Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, June 1998, p. 1350-1354, Vol. 42, No. 6
Department of Medical Microbiology and
Immunology, Creighton University School of Medicine, Omaha,
Nebraska 68178
Received 21 August 1997/Returned for modification 15 December
1997/Accepted 28 March 1998
Although resistance to the expanded-spectrum cephalosporins among
members of the family Enterobacteriaceae lacking
inducible The production of Although ESBL-producing members of the family
Enterobacteriaceae were first reported in Europe in 1983 and 1984, ESBLs have now been found in organisms recovered from
patients on all continents except Antarctica (14, 27). The
occurrence of organisms producing ESBLs varies widely, with some types
more prevalent in Europe (TEM-3) and others more prevalent in the
United States (TEM-10, TEM-12 and TEM-26), while others appear
worldwide (SHV-2 and SHV-5) (30).
Reports concerning the existence of members of the family
Enterobacteriaceae producing ESBLs in Africa have been
limited to Saharan countries, and information from sub-Saharan Africa
is scarce. Members of the family Enterobacteriaceae
producing SHV-2 have been isolated from three different African
countries, namely, Tunisia (6), Senegal (29), and
Egypt (29), while TEM-3, TEM-20, and TEM-21 have also been
recovered from Tunisia (6). K. pneumoniae
strains resistant to the expanded-spectrum cephalosporins were the
cause of a nosocomial outbreak in South Africa in the late 1980s, but
the mechanism of resistance was not described (9).
Resistance to the expanded-spectrum cephalosporins has also been
observed in other species of the family Enterobacteriaceae such as E. coli and Proteus mirabilis. Therefore,
a study was designed to characterize and describe the mechanisms
responsible for resistance to the expanded-spectrum cephalosporins
among clinical isolates of K. pneumoniae, E. coli, and P. mirabilis recovered from various
medical centers in South Africa.
Bacterial strains.
During a period of 3 months in 1993, 37 strains of K. pneumoniae (13 blood, 5 burn, 7 wound,
and 11 tracheal isolates), 4 strains of P. mirabilis
(all wound isolates), and 4 strains of E. coli (1 blood, 1 burn, and 2 wound isolates) were collected from patients at the
following medical centers in South Africa: Tygerberg Hospital near Cape
Town, King Edward VIII Hospital in Durban, Chris Hani Baragwanath
Hospital in Soweto, and Pretoria Academic Hospital in Pretoria. The
strains were provided in response to a request for all strains of the
family Enterobacteriaceae that lacked inducible
0066-4804/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
-Lactamases Responsible for Resistance to Expanded-Spectrum
Cephalosporins in Klebsiella pneumoniae, Escherichia
coli, and Proteus mirabilis Isolates Recovered in
South Africa

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-lactamases occurs virtually worldwide, little is known
about this problem among isolates recovered in South Africa.
Isolates of Klebsiella pneumoniae, Escherichia
coli, and Proteus mirabilis resistant to
expanded-spectrum cephalosporins recovered from patients in various
parts of South Africa over a 3-month period were investigated for
extended-spectrum
-lactamase production. Antibiotic susceptibility was determined by standard disk diffusion and agar dilution procedures. Production of extended-spectrum
-lactamases was evaluated by using
the double-disk test, and the
-lactamases were characterized by
spectrophotometric hydrolysis assays and an isoelectric
focusing overlay technique which simultaneously determined isoelectric points and general substrate or inhibitor characteristics. DNA amplification and sequencing were performed to confirm the identities of these enzymes. The P. mirabilis and E. coli
isolates were found to produce TEM-26-type, SHV-2, and SHV-5
extended-spectrum
-lactamases. An AmpC-related enzyme which had a pI
of 8.0 and which conferred resistance to cefoxitin as well as the
expanded-spectrum cephalosporins was found in a strain of K. pneumoniae. This is the first study which has identified
organisms producing different extended-spectrum
-lactamases from
South Africa and the first report describing strains of P. mirabilis producing a TEM-26-type enzyme. The variety of
extended-spectrum
-lactamases found among members of the family Enterobacteriaceae isolated from major medical centers in
South Africa is troubling and adds to the growing list of countries where these enzymes pose a serious problem for antimicrobial therapy.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-lactamases is
an important mechanism of resistance to
-lactam antibiotics
among gram-negative bacteria. Expanded-spectrum cephalosporins
have been specifically designed to resist degradation by the older
broad-spectrum
-lactamases such as TEM-1, TEM-2, and SHV-1.
