Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, January 1999, p. 161-162, Vol. 43, No. 1
Departament de Microbiologia,
Received 26 February 1998/Returned for modification 1 July
1998/Accepted 5 October 1998
The increase in the level of quinolone resistance of
Haemophilus influenzae clinical isolates during ofloxacin
therapy of a patient with recurrent respiratory infections was
investigated. The first isolate (MIC of ciprofloxacin of 2 µg/ml) and
the second isolate (MIC of 32 µg/ml) belonged to the same clone, as
shown by pulsed-field gel electrophoresis, and the increase in the
resistance level was associated with a substitution in Ser-84 to Arg in
the ParC protein. These results emphasize the potential risk of
development of quinolone-resistant H. influenzae during
fluoroquinolone therapy in patients with recurrent respiratory infection.
Haemophilus influenzae is
a frequent cause of upper and lower respiratory tract infections
(9). The new fluoroquinolones have been widely used as
therapy for respiratory tract infections and have shown good activity
against H. influenzae (3). Resistance to
quinolones in H. influenzae is mainly due to chromosomal
mutations in the gyrA and parC genes, which
encode the A subunits of the DNA gyrase and topoisomerase IV,
respectively (2, 7), similar to those found in other
bacterial species (11, 12). Although ciprofloxacin-resistant
H. influenzae strains have been isolated (2, 4),
the development of quinolone resistance in H. influenzae from patients with chronic lung disease has been infrequently reported,
and the mechanism of quinolone resistance acquisition has not been
investigated (1).
We studied the increase in the level of quinolone resistance of an
H. influenzae clinical isolate during ofloxacin therapy in a
patient with recurrent respiratory infections. The patient was a
59-year-old female with severe bronchiectasis and recurrent respiratory
infections repeatedly submitted to multiple courses of antibiotics
(frequently including amoxicillin plus clavulanic acid or
ciprofloxacin). In May 1997, she was admitted to the hospital for an
episode of bronchial infection, respiratory failure, and severe
hypoxemia. She was on ventilatory support and intravenous therapy.
Sputum culture for noncapsulated H. influenzae (isolate 1)
with susceptibility to ciprofloxacin (MIC, 2 µg/ml), ofloxacin (MIC, 4 µg/ml), and nalidixic acid (MIC, MICs were determined by a commercial microdilution test (Emiza 2E;
Sensititre Ltd., Imberhorne, United Kingdom) and for nalidixic acid, by
the E-test method (AB Biodisk, Dalvagen, Sweden) performed according to
the manufacturers' instructions. In addition, for the strain with a
MIC of ciprofloxacin higher than 2 µg/ml, the MIC was determined by
the macrodilution broth method according to the National Committee for
Clinical Laboratory Standards recommendations (10).
PCR amplification was used to amplify the quinolone
resistance-determining region (QRDR) of the gyrA and
parC genes, and the nucleotide sequences of these
amplicons were determined. The oligonucleotide primers used to amplify
the QRDR of the gyrA gene from nucleotides 17 to 816 (800 bp) (from codon 6 to 272) were 5' AATCATCTATCACCCCTGTC 3' and 5' TTTTGCTTTATTTACTTGGT 3', whereas for the
amplification of the QRDR of the parC gene from
nucleotides 95 to 471 (377 bp) (from codon 32 to 157) the
oligonucleotide primers used were 5' ATCGTGCGTTGCCTTTTATC
3' and 5' TTCAGCCAAGGTTCCATCAA 3'. The PCR program and
the DNA sequencing methodology used were as described in reference
11.
Nucleotide sequencing of the 800- and 377-bp amplicons obtained from
the QRDR of the gyrA and parC genes,
respectively, revealed several mutations leading to the amino acid
substitutions shown in Table 1.
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Increase in Quinolone Resistance in a
Haemophilus influenzae Strain Isolated from a Patient with
Recurrent Respiratory Infections Treated with Ofloxacin
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
256 µg/ml) was positive. The patient was treated with ofloxacin (200 mg/12 h orally) for 4 days
and subsequently with amoxicillin plus clavulanic acid and was
discharged after compensation. Four months later, she attended the
outpatient clinic and a control sputum culture was positive, with two
colonial morphotypes of H. influenzae being detected. One
(isolate 2) had the same resistance pattern as the one isolated in May
(isolate 1), while the only difference with the other (isolate 3) was
that the MIC of ciprofloxacin was 32 µg/ml (isolate 3). Finally,
three months later, the patient was again admitted for respiratory
deterioration, and two H. influenzae isolates with
resistance patterns identical to those previously recovered were found
in sputum. The epidemiological relationship of these isolates was
investigated by pulsed-field gel electrophoresis (PFGE), showing that
the three isolates belonged to the same clone (Fig.
1).
View larger version (99K):
[in a new window]
FIG. 1.
