposium on Microbial Diseases held on 14 February 1998. J Med Microbiol 49: 5-27 [Full Text]  
  • Bonnet, R., De Champs, C., Sirot, D., Chanal, C., Labia, R., Sirot, J. (1999). Diversity of TEM Mutants in Proteus mirabilis. Antimicrob. Agents Chemother. 43: 2671-2677 [Abstract] [Full Text]  
  • Heritage, J., M'Zali, F. H., Gascoyne-Binzi, D., Hawkey, P. M. (1999). Evolution and spread of SHV extended-spectrum {beta}-lactamases in Gram-negative bacteria. J Antimicrob Chemother 44: 309-318 [Abstract] [Full Text]  
  • Hanson, N. D., Thomson, K. S., Moland, E. S., Sanders, C. C., Berthold, G., Penn, R. G. (1999). Molecular characterization of a multiply resistant Klebsiella pneumoniae encoding ESBLs and a plasmid-mediated AmpC. J Antimicrob Chemother 44: 377-380 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pitout, J. D. D.
Right arrow Articles by Sanders, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pitout, J. D. D.
Right arrow Articles by Sanders, C. C.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»