The response to the expanded-spectrum cephalosporins among members of
the family Enterobacteriaceae lacking inducible
-lactamases has been the production of mutant forms of the
older
-lactamases called extended-spectrum
-lactamases (ESBLs). These enzymes are capable of hydrolyzing
the newer cephalosporins and aztreonam (11). Studies
by biochemical and molecular techniques indicate that many ESBLs
are derivatives of older TEM-1, TEM-2, or SHV-1
-lactamases, some of
which differ from the parent enzyme by only one or two amino acids
(11). In addition, resistance to the expanded-spectrum
cephalosporins has also arisen in Klebsiella pneumoiae
and Escherichia coli via the acquisition of plasmids containing the chromosomally encoded AmpC
-lactamase found in Enterobacter spp., Pseudomonas aeruginosa,
and Citrobacter spp. (3, 25, 26).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-lactamases and that were intermediate or resistant to cefotaxime or
ceftazidime. The total number of strains screened is unknown, and at
this time the referring hospitals did not perform more sensitive
screening tests for ESBL detection. Therefore, accurate prevalence data
were not obtained.
Susceptibility testing and antibiotics. Antibiotic susceptibility was determined by standard disk diffusion (21) and agar dilution (20) procedures. Standard powders of the following antimicrobial agents were kindly provided by the indicated companies: piperacillin and tazobactam, Lederle Laboratories (Wayne, N.J.); cefoxitin and imipenem, Merck (Rathway, N.J.); cefotaxime, Hoechst-Roussel Pharmaceuticals Inc. (Somerville, N.J.); ceftazidime, Glaxo Group Research Ltd. (Greenford, England); and aztreonam and cefepime, Bristol-Myers Squibb (Princeton, N.J.). Disks for the agar diffusion procedures were obtained from Becton Dickinson Microbiology Systems (Cockeysville, Md.). For quality control purposes, the following quality control strains were run simultaneously with the test organisms: E. coli ATCC 25922, P. aeruginosa ATCC 27853, E. coli ATCC 35218, and Staphylococcus aureus ATCC 29213. Throughout this study, results were interpreted by using the criteria of the National Committee for Clinical Laboratory Standards for disk diffusion (21) and broth dilution (20) procedures.
Double-disk test. All the strains were screened for the production of ESBLs by using the double-disk test as described by Jarlier et al. (15). A potentiation of the zones of cefotaxime, ceftriaxone, ceftazidime, or aztreonam by clavulanic acid represented a positive test result and was indicative of the possible presence of an ESBL.
-Lactamase characterization.
Overnight cultures in 5 ml
of Trypticase soy broth were diluted with 45 ml of fresh broth and were
incubated with shaking for 4 h at 37°C. The cells were harvested
by centrifugation at 4°C, washed with 1 M potassium-phosphate buffer
(pH 7.0), suspended, and sonicated. After sonication, crude extracts
were obtained by centrifugation at 5,858 × g for
1 h. One strain, K. pneumoniae Pit 68, with a
suspected AmpC
-lactamase, was induced with cefoxitin as described
previously (28). The rates of hydrolysis of 100 µM
solutions of nitrocephin, cephalothin, cefotaxime, ceftazidime, and aztreonam were determined by spectrophotometric assays with crude
-lactamase extracts (23).
-lactamases in the sonic extracts were assessed for pIs and
general substrate and inhibitor characteristics in polyacrylamide gels (4, 18, 31). As controls, crude
-lactamase
preparations from the following organisms possessing different TEM and
SHV enzymes were examined simultaneously with the K. pneumoniae, E. coli, and P. mirabilis strains: TEM-1 [from E. coli
RTEM(R6K)], TEM-2 [from E. coli 1752E(RP1)],
TEM-10 [from E. coli C600(pK2)], TEM-26 [from
E. coli HB101(pJPQ101), SHV-1 [from E. coli
J53(R1010)], SHV-2 (from Klebsiella ozaenae 2180),
SHV-3 [from E. coli J53(pUD18)], SHV-4 [from E. coli J53-2(pUD21)], and SHV-5 [from E. coli
ClaNal(pAFF2)].
