Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, November 1999, p. 2648-2656, Vol. 43, No. 11
Department of Microbiology and Infectious
Diseases, University of Calgary Health Sciences Center, Calgary,
Alberta, Canada T2N 4N1
Received 24 April 1999/Returned for modification 2 June
1999/Accepted 26 August 1999
Burkholderia pseudomallei is a gram-negative bacterium
that causes the disease known as melioidosis. This pathogen is endemic to Southeast Asia and northern Australia and is particularly
problematic in northeastern Thailand. It has been previously reported
that B. pseudomallei is resistant to the killing action of
cationic antimicrobial peptides, including human neutrophil peptide,
protamine sulfate, poly-L-lysine, magainins, and
polymyxins. Recently, we have also found that the virulent clinical
isolate B. pseudomallei 1026b is capable of replicating in
media containing polymyxin B at concentrations of >100 mg/ml. In order
to identify genetic loci that are associated with this particular
resistance phenotype, we employed a Tn5-OT182 mutagenesis
system in coordination with a replica plating screen to isolate
polymyxin B-susceptible mutants. Of the 17,000 Tn5-OT182
mutants screened via this approach, five polymyxin B-susceptible
mutants were obtained. Three of these mutants harbored
Tn5-OT182 insertions within a genetic locus demonstrating strong homology to the lytB gene present in other
gram-negative bacteria. Of the remaining two mutants, one contained a
transposon insertion in a locus involved in lipopolysaccharide core
biosynthesis (waaF), while the other contained an insertion
in an open reading frame homologous to UDP-glucose dehydrogenase genes.
Isogenic mutants were also constructed via allelic exchange and used in complementation analysis studies to further characterize the relative importance of each of the various genetic loci with respect to the
polymyxin B resistance phenotype exhibited by B. pseudomallei 1026b.
Burkholderia pseudomallei
is the causative agent of melioidosis. This bacterial pathogen is
endemic to Southeast Asia, northern Australia, and temperate areas that
border the equator (23). B. pseudomallei is found
as a natural inhabitant of moist soils, stagnant waters, and rice
paddies that predominate in regions of endemicity such as northeastern
Thailand (8, 35).
The clinical manifestations of melioidosis may be observed as
inapparent infection, asymptomatic pulmonary infiltration, acute localized supprative infection, acute pulmonary infection, acute septicemic infection, or chronic supprative infection (9,
39). B. pseudomallei is a common cause of
opportunistic infections in areas of endemicity, and individuals
particularly susceptible include diabetics and those with renal disease
(8). In addition, it has been shown that in some areas this
pathogen is a major cause of community-acquired sepsis, resulting in up
to 70% mortality even with treatment (8).
B. pseudomallei strains are intrinsically resistant to a
broad spectrum of antibiotics, a feature that can often complicate the
treatment of melioidosis (14). This organism is resistant to
a variety of antibiotics, including penicillin, ampicillin (AMP),
narrow-spectrum cephalosporins, streptomycin (STR), tobramycin, and
gentamicin (GEN) (14, 20, 23). Recently, Moore et al. (28) have demonstrated the presence of an efflux pump
involved in aminoglycoside resistance. In addition, B. pseudomallei demonstrates high levels of resistance to the
action of cationic antimicrobial peptides such as polylysine, protamine
sulfate, human neutrophil peptides (HNP-1), and polymyxins (14,
21).
In the present studies we have chosen polymyxin B (PMB) as a model in
an attempt to elucidate the mechanisms by which B. pseudomallei resists the killing action imparted by cationic
antimicrobial peptides.
Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this study are shown in Table
1. Cultures were grown at 37°C on
Luria-Bertani (LB) base agar plates or in LB broth. For
Escherichia coli, antibiotics were used, when appropriate,
at the following concentrations: AMP, 100 µg/ml; kanamycin (KAN), 25 µg/ml; chloramphenicol (CHL), 25 µg/ml; STR, 100 µg/ml;
tetracycline (TET), 15 µg/ml; trimethoprim (TMP), 1.5 mg/ml; and
Zeocin (ZEO), 25 µg/ml. For B. pseudomallei, antibiotic
concentrations were as follows: KAN, 50 µg/ml; TET, 50 µg/ml; TMP,
100 µg/ml; and ZEO, 100 µg/ml. Antibiotics were purchased from
Sigma Chemical Co. and Invitrogen.
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Isolation of Polymyxin B-Susceptible Mutants of
Burkholderia pseudomallei and Molecular Characterization of
Genetic Loci Involved in Polymyxin B Resistance
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids
Mutagenesis and screening. B. pseudomallei 1026b was mutagenized with Tn5-OT182 as previously described (12). PMB-susceptible mutants were isolated by using a replica plating method in which Tn5-OT182 mutants were screened on LB agar plates with or without 200 µg of PMB per ml. Those mutants that failed to grow on the medium containing PMB were retested and retained for further analyses.
MIC determination. MICs were determined by using Mueller-Hinton (MH) agar-based plates or MH broth (Becton Dickinson Microbiology Systems). Standard MIC tests were used for a variety of antimicrobials and included both agar and broth dilution assays (29). For MIC testing in excess of 10,000 µg/ml, PMB sulfate was solubilized directly in MH broth, filter sterilized, and then inoculated with mid-log-phase cultures of the B. pseudomallei strain. In addition, when appropriate, E-tests (AB Biodisk, Solna, Sweden) were used as per the manufacturer's instructions.
DPX binding assay.
The interaction of dansyl polymyxin (DPX)
with B. pseudomallei was examined under standard assay
conditions as previously described (26, 27). The DPX used in
this study was generously provided by R. E. W. Hancock,
University of British Columbia, Vancouver, Canada. A 1.5 mM stock
solution of DPX was stored at
20°C and diluted appropriately for
assays. Fluorescence was measured with an F-2000 fluorescence
spectrophotometer (Hitachi).
DNA manipulation and electroporation. Restriction endonucleases and T4 DNA ligase were purchased from Gibco BRL, Boehringer Mannheim, and New England BioLabs and were used according to the manufacturer's instructions. A Gene Clean II kit (Bio 101) was used for purification of DNA fragments that were excised from agarose gels and used in cloning procedures. Isolation of chromosomal DNA and cloning of DNA immediately flanking Tn5-OT182 insertions were performed as previously described (12, 43).
ELISA. B. pseudomallei strains were assayed for the presence of type II O-polysaccharide (O-PS) moieties via enzyme-linked immunosorbent assay (ELISA) (13) with a type II O-PS-specific monoclonal antibody (MAb) (19).
LPS purification and immunoblot analysis. Lipopolysaccharide (LPS) was purified as previously described (4). Immunoblot analyses were performed with the type II O-PS-specific MAb (7, 19). In addition, polyclonal rabbit sera recognizing type I and II O-PSs as well as flagellin proteins were used for immunoblot analysis as previously described (4).
LPS silver stain analysis. LPS from whole cells of B. pseudomallei was silver stained by using a previously described method and analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (18, 42).
Outer membrane protein isolation and analysis. Outer membrane proteins were prepared as previously described (15). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis analysis (40) with a 5% stacking gel and a 12% separating gel. Protein was visualized with Coomassie blue staining.
Construction of allelic exchange knockouts.
Allelic exchange
was performed in this study as previously described for B. pseudomallei (13), with the rpsL-based
vector pKAS46 (38). B. pseudomallei DD503 was
used for gene replacement experiments (13, 28). A typical
allelic exchange procedure consisted of first transforming SM10
pir
with a pKAS46 derivative harboring an insertionally inactivated allele.
Each gene was disrupted with an antibiotic cassette next to an origin
of replication (6). This was followed by conjugation of this
SM10
pir strain to DD503 as previously described (13).