Molecular typing of H. influenzae strains by
PFGE. Lanes 1, 2, and 10 are molecular weight markers. Lanes 3, 4, and
5 are isolates 1, 2, and 3 of this study, respectively. Lanes 6, 7, 8, and 9 are different strains of H. influenzae chosen
randomly.
TABLE 1.
Mutations in the gyrA and parC
genes of different isolates of H. influenzae
The substitution at amino acid 84 (Ser-Leu) of the GyrA protein or its equivalent in other microorganisms is the most prevalent and has been found in H. influenzae (2, 7) and in other bacteria (11, 12). Georgiou et al. (7) found that strains with MICs of 2 µg/ml showed double mutations, one in the amino acid codon Asp-88 of the gyrA gene and another in the amino acid codon Ser-84 of the parC gene. Similarly, isolates 1 and 2 (MICs of ciprofloxacin of 2 µg/ml) of our study also present a double mutation, whereas the strain for which the MIC of ciprofloxacin was 32 µg/ml showed three main substitutions, two in the GyrA protein (Ser-84 to Leu and Asp-88 to Ala) and one in the ParC protein (Ser-84 to Arg). These results are also in agreement with those found by Georgiou et al. (7). The mutation in the amino acid codon Asp-83, which generated a substitution to Asn, is apparently neutral despite the change in the charge.
Studying H. influenzae in sputum samples, Groeneveld et al. (8) found patients persistently infected with the same H. influenzae strain for up to 23 months. Similarly, the strain described herein persisted for at least 7 months despite the treatment with amoxicillin plus clavulanic acid.
These results emphasize the potential risk of development of quinolone-resistant H. influenzae during fluoroquinolone therapy in patients with recurrent respiratory infections and confirm the role of substitutions in positions Ser-84 and Asp-88 of the GyrA protein and Ser-84 of the ParC protein in the acquisition of quinolone resistance in this microorganism.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by grants SAF97/0091 and FIS 97/0623 from Spain.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratori de Microbiologia, Hospital Clinic, Villarroel, 170, 08036 Barcelona, Spain. Phone: 34.3.2275522. Fax: 34.3.2275454. E-mail: vila{at}medicina.ub.es.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Barriere, S. L., and J. A. Hindler. 1993. Ciprofloxacin-resistant Haemophilus influenzae infection in a patient with chronic lung disease. Ann. Pharmacother. 27:309-310[Abstract]. |
| 2. |
Bootsma, H. J.,
A. Troeltra,
A. van Veen-Rutgers,
F. R. Mooi,
A. J. de Neeling, and B. P. Overbeek.
1997.
Isolation and characterization of a ciprofloxacin-resistant isolate of Haemophilus influenzae from The Netherlands.
J. Antimicrob. Chemother.
39:292-293 |
| 3. | Brueggeman, A. B., K. C. Kugler, and G. V. Doern. 1997. In vitro activity of BAY 12-8039, a novel 8-methoxyquinolone, compared to activities of six fluoroquinolones against Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis. Antimicrob. Agents Chemother. 41:1594-1597[Abstract]. |
| 4. | Campos, J., F. Román, M. Georgiou, C. Garcia, R. Gomez-Lus, R. Cantón, V. Escobar, and F. Baquero. 1996. Long-term persistence of ciprofloxacin-resistant Haemophilus influenzae in patients with cystic fibrosis. J. Infect. Dis. 174:1345-1347[Medline]. |
| 5. |
Chamberland, S.,
F. Malouin,
T. Schollaardt,
T. R. Parr, Jr., and L. E. Bryan.
1990.
Persistence of Pseudomonas aeruginosa during ciprofloxacin therapy of a cystic fibrosis patient: transient resistance to quinolones and protein F-deficiency.
J. Antimicrob. Chemother.
25:995-1010 |
| 6. |
Corkill, J. E.,
A. Percival,
P. McDonald, and A. I. Bamber.
1994.
Detection of quinolone resistance in Haemophilus spp.
J. Antimicrob. Chemother.
34:841-844 |
| 7. | Georgiou, M., R. Muñoz, F. Román, R. Cantón, R. Gómez-Lus, J. Campos, and A. G. de la Campa. 1996. Ciprofloxacin-resistant Haemophilus influenzae strains possess mutations in analogous positions of GyrA and ParC. Antimicrob. Agents Chemother. 40:1741-1744[Abstract]. |
| 8. | Groeneveld, K., L. van Alphen, P. P. Eijk, G. Visschers, H. M. Jansen, and H. C. Zanen. 1990. Endogenous and exogenous reinfections by Haemophilus influenzae in patients with chronic obstructive pulmonary disease: the effect of antibiotic treatment of persistence. J. Infect. Dis. 161:512-517[Medline]. |
| 9. | Moxon, E. R. 1995. Haemophilus influenzae, p. 2039-2045. In G. L. Mandell, J. E. Douglas, and R. Dolin (ed.), Principles and practice of infectious diseases. Churchill Livingstone, New York, N.Y. |
| 10. | National Committee for Clinical Laboratory Standards. 1997. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 4th ed. Approved standard M7-A4. National Committee for Clinical Laboratory Standards, Wayne, Pa. |
| 11. |
Vila, J.,
J. Ruiz,
F. Marco,
A. Barcelo,
P. Goñi,
E. Giralt, and T. Jimenez de Anta.
1994.