DNA amplification by PCR. The organisms were inoculated into 5 ml of Luria-Bertani broth (Difco, Detroit, Mich.) and incubated for 20 h at 37°C with shaking. Cells from 1.5 ml of an overnight culture were harvested by centrifugation at 17,310 × g in a Hermle centrifuge for 5 min. After the supernatant was decanted, the pellet was resuspended in 500 µl of distilled water. The cells were lysed by heating at 95°C for 10 min, and cellular debris was removed by centrifugation at 17,310 × g for 5 min. The supernatant was used as a source of template for amplification.
The following oligonucleotide primers specific for the SHV and TEM genes were designed by using MacVector, version 4.5 (Kodak/IBI): for SHV genes, A [5'-(CACTCAAGGATGTATTGTG)-3'] and B [5'-(TTAGCGTTGCCAGTGCTCG)-3'] corresponding to nucleotide numbers 103 to 121 and 988 to 970, respectively, of Mercier and Levesque (19); for TEM genes, C [5'-(TCGGGGAA ATGTGCGCG)-3'] and D [5'-(TGCTTAATCAGTGAGGCACC)-3'] corresponding to nucleotide numbers 90 to 105 and 1062 to 1042, respectively, of Sutcliffe (34). Primers A and B amplified a 885-bp fragment, while primers C and D amplified a 971-bp fragment. The specificities of the SHV and TEM primers for amplification of SHV and TEM genes, respectively, were tested by using the following
-lactamase
controls; TEM-1 (pACYC177), MIR-1 (from K. pneumoniae 96D), and SHV-7 (pCLL3410).
PCR amplifications were carried out on a DNA Thermal Cycler 480 instrument (Perkin-Elmer, Cetus, Norwalk, Conn.) with the Gene Amp DNA
amplification kit containing AmpliTaq polymerase (Perkin-Elmer, Roche
Molecular Systems, Inc., Branchburg, N.J.). The composition of the
reaction mixture was as follows: 10 mM Tris-HCl (pH 8.3), 50 mM KCl,
0.1% Triton X-100, 1.5 mM MgCl2, each of the four
deoxynucleoside triphosphates at a concentration of 0.2 mM, and 1.2 U
of AmpliTaq in a total volume of 49 µl. A total of 1 µl of sample
lysate was added to the reaction mixture, and the mixture was
centrifuged briefly before 50 µl of mineral oil was layered onto the
surface. The PCR program consisted of an initial denaturation step at
96°C for 15 s, followed by 24 cycles of DNA denaturation at
96°C for 15 s, primer annealing at 50°C for 15 s, and
primer extension at 72°C for 2 min. After the last cycle the products
were stored at 4°C. The PCR products (1/10 volume) were analyzed by
electrophoresis with 1.4% agarose gels in TAE buffer (0.04 M
Tris-acetate, 0.002 M EDTA [pH 8.5]). The gels were stained with
ethidium bromide, and the PCR products were visualized with UV light. A
single band was observed for TEM amplified products with a single
primer set. Two amplified products were observed with the SHV primer
set. The larger product, which corresponded to the expected size of the
SHV-specific product, was gel purified with a 1.4% agarose gel in TAE
buffer, and the purified PCR product was used for sequence analysis.
PCR products were sequenced by automated PCR cycle sequencing with
dye-terminator chemistry by using a DNA stretch sequencer from
Applied Biosystems.
| |
RESULTS |
|---|
|
|
|---|
Resistance phenotypes.
All the strains except K. pneumoniae Pit 68 gave a positive disk potentiation when
cefotaxime, ceftriaxone, aztreonam, and/or ceftazidime disks were used.