Transconjugates were selected for on LB plates containing PMB (50 µg/ml) and ZEO (100 µg/ml) or TMP (100 µg/ml). The
Pmbr and Zeor or Tmpr
transconjugates were then plated on STR (100 µg/ml) and either ZEO
(100 µg/ml) or TMP (100 µg/ml) to select for loss of the vector. These mutants were then tested on plates containing KAN (50 µg/ml) to
confirm loss of the vector; this was indicated by absence of growth.
Mutations were confirmed by either Southern blot analysis or
self-cloning and sequencing of the DNA flanking the oriZeo or oriTp cassette.
PCR amplification and cloning of PCR products. The waaF, udg, and lytB genes were amplified from B. pseudomallei 1026b chromosomal DNA by PCR. The oligodeoxyribonucleotide primers used to amplify the waaF gene were rfaF-5' (5'GGGGTACCGAGCGTCGCGTTTATTACG3') and rfaF-3' (5'CGGGATCCTGAATCGGGTGCGGGTGCGC3'). The waaF gene was PCR amplified in a 100-µl reaction mixture containing 500 ng of genomic DNA, 1× PCR buffer (Gibco BRL), a 200 µM concentration of each deoxynucleoside triphosphate, a 0.5 µM concentration of each primer, 1.5 mM MgCl2 (Gibco BRL), and 5 U of Taq DNA polymerase (Gibco BRL) per µl. This mixture was placed in a GeneAmp PCR system 9600 (Perkin-Elmer Cetus) thermal cycler and subjected to a 5-min denaturation step at 97°C followed by 30 cycles at 97°C for 45 s, 53°C for 30 s, and 72°C for 90 s. The reaction mixture was then held at 72°C for 10 min. The oligodeoxyribonucleotide primers used to amplify the lytB gene were lytB-5' (5'GGGGTACCATCCAAGTTGGGGCGATCGG3') and lytB-3' (5'GCTCTAGAGCGGATAGCGTTTTGTTGCC3'). The PCR conditions were the same as those described above except that the annealing step was performed at 55°C rather than 53°C. The primer sequences used for the amplification of the udg gene were udg2-5' (5'GGGTACCAGCCGGGCGGACGCCGTTCG3') and udg2-3' (5'GCTCTAGAGACTTCGCGATCTGCTCGCG3'). The PCR conditions were the same as those used for amplification of the waaF gene. The PCR products were cloned into pCR2.1-TOPO (Invitrogen) by using the TOPO TA Cloning Kit (Invitrogen). The cloned PCR products were sequenced to confirm that the desired gene was obtained. Each gene was then cloned into a broad-host-range vector, either pUCP28T (waaF) or pRK415 (lytB and udg).
Complementation of allelic exchange mutants.
Broad-host-range vectors (either pUCP28T or pRK415) containing
wild-type copies of the waaF, lytB, and
udg genes were used for complementation analyses. E. coli SM10
pir strains containing the appropriate vectors were
conjugated to B. pseudomallei MB100, MB203, or MB300,
followed by selection on appropriate antibiotics. MICs and LPS profiles
were then determined for the complemented strains.
DNA sequencing and sequence analysis. DNA sequencing of both strands was performed by University Core DNA Services (University of Calgary). Fragments that were sequenced were further analyzed by performing database searches to establish homology to known gene sequences with the gapped BLASTX and BLASTP programs (2). DNA and protein sequences were analyzed by using DNASIS version 2.5 (Hitachi).
Nucleotide sequence accession numbers. The waaF gene sequence was submitted to GenBank under accession no. AF097748. The lytB gene sequence was submitted under accession no. AF098521. The udg, waaE, and gmhD gene sequences were submitted to GenBank under accession no. AF159428.
| |
RESULTS |
|---|
|
|
|---|
Isolation of PMB-susceptible mutants.