Association between double mutation in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs.
Antimicrob. Agents Chemother.
38:2477-2479 |
| 12. | Vila, J., J. Ruiz, P. Goñi, and M. T. Jimenez de Anta. 1996. Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli. Antimicrob. Agents Chemother. 40:491-493[Abstract]. |
Antimicrobial Agents and Chemotherapy, January 1999, p. 161-162, Vol. 43, No. 1
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nakamura, S., Yanagihara, K., Morinaga, Y., Izumikawa, K., Seki, M., Kakeya, H., Yamamoto, Y., Kamihira, S., Kohno, S.
(2009). Melting Curve Analysis for Rapid Detection of Topoisomerase Gene Mutations in Haemophilus influenzae. J. Clin. Microbiol.
47: 781-784
[Abstract] [Full Text] -
Ho, P. L., Mak, G. C., Tse, C. W. S., Chow, K. H., Cheung, C. H. Y.
(2006). Invasive Haemophilus influenzae isolates with decreased levofloxacin susceptibility in Hong Kong. J Antimicrob Chemother
57: 366-366
[Full Text] -
Li, X., Mariano, N., Rahal, J. J., Urban, C. M., Drlica, K.
(2004). Quinolone-Resistant Haemophilus influenzae: Determination of Mutant Selection Window for Ciprofloxacin, Garenoxacin, Levofloxacin, and Moxifloxacin. Antimicrob. Agents Chemother.
48: 4460-4462
[Abstract] [Full Text] -
Li, X., Mariano, N., Rahal, J. J., Urban, C. M., Drlica, K.
(2004). Quinolone-Resistant Haemophilus influenzae in a Long-Term-Care Facility: Nucleotide Sequence Characterization of Alterations in the Genes Encoding DNA Gyrase and DNA Topoisomerase IV. Antimicrob. Agents Chemother.
48: 3570-3572
[Abstract] [Full Text] -
Perez-Vazquez, M., Roman, F., Aracil, B., Canton, R., Campos, J.
(2004). Laboratory Detection of Haemophilus influenzae with Decreased Susceptibility to Nalidixic Acid, Ciprofloxacin, Levofloxacin, and Moxifloxacin Due to gyrA and parC Mutations. J. Clin. Microbiol.
42: 1185-1191
[Abstract] [Full Text] -
Morrissey, I., Tillotson, G.
(2004). Activity of gemifloxacin against Streptococcus pneumoniae and Haemophilus influenzae. J Antimicrob Chemother
53: 144-148
[Abstract] [Full Text] -
Elliott, E., Oosthuizen, D., Johnson, M. M, Piddock, L. J. V.
(2003). Fluoroquinolone resistance in Haemophilus influenzae. J Antimicrob Chemother
52: 734-735
[Full Text] -
Brenwald, N. P., Andrews, J. M., Jevons, G., Wise, R.
(2003). Detection of ciprofloxacin resistance in Haemophilus influenzae using nalidixic acid and BSAC methodology. J Antimicrob Chemother
51: 1311-1312
[Full Text] -
Ruiz, J.
(2003). Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother
51: 1109-1117
[Abstract] [Full Text] -
Williams, J. H. Jr
(2001). Fluoroquinolones for Respiratory Infections : Too Valuable To Overuse. Chest
120: 1771-1775
[Full Text] -
Cardenas, M., Barbe, J., Llagostera, M., Miro, E., Navarro, F., Mirelis, B., Prats, G., Badiola, I.
(2001). Quinolone Resistance-Determining Regions of gyrA and parC in Pasteurella multocida Strains with Different Levels of Nalidixic Acid Resistance. Antimicrob. Agents Chemother.
45: 990-991
[Full Text] -
Davies, T. A., Kelly, L. M., Hoellman, D. B., Ednie, L. M., Clark, C. L., Bajaksouzian, S., Jacobs, M. R., Appelbaum, P. C.
(2000). Activities and Postantibiotic Effects of Gemifloxacin Compared to Those of 11 Other Agents against Haemophilus influenzae and Moraxella catarrhalis. Antimicrob. Agents Chemother.
44: 633-639
[Abstract] [Full Text] -
Moss, P. J, Finch, R. G
(2000). The next generation: fluoroquinolones in the management of acute lower respiratory infection in adults. Thorax
55: 83-85
[Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»