Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 1999, p. 2753-2765, Vol. 43, No. 11
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The ATP Binding Cassette Transporter Gene
CgCDR1 from Candida glabrata Is Involved in the
Resistance of Clinical Isolates to Azole Antifungal Agents
Dominique
Sanglard,1,*
Françoise
Ischer,1
David
Calabrese,1
Paul A.
Majcherczyk,2 and
Jacques
Bille1
Institut de
Microbiologie1 and Division of
Infectious Diseases,2 Centre Hospitalier
Universitaire Vaudois (CHUV), 1011 Lausanne, Switzerland
Received 17 June 1999/Returned for modification 13 August
1999/Accepted 7 September 1999
 |
ABSTRACT |
The resistance mechanisms to azole antifungal agents were
investigated in this study with two pairs of Candida
glabrata clinical isolates recovered from two separate AIDS
patients. The two pairs each contained a fluconazole-susceptible
isolate and a fluconazole-resistant isolate, the latter with
cross-resistance to itraconazole and ketoconazole. Since the
accumulation of fluconazole and of another unrelated substance,
rhodamine 6G, was reduced in the azole-resistant isolates, enhanced
drug efflux was considered as a possible resistance mechanism. The
expression of multidrug efflux transporter genes was therefore examined
in the azole-susceptible and azole-resistant yeast isolates. For this
purpose, C. glabrata genes conferring resistance to azole
antifungals were cloned in a Saccharomyces cerevisiae
strain in which the ATP binding cassette (ABC) transporter gene
PDR5 was deleted. Three different genes were recovered, and among them, only C. glabrata CDR1 (CgCDR1), a
gene similar to the Candida albicans ABC transporter
CDR genes, was upregulated by a factor of 5 to 8 in the
azole-resistant isolates. A correlation between upregulation of this
gene and azole resistance was thus established. The deletion of
CgCDR1 in an azole-resistant C. glabrata clinical isolate rendered the resulting mutant (DSY1041) susceptible to
azole derivatives as the azole-susceptible clinical parent, thus
providing genetic evidence that a specific mechanism was involved in
the azole resistance of a clinical isolate. When CgCDR1 obtained from an azole-susceptible isolate was reintroduced with the
help of a centromeric vector in DSY1041, azole resistance was restored
and thus suggested that a trans-acting mutation(s) could be
made responsible for the increased expression of this ABC transporter
gene in the azole-resistant strain. This study demonstrates for the
first time the determinant role of an ABC transporter gene in the
acquisition of resistance to azole antifungals by C. glabrata clinical isolates.
 |
INTRODUCTION |
Patients with advanced human
immunodeficiency virus infection develop opportunistic infections due
to the decrease in their immunity. Oropharyngeal candidiasis (OPC)
caused by Candida albicans is a very common opportunistic
infection in these patients and is treated mainly with azole antifungal
agents, particularly with fluconazole. Treatment failures have been
observed following the repeated use of this agent in relapses of OPC
(21, 37, 45, 55). Different laboratories have reported that
C. albicans isolates sampled sequentially during fluconazole
treatment showed decreased susceptibility to fluconazole compared to
that of the isolates sampled at the time of the first episode of
infection (6, 30, 41, 53). Clinical resistance to
fluconazole has been correlated with in vitro resistance of the yeasts
recovered from patients undergoing antifungal therapy (54).
This phenomenon has been also documented in other yeast species,
including Candida glabrata (4, 16), Candida
tropicalis (28), and Candida krusei
(57, 58), and in Cryptococcus neoformans
(27).
The increasing number of azole-resistant isolates recovered in many
institutions during the past decade has motivated studies with the aim
of understanding their mechanisms of resistance at the molecular level.
Until now, C. albicans isolates have provided a major source
for the discovery of mechanisms of azole resistance. Recent findings
have shown that increased azole efflux is an important mechanism of
resistance in yeast clinical isolates. In azole-resistant C. albicans isolates, increased azole efflux has been correlated with
the upregulation of multidrug efflux transporter genes from two
distinct families, the ATP binding cassette (ABC) transporters (CDR1 and CDR2) and the major facilitators
(C. albicans MDR1) (3, 27, 30, 50, 53, 60).
Deletion of CDR1 in C. albicans leads to azole
hypersusceptibility and increased fluconazole accumulation (51). Decrease in azole affinity of the target enzyme of
these antifungals, i.e., the cytochrome P450 lanosterol demethylase (called CYP51A1, or ERG11), has also been explained at the molecular level. Mutations in the genes encoding CYP51A1 (CYP51A1)
have been detected in azole-resistant yeasts. These mutations resulted, in some cases, in amino acid substitutions with the probable effect of
altering the binding properties of azoles and thus contributing to a
decrease in azole susceptibility in clinical yeast isolates (49). Another mechanism of azole resistance originates from alterations in the ergosterol biosynthesis pathway, often resulting in
the absence of ergosterol. This feature renders cells affected by this
mechanism cross-resistant to amphotericin B. A few C. albicans clinical isolates possess this property and have been found to accumulate 14
-methylergosta-8,24(28)-dien-3
,6
-diol, which is indicative of a defect in
5,6 sterol desaturase
(24, 35). The above-mentioned resistance mechanisms can
combine with each other in C. albicans and complicate the
analysis of such isolates, since it is difficult to establish the role
of an individual mechanism in the decrease in azole susceptibility (48). Dissection of resistance mechanisms by the use of
genetics in C. albicans clinical isolates resistant to azole
antifungal agents has not been reported yet. This lack of important
information arises from the difficulties of developing reliable genetic
systems for this diploid organism.
Historically, C. albicans accounted for 70 to 80% of
organisms isolated in patients infected by fungal species