In order to identify
specific genes necessary for resistance of B. pseudomallei
to PMB, the virulent clinical isolate 1026b was mutagenized with the
transposon Tn5-OT182. Transposon mutants were replica plated
onto LB agar with TET (50 µg/ml) and onto LB agar with 200 µg of
PMB per ml. A total of 17,000 colonies from five separate mutagenesis
experiments were screened, and five PMB-susceptible mutants were
obtained. These mutants were designated PMB-4, -7, -14, -17, and -20. The MICs for the PMB-susceptible mutants were determined and proved to
be 500- to 4,000-fold lower than those for the parent strain 1026b
(Table 2). Additionally, for all of the
PMB-susceptible mutants, the colistin (polymyxin E) and PMB MICs were
similar (Table 2). The MIC for B. pseudomallei SRM 117, carrying a Tn5-OT182 mutation in the wbiI gene
and lacking the O-antigen moiety of the type II LPS, was determined to
be similar to that for 1026b in the agar plate dilution assay. The MIC
for B. thailandensis E264, an organism that possesses only type II LPS, was the same as that for B. pseudomallei 1026b.
|
DPX interacts with lipid A of PMB-susceptible mutants. In order to explore the interaction of polymyxin with lipid A moieties, DPX binding assays were conducted with B. pseudomallei 1026b, PMB-7, PMB-20, and PMB-4 (a representative LytB mutant). The PMB-susceptible mutants bound significantly more DPX, as indicated by an increase in fluorescence compared to that for the wild type (Fig. 1a). Allelic exchange mutants MB100, MB203, and MB300 also showed increased binding of DPX (Fig. 1b). These results indicate that the DPX is able to permeabilize the outer membrane and interact with the lipid A moieties and phospholipids of the Tn5-OT182 and allelic exchange mutants.
|
Analysis of DNA flanking Tn5-OT182 integrations in
PMB-susceptible mutants.
The DNA sequences immediately flanking
Tn5-OT182 integrations in all five mutants were obtained by
self-cloning (12, 24). The resultant plasmids were
sequenced, and database searches for homology to known gene sequences
were performed. The Tn5-OT182 integrations in PMB-7, PMB-20,
and PMB-4, -14, and -17 map to three physically distinct loci (Table
3; Fig. 2).
Each gene was fully sequenced through primer walking or subcloning,
allowing for the identification of putative start codons and ribosome
binding sites for each open reading frame.
|
|
Genetic loci required for a PMB-resistant phenotype. In order to confirm the role of each genetic locus identified in the PMB-susceptible mutants, isogenic mutants were constructed by allelic exchange. We found that insertional inactivation of the waaF, lytB, udg, and waaE genes leads to a PMB-susceptible phenotype. MICs for each of the mutants were similar to those for the corresponding Tn5-OT182 mutants (Table 2).
In strain MB100, the waaF gene was insertionally inactivated by using an oriZeo cassette. This gene encodes a protein similar to a heptosyl transferase involved in LPS inner core biosynthesis (11, 37), resulting in a strain with an altered LPS profile. The PMB MIC is the same as that for PMB-7. In MB203, the lytB gene was inactivated through the insertion of an oriTp cassette. This resulted in a PMB MIC that is significantly reduced compared to that for the parent strain and was determined to be similar to that for the Tn5-OT182 mutants. This confirmed that disruption of the lytB gene was responsible for the observed phenotype. Inactivation of the udg locus resulted in strain MB300. The MIC for this strain was also decreased compared to that for the wild type. Insertional inactivation of the waaE locus resulted in strain MB301. Studies confirmed an MIC similar to that for MB300, suggesting that these genes may be coordinately regulated and expressed. Additional sequence analysis in this region of the B. pseudomallei genome along with specific inactivation of each gene identified is necessary to determine if, in fact, core oligosaccharide genes form an operon. In any case, it is clear that genes affecting LPS core biosynthesis in this organism are involved in maintenance of a PMB-resistant phenotype.Complementation. Complementation analyses further support the fact that the waaF, lytB, and udg genes play a critical role in maintenance of a PMB-resistant phenotype. Complementation in trans with wild-type copies of the waaF gene, the lytB gene, or the udg gene partially restored the phenotypes of the allelic exchange mutants MB100, MB203, and MB300, respectively, to various degrees; the complemented mutants were designated MB100C, MB203C, and MB300C (Table 2).