The MICs of piperacillin, piperacillin-tazobactam, cefotaxime,
ceftazidime, aztreonam, and cefoxitin revealed three different
resistance phenotypes (Kpn1, Kpn2, and Kpn3) in the K. pneumoniae strains and two resistance phenotypes (Ec1 and Ec2) in
E. coli strains (Table 1). The
phenotypes Kpn1 and Ec1 involved high-level resistance to ceftazidime
(MICs, >128 µg/ml) but susceptibility to cefotaxime (MIC range, 0.25 to 1 µg/ml), while Kpn2 and Ec2 involved decreased susceptibility
to both cefotaxime (MIC range, 4 to 64 µg/ml) and ceftazidime (MIC
range, 4 to 128 µg/ml). Kpn3, represented by K. pneumoniae Pit 68, involved resistance to cefoxitin (MIC, >128
µg/ml) and decreased susceptibility to cefotaxime, ceftazidime, and
aztreonam (MICs
2 µg/ml) (Table 1). The P. mirabilis isolates showed decreased susceptibility to ceftazidime (MIC range, 16 to 64 µg/ml) and susceptibility to cefotaxime (MIC range, 0.25 to 0.5 µg/ml).
|
-Lactamases.
Strains representing the Kpn1 and Ec1
phenotypes produced
-lactamases with pI values of 5.6 and 7.6 respectively, while phenotype Kpn2 and Ec2 involved enzymes with pIs of
5.4, 7.6, and 8.2 (Table 2).
K. pneumoniae Pit 68, representing phenotype
Kpn3, produced two
-lactamases with pIs of 5.4 and 8.0, respectively. The P. mirabilis strains showed a single
enzyme with a pI of 5.6 (Table 2). The enzymes with pIs of 5.4, 5.6, 7.6, and 8.2 aligned with TEM-1 (pI 5.4), TEM-10 or TEM-26 (pI
5.57), SHV-1, SHV-2, or SHV-8 (pI 7.6), and SHV-5 (pI 8.2) (Table 2).
It was therefore necessary to investigate these enzymes further. On
isoelectric focusing gels, all of the
-lactamases except for the
enzyme with a pI of 8.0 were inhibited by clavulanate, a characteristic
of Bush group 2 enzymes (8). The enzyme with a pI of
8.0 was inhibited by cloxacillin, which correlates with Bush group 1 cephalosporinases (8). The substrate-based technique showed
hydrolysis of 0.75 µg cefotaxime per ml at the bands focusing at pIs
of 5.6, 8.0, and 8.2 and for some enzymes at the bands focusing at a pI
of 7.6 (Table 2). Control enzymes of TEM-10, TEM-26, SHV-2, and SHV-5 showed hydrolysis of cefotaxime in this assay (Table 2).
|
-lactamases. All the strains assayed hydrolyzed cefotaxime, ceftazidime, and aztreonam to some extent (Table 3).
|
DNA amplification and sequencing.
The DNAs from
organisms producing single
-lactamases were amplified and sequenced.
Strains producing ESBLs with pIs of 5.6, which aligned with TEM-10 and
TEM-26, were amplified with the TEM primers (Table
4). The amino acids at positions 104, 164, and 240 (numbering of Ambler et al. [1]) were
used to determine that this enzyme was more similar to TEM-26
(32). Amino acids deduced from amplicon sequences
included lysine at position 104, serine at position 164, and glutamine
at position 240 (Table 4). Strains producing ESBLs with pI values of
7.6 and 8.2, which aligned with SHV-2 and SHV-5, respectively, were
amplified with SHV primers (Table 4). The amino acids at positions 205, 238, and 240 (numbering of Barthélémy et al.
[2]) were used to identify the ESBL involved. The
arginine at position 205, the serine at position 238, and the glutamic
acid at position 240 of the deduced amino acid sequence of strains
producing an ESBL with a pI of 7.6 indicated the presence of SHV-2
(13) (Table 4). K. pneumoniae Pit 82, producing an ESBL with a pI of 8.2, had a lysine at position 240, indicating the presence of SHV-5 (7) (Table 4).
|
| |
DISCUSSION |
|---|
|
|
|---|
Although members of the family Enterobacteriaceae producing ESBLs have been recovered from medical centers in South Africa since the late 1980s, little is known about the various types present or their prevalence (10). ESBL-producing K. pneumoniae strains have been involved in nosocomial outbreaks in intensive care units at several academic centers, leading to the temporary closure of one of the units. Furthermore, in Durban, a strain of K. pneumoniae producing an ESBL has been responsible for the failure of therapy with an expanded-spectrum cephalosporin (16).