Mutations in the waaF, udg, and waaE genes result in alterations of LPS moieties. Silver stain analysis of PMB-7 and MB100 revealed alteration of the LPS type II moiety, specifically, truncation of the core oligosaccharide-lipid A region (Fig. 3). ELISAs and Western blot analyses of both purified LPS and whole cells of PMB-7 demonstrated a loss of LPS type II O-PS (Fig. 4 and 5). Figure 4 shows the lack of LPS type II O antigen in PMB-7 as indicated by decreased optical density. In addition, 13C nuclear magnetic resonance analysis demonstrated that PMB-7 had only LPS type I O antigen (data not shown). These results indicate that a disruption in the waaF gene leads to production of an incomplete LPS type II molecule.
|
|
|
PMB-susceptible mutants have altered outer membrane protein profiles. All of the PMB-susceptible mutants isolated showed alterations in their outer membrane protein profile compared to wild-type B. pseudomallei 1026b (Fig. 6). PMB-4, -14, and -17 are all missing a protein band with a molecular mass of 110 kDa. PMB-7 clearly lacks a well-conserved band at approximately 15 kDa, and PMB-20 is missing a number of bands throughout its outer membrane protein profile. These changes potentially affect the permeability of the bacterial cell by compromising its effectiveness as a barrier. The outer membranes of the allelic exchange mutants were not analyzed.
|
| |
DISCUSSION |
|---|
|
|
|---|
B. pseudomallei is intrinsically resistant to a variety
of antibiotics, including most
-lactams, aminoglycosides, and
polymyxins (20). Despite aggressive therapy with
antimicrobials effective against this pathogen, the mortality rate due
to acute septicemic B. pseudomallei infection remains
unacceptably high (10). The ability of B. pseudomallei to survive intracellularly and to resist the killing
action of many antibiotics, including cationic antimicrobial peptides,
is clearly important in the pathogenesis of this infection. In this
study, we have isolated PMB-susceptible mutants of B. pseudomallei and identified genetic loci involved in the
resistance phenotype of wild-type B. pseudomallei.
We have found that B. pseudomallei 1026b survived and multiplied at all achievable concentrations of PMB. The data shown here indicate that PMB is unable to permeabilize the outer membrane of wild-type B. pseudomallei 1026b. The mutants obtained in this study possess alterations such that PMB had an increased ability to permeabilize their outer membranes, as shown by the DPX binding assay results. In addition, for these mutants the MICs of a number of other antimicrobial compounds were decreased, suggesting increased permeability of the bacterial outer membranes.
In these studies two distinct groups of mutants were identified: (i) those with disruptions in genes predicted to be involved in LPS core oligosaccharide biosynthesis, resulting in incomplete LPS molecules, and (ii) those with disruptions in the lytB gene. Both groups of mutants exhibited differences in their outer membrane protein profiles compared to wild-type B. pseudomallei, suggesting that the integrity of this permeability barrier may be compromised. In addition, it is well established that bacterial LPS is a permeability barrier that confers resistance to a variety of antimicrobial agents (30). Alteration of this barrier often leads to increased sensitivity to hydrophobic and cationic compounds (30).
The data collected in the present study indicates that it is the architecture of the B. pseudomallei cell which prevents PMB molecules from interacting with target groups on LPS molecules and phospholipids. It seems that the O-antigen and outer core components of B. pseudomallei LPS act as a protective barrier in order to prevent PMB molecules from interacting with potential binding sites found in the inner core and lipid A regions of the moiety. This is clearly seen in mutants of B. pseudomallei that possess incomplete LPS molecules, specifically those with disruptions in genes involved in LPS core biosynthesis. Thus, in order to achieve a PMB-susceptible phenotype in this organism, LPS alterations must be such that both outer core and O-antigen moieties of LPS type II are absent.