This is the first report to identify definitively the different types
of ESBLs produced by members of the family
Enterobacteriaceae isolated from major medical centers in
South Africa. The following ESBLs, produced by K. pneumoniae, E. coli, and P. mirabilis,
were identified: a TEM-26-type
-lactamase, SHV-2, SHV-5, and an AmpC
-lactamase with a pI of 8.0. This represents the major types of
-lactamases found worldwide. K. pneumoniae and
E. coli producing TEM-26 were first isolated from cancer
patients in a children's hospital in Stanford, Calif. (22),
and have subsequently been described in England
(12) and France (33). This is the first report of
K. pneumoniae and E. coli producing a
TEM-26-type
-lactamase outside the United States, Europe, and
the United Kingdom. Members of the family
Enterobacteriaceae producing SHV-2 and SHV-5 have been
described worldwide (30), and South Africa has now been added to the list of countries where these enzymes are present.
The occurrence of an AmpC
-lactamase encoded on a plasmid
recovered from strains of K. pneumoniae resistant to
cefoxitin, as well as the expanded-spectrum cephalosporins, was first
reported from Providence, R.I. (25). These strains were
involved in a nosocomial outbreak, and imipenem was the only
-lactam antibiotic active against the strains involved. Since
that initial report, E. coli and K. pneumoniae strains producing plasmid-mediated AmpC
-lactamases have been isolated worldwide (35).
These Bush group 1
-lactamases appear to originate from
chromosomal genes of Enterobacter, Citrobacter
freundii, and P. aeruginosa (5).
This report of a South African strain adds another isolate of
K. pneumoniae which appears to produce this type of
-lactamase. The DNA responsible for encoding this enzyme needs
to be cloned and sequenced to determine if this is a new type of
plasmid-mediated AmpC
-lactamase.
-Lactamases with extended-spectrum activities were first isolated
from P. mirabilis in 1991 (36). This enzyme,
FPM-1, was very similar to the chromosomal cephalosporinase of
Proteus vulgaris. Subsequently, P. mirabilis
strains producing TEM-3 have been isolated in France
(17), and P. mirabilis producing TEM-10 have
been isolated in the United States (24). This is the first
report describing clinical isolates of P. mirabilis
that produce TEM-26.
The variety of
-lactamases present in South Africa is disconcerting
and probably reflects the overuse of the newer expanded-spectrum cephalosporins by the medical community at large. Although this investigation did not address the issue of prevalence, there is not
doubt that the widespread dissemination of organisms producing ESBLs
and plasmid-mediated AmpC enzymes will severely limit the therapeutic
options of physicians facing these organisms, because the carbapenems
are the only
-lactam drugs uniformly active against organisms
producing these
-lactamases. Organisms producing these enzymes pose
a serious threat for the future treatment of infections at large, and
if these problems are to be minimized, it is important that these newer
antimicrobial agents be used sparingly and with discretion.
| |
ACKNOWLEDGMENTS |
|---|
DNA sequencing was supported in part by UNMC/Eppley Cancer Center grant P30CA36727.
We thank the following individuals for provision of some of the clinical isolates of K. pneumoniae: K. P. Klugman and L. Saunders, Chris Hani Baragwanath Hospital; A. Brink, Pretoria Academic Hospital; and Y. Coovadia, King Edward VIII Hospital.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, Creighton University School of Medicine, 2500 California Plaza, Omaha, NE 68178. Phone: (402) 280-1881. Fax: (402) 280-1225. E-mail: kstaac{at}creighton.edu.
Present address: Department of Medical Microbiology, University of
the Free State, Bloemfontein, South Africa 9300.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ambler, R. P.,
A. F. W. Coulson,
J. M. Frere,
J. M. Ghuysen,
B. Joris,
M. Forsmann,
R. C. Levesque,
G. Tiraby, and S. G. Waley.
1991.
A standard numbering scheme for the class A -lactamases.
Biochem. J.
276:269-270.
|
| 2. |
Barthélémy, M.,
J. Peduzzi, and R. Labia.
1988.
Complete amino acid sequence of p453-plasmid-mediated PIT-2 -lactamase (SHV-1).
Biochem. J.
251:73-79[Medline].
|
| 3. |
Bauernfeind, A.,
Y. Chong, and S. Schweighart.
1989.
Extended broad-spectrum -lactamase in Klebsiella pneumoniae including resistance to cephamycins.