It appears that there may be another mechanism of PMB resistance that is LPS independent. This is seen in the mutants that contain mutations in their lytB genes. These mutants seem to possess a wild-type LPS profile, as no obvious changes were identified, yet the PMB MICs are significantly reduced. This may be explained in part by the fact that the lytB gene product affects phospholipid and peptidoglycan biosynthesis (32, 33), leading to changes in membrane permeability. Possible factors affecting membrane integrity include changes in phospholipid arrangement and stability as well as the destabilization of cross bridges between neighboring LPS molecules. In any case, there are complex changes that occur due to disruption of the lytB gene, leading to PMB susceptibility. These changes are not yet fully understood and are being further investigated.
Following screening for PMB-susceptible mutants of B. pseudomallei, we have confirmed that LPS core biosynthesis genes are implicated in cationic peptide resistance, and this is consistent with the findings of a number of previous studies (1, 3, 41). Further investigation is required in order to determine the exact lengths of the truncated LPS molecules, the presence or absence of potential PMB binding sites, and the charges on the LPS molecules. With this information it can be assessed whether PMB and possibly other antibiotics can efficiently attack the membrane of B. pseudomallei cells. In addition, we have identified a possible LPS-independent mechanism of PMB resistance, but the exact nature of this susceptibility requires further attention.
Topics for future studies include investigation of the arrangement of the LPS core oligosaccharide biosynthesis genes and their functions. Also, the role of the lytB gene in B. pseudomallei pathogenesis has yet to be determined. In addition, the mechanism(s) responsible for the resistance to other cationic peptides, such as protamine sulfate, poly-L-lysine, and HNP-1, in B. pseudomallei is currently being studied. It is hoped that these studies will lead to the elucidation of a novel mechanism(s) of cationic peptide resistance that will lead to the identification of new targets of therapy against this organism.
| |
ACKNOWLEDGMENTS |
|---|
This work was funded by the Canadian Bacterial Diseases Network Centers for Excellence Program. M.N.B. is the recipient of an Alberta Heritage Foundation for Medical Research Studentship Award.
We are grateful to Malcolm B. Perry for 13C nuclear magnetic resonance results.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, 3330 Hospital Dr. N.W., Calgary, Alberta, Canada T2N 4N1. Phone: (403) 220-2564. Fax: (403) 283-5241. E-mail: woods{at}ucalgary.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Allen, C. A.,
L. G. Adams, and T. A. Ficht.
1998.
Transposon-derived Brucella abortus rough mutants are attenuated and exhibit reduced intracellular survival.
Infect. Immun.
66:1008-1016 |
| 2. |
Altshul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 3. |
Banemann, A.,
H. Deppeisch, and R. Gross.
1998.
The lipopolysaccharide of Bordetella brochiseptica acts as protective shield against antimicrobial peptides.
Infect. Immun.
66:5607-5612 |
| 4. | Brett, P. J., and D. E. Woods. 1996. Structural and immunological characterization of Burkholderia pseudomallei O-polysaccharide-flagellin protein conjugates. Infect. Immun. 64:2824-2828[Abstract]. |
| 5. |
Brett, P. J.,
D. DeShazer, and D. E. Woods.
1998.
Burkholderia thailandensis sp. nov., description of a Burkholderia pseudomallei-like species.
Int. J. Syst. Bacteriol.
48:317-320 |
| 6. | Brett, P. J., D. DeShazer, and D. E. Woods. Self-cloning cassette vectors. Unpublished. |
| 7. | Bryan, L. E., S. Wong, D. E. Woods, D. A. B. Dance, and W. Chaowagul. 1994. Passive protection of diabetic rats with antisera specific for the polysaccharide portion of the lipopolysaccharide from Pseudomonas pseudomallei. Can. J. Infect. Dis. 5:170-178. |
| 8. | Chaowagul, W., N. J. White, D. A. B. Dance, Y. Wattanagoon, P. Naigowit, T. M. E. Davis, S. Looareesuwan, and N. Pitawatchara. 1989. Melioidosis: a major cause of community acquired septicemia in northeastern Thailand. J. Infect. Dis. 159:890-899[Medline]. |
| 9. |
Dance, D. A. B.
1991.
Melioidosis: tip of the iceberg?
Clin. Microbiol. Rev.
4:52-60 |
| 10. | Dance, D. A. B. 1996. Melioidosis, p. 925-930. In G. C. Cook (ed.), Manson's tropical diseases, 20th ed. W. B. Saunders Co. Ltd., London, England |
| 11. |
De Kievet, T. R., and J. S. Lam.
1997.
Isolation and characterization of two genes, waaC (rfaC) and waaF (rfaF), involved in Pseudomonas aeruginosa serotype O5 inner-core biosynthesis.
J. Bacteriol.
179:3451-3457 |
| 12. |
DeShazer, D.,
P. J. Brett,
R. Carlyon, and D. E. Woods.
1997.
Mutagenesis of Burkholderia pseudomallei with Tn5-OT182: isolation of motility mutants and molecular characterization of the flagellin structural gene.
J. Bacteriol.
179:2116-2125 |
| 13. | DeShazer, D., P. J. Brett, and D. E. Woods. 1998. The type II O-antigenic polysaccharide moiety of Burkholderia pseudomallei lipopolysaccharide is required for serum resistance and virulence. Mol. Microbiol. 30:1081-1100[Medline]. |
| 14. | Eickhoff, T. C., J. V. Bennett, P. S. Hayes, and J. Feeley. 1970. Pseudomonas pseudomallei: susceptibility to chemotherapeutic agents. J. Infect. Dis. 121:95-102[Medline]. |
| 15. |
Gotoh, N.,
N. J. White,
W. Choawagul, and D. E. Woods.
1994.
Isolation and characterization of the outer-membrane proteins of Burkholderia (Pseudomonas) pseudomallei.
Microbiology
140:797-805 |
| 16. | Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin B resistance. Mol. Microbiol. 27:1171-1182[Medline]. |
| 17. |
Gustafson, C. E.,
S. Kaul, and E. E. Ishiguro.
1993.
Identification of the Escherichia coli lytB gene, which is involved in penicillin tolerance and control of the stringent response.
J. Bacteriol.
175:1203-1205 |
| 18. |
Hitchcock, P. J., and T. M. Brown.
1983.
Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels.
J. Bacteriol.
154:269-277 |
| 19. | Ho, M., T. Schollaardt, M. D. Smith, M. B. Perry, P. J. Brett, W. Chaowagul, and L. E. Bryan. 1997. Specificity and functional activity of anti-Burkholderia pseudomallei polysaccharide antibodies. Infect. Immun. 65:3648-3653[Abstract]. |
| 20. | Howe, C., A. Sampath, and M. Spotnitz. 1971. The pseudomallei group: a review. J. Infect. Dis. 124:598-606[Medline]. |
| 21. | Jones, A. L., T. J. Beveridge, and D. E. Woods. 1996. Intracellular survival of Burkholderia pseudomallei. Infect. Immun. 64:782-790[Abstract]. |
| 22. | Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191-197[Medline]. |
| 23. | Leelarasamee, A., and S. Bovornkitti. 1989. Melioidosis: review and update. Rev. Infect. Dis. 11:413-425[Medline]. |
| 24. | Merriman, T. R., and I. L. Lamont. 1993. Construction and use of a self cloning promoter probe vector for Gram-negative bacteria. Gene 126:17-23[Medline]. |
| 25. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 26. |
Moore, R. A., and R. E. W. Hancock.
1986.
Involvement of outer membrane of Pseudomonas cepacia in aminoglycoside and polymyxin resistance.