Infection
17:316-321[Medline].
|
| 4. | Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298[Medline]. |
| 5. |
Bauernfeind, A.,
I. Stemplinger,
R. Jungwirth,
R. Wilhelm, and Y. Chang.
1996.
Comparative characterization of the cephamycinase blaCMY-1 gene and its relationship with other -lactamase genes.
Antimicrob. Agents Chemother.
40:1926-1930[Abstract].
|
| 6. | Ben Hassen, A., G. Fournier, A. Kechrid, C. Fendri, S. Ben Redjeb, and A. Philippon. 1990. Résistance enzymatique au céfotaxime chez cinquante-six souches de Klebsiella spp., Escherichia coli et Salmonella spp. dans un hopital tunisien (1984-1988). Pathol. Biol. 38:464-469[Medline]. |
| 7. |
Billot-Klein, D.,
L. Gutmann, and E. Collatz.
1990.
Nucleotide sequence of the SHV-5 -lactamase gene of Klebsiella pneumoniae plasmid.
Antimicrob. Agents Chemother.
34:2439-2441 |
| 8. |
Bush, K.,
G. A. Jacoby, and A. A. Medeiros.
1995.
A functional classification scheme for -lactamases and its correlation with molecular structure.
Antimicrob. Agents Chemother.
39:1211-1233[Medline].
|
| 9. | Coovadia, Y. M., A. P. Johnson, B. H. Bhana, C. R. Hutchinson, R. C. George, and I. E. Haferjee. 1992. Multiresistant Klebsiella pneumoniae in a neonatal nursery: the importance of maintenance of infection control policies and procedures in prevention of outbreaks. J. Hosp. Infect. 22:197-205[Medline]. |
| 10. | Derby, P., and J. Berens. 1997. Letter. South Afr. Med. J. 87:80[Medline]. |
| 11. |
DuBois, S. K.,
M. S. Marriott, and S. G. B. Amyes.
1995.
TEM- and SHV-derived extended-spectrum -lactamases: relationship between selection, structure and function.
J. Antimicrob. Chemother.
35:7-22 |
| 12. |
Hibbert-Rodgers, L. C.,
J. Heritage,
N. Todd, and P. M. Hawkey.
1994.
Convergent evolution of TEM-26, a -lactamase with extended-spectrum activity.
J. Antimicrob. Chemother.
33:707-720 |
| 13. |
Huletsky, A.,
F. Coutre, and R. C. Levesque.
1990.
Nucleotide sequence and phylogeny of SHV-2 -lactamase.
Antimicrob. Agents Chemother.
34:1725-1732 |
| 14. |
Jacoby, G. A., and A. A. Medeiros.
1991.
More extended-spectrum -lactamases.
Antimicrob. Agents Chemother.
35:1697-1704 |
| 15. |
Jarlier, V.,
M.-H. Nicolas,
G. Fournier, and A. Philippon.
1988.
Extended broad-spectrum -lactamases conferring transferable resistance to newer -lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns.
Rev. Infect. Dis.
10:867-878[Medline].
|
| 16. |
Karas, J. A.,
D. G. Pillay,
D. Muckart, and A. W. Sturm.
1996.
Letter.
J. Antimicrob. Chemother.
37:203-204 |
| 17. |
Mariotte, S.,
P. Nordmann, and M. H. Nicolas.
1994.
Extended-spectrum -lactamase in Proteus mirabilis.
J. Antimicrob. Chemother.
33:925-935 |
| 18. |
Matthew, M. A.,
A. M. Harris,
M. J. Marshall, and G. W. Ross.
1975.
The use of analytical isoelectric focusing for detection and identification of -lactamases.
J. Gen. Microbiol.
88:169-178[Medline].
|
| 19. |
Mercier, J., and R. C. Levesque.
1990.
Cloning of SHV-2, OHIO-1, and OXA-6 -lactamases and cloning and sequencing of SHV-1 -lactamase.
Antimicrob. Agents Chemother.
34:1577-1583 |
| 20. | National Committee for Clinical Laboratory Standards. 1994. Methods for dilution antimicrobial susceptibility for bacteria that grow aerobically, M7-T2, 4th ed. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 21. | National Committee for Clinical Laboratory Standards. 1994. Performance standards for antimicrobial disk susceptibility tests, M2-T4, 4th ed. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 22. |
Naumovski, L.,
J. P. Quinn,
D. Miyashiro,
M. Patel,
K. Bush,
S. B. Singer,
D. Graves,
T. Palzkill, and A. M. Arvin.
1992.