Antimicrob. Agents Chemother.
30:923-926 |
| 27. |
Moore, R. A.,
N. C. Bates, and R. E. W. Hancock.
1986.
Interaction of polycationic antibiotics with Pseudomonas aeruginosa lipopolysaccharide and lipid A studied using dansyl-polymyxin.
Antimicrob. Agents Chemother.
29:496-500 |
| 28. |
Moore, R. A.,
D. DeShazer,
S. Reckseidler,
A. Weissman, and D. E. Woods.
1999.
Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei.
Antimicrob. Agents Chemother.
43:465-470 |
| 29. | National Committee for Clinical Laboratory Standards. 1990. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 2nd ed. National Committee for Clinical Laboratory Standards, Villanova, Pa |
| 30. |
Nikaido, H.
1989.
Outer membrane barrier as a mechanism of antimicrobial resistance.
Antimicrob. Agents Chemother.
33:1831-1836 |
| 31. |
Potter, S.,
X. Yang,
M. J. Boulanger, and E. E. Ishiguro.
1998.
Occurrence of homologs of the Escherichia coli lytB gene in gram-negative bacterial species.
J. Bacteriol.
180:1959-1965 |
| 32. |
Rodinov, D. G.,
A. G. Pisabarro,
M. A. De Pedro,
W. Kusser, and E. E. Ishiguro.
1995.
-Lactam-induced bacteriolysis of amino acid-deprived Escherichia coli is dependent on phospholipid synthesis.
J. Bacteriol.
177:992-997 |
| 33. |
Rodinov, D. G., and E. E. Ishiguro.
1996.
Dependence of peptidoglycan metabolism on phospholipid synthesis during growth of Escherichia coli.
Microbiology
142:2871-2877 |
| 34. | Schweizer, H. P., T. Klassen, and T. Hoang. 1996. Improved methods for gene analysis and expression in Pseudomonas spp., p. 229-237. In T. Nakazawa, K. Furukawa, D. Haas, and S. Silver (ed.), Molecular biology of pseudomonads. American Society for Microbiology, Washington, D.C. |
| 35. |
Sexton, M. M.,
L. A. Goebel,
A. J. Godfrey,
W. Chaowagul,
N. J. White, and D. E. Woods.
1993.
Ribotype analysis of Pseudomonas pseudomallei isolates.
J. Clin. Microbiol.
31:238-243 |
| 36. | Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784-791. |
| 37. |
Sirisena, D. M.,
P. R. MacLachlan,
S. L. Liu,
A. Hessel, and K. E. Sanderson.
1994.
Molecular analysis of the rfaD gene, for heptose synthesis, and the rfaF gene, for heptose transfer, in lipopolysaccharide synthesis in Salmonella typhimurium.
J. Bacteriol.
176:2379-2385 |
| 38. | Skorupski, K., and R. K. Taylor. 1996. Positive selection vectors for allelic exchange. Gene 169:47-52[Medline]. |
| 39. | Smith, C. J., J. C. Allen, M. N. Embi, O. Othman, N. Ratzak, and G. Ismail. 1987. Human melioidosis: an emerging medical problem. MIRCEN 3:343-366. |
| 40. | Smith, J. A. 1987. Electrophoretic separation of proteins, p. 10.2.1-10.2.7. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, New York, N.Y |
| 41. |
Titarenko, E.,
E. Lopez-Solanilla,
F. Garcia-Olmedo, and P. Rodriguez-Palenzuela.
1997.
Mutants of Ralstonia (Pseudomonas) solanacearum sensitive to antimicrobial peptides are altered in their lipopolysaccharide structure and are avirulent in tobacco.
J. Bacteriol.
179:6699-6704 |
| 42. | Tsai, C., and C. E. Frasch. 1982. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119:115-119[Medline]. |
| 43. | Wilson, K. 1987. Preparation of genomic DNA from bacteria, p. 2.4.1-2.4.5. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, New York, N.Y |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»