Outbreak of ceftazidime resistance due to extended-spectrum -lactamases in isolates from cancer patients.
Antimicrob. Agents Chemother.
36:1991-1996 |
| 23. |
O'Callaghan, C. H.,
P. W. Muggleton,
S. M. Kirby, and D. M. Ryan.
1967.
Inhibition of -lactamase decomposition of cephaloridine and cephalothin by other cephalosporins.
Antimicrob. Agents Chemother.
11:337-343.
|
| 24. |
Palzkill, T.,
K. S. Thomson,
C. C. Sanders,
E. S. Moland,
W. Huang, and T. W. Milligan.
1995.
New variant of TEM-10 -lactamase gene produced by a clinical isolate of Proteus mirabilis.
Antimicrob. Agents Chemother.
39:1199-1200[Abstract].
|
| 25. |
Papanicolaou, G. A.,
A. A. Medeiros, and G. A. Jacoby.
1990.
Novel plasmid-mediated -lactamase (MIR-1) conferring resistance to oxyimino- and -methoxy -lactams in clinical isolates of Klebsiella pneumoniae.
Antimicrob. Agents Chemother.
34:2200-2209 |
| 26. |
Payne, D. J.,
N. Woodford, and S. G. Amyes.
1992.
Characterization of the plasmid mediated beta-lactamase BIL-1.
J. Antimicrob. Chemother.
30:119-127 |
| 27. |
Philippon, A.,
R. Labia, and G. A. Jacoby.
1989.
Extended-spectrum -lactamases.
Antimicrob. Agents Chemother.
33:1131-1136 |
| 28. |
Pitout, J. D. D.,
E. S. Moland,
C. C. Sanders,
K. S. Thomson, and S. R. Fitzsimmons.
1997.
-Lactamases and detection of -lactam resistance in Enterobacter spp.
Antimicrob. Agents Chemother.
41:35-39[Abstract].
|
| 29. |
Richard, C.,
A. Philippon,
S. M'Boup, and J. F. Vieu.
1989.
Epidemiologie des infections pediatriques a Klebsiella dans deux hopitaux de Dakar. Production de -lactamases a spectre elargi (1987-1988).
Med. Mal. Infect.
19:753-759.
|
| 30. |
Sanders, C. C., and W. E. Sanders, Jr.
1992.
-Lactam resistance in gram-negative bacteria: global trends and clinical impact.
Clin. Infect. Dis.
15:824-839[Medline].
|
| 31. |
Sanders, C. C.,
W. E. Sanders, Jr., and E. S. Moland.
1986.
Characterization of -lactamases in situ on polyacrylamide gels.
Antimicrob. Agents Chemother.
30:951-952 |
| 32. | Sirot, D. 1995. Extended-spectrum plasmid-mediated
-lactamases. J. Antimicrob. Chemother. 36(Suppl.
A):19-34.
|
| 33. |
Soilleux, M. J.,
A. M. Morand,
G. J. Arlet,
M. R. Scavizzi, and R. Labia.
1996.
Survey of Klebsiella pneumoniae producing extended-spectrum -lactamases: prevalence of TEM-3 and first identification of TEM-26 in France.
Antimicrob. Agents Chemother.
40:1027-1029[Abstract].
|
| 34. |
Sutcliffe, J. G.
1978.
Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322.
Proc. Natl. Acad. Sci. USA
75:3737-3741 |
| 35. |
Thomson, K. S.,
A. M. Prevan, and C. C. Sanders.
1996.
Novel plasmid-mediated -lactamases in Enterobacteriaceae: emerging problems for new -lactam antibiotics.
Curr. Clin. Top. Infect. Dis.
16:151-163[Medline].
|
| 36. |
Watanabe, Y.,
T. Yokota,
Y. Higashi,
Y. Wakai, and Y. Mine.
1991.
In-vitro and in-vivo transferable -lactam resistance due to new plasmid-mediated oxyiminocephalosporinase from a clinical isolate of Proteus mirabilis.
Microbiol. Immunol.
35:87-97[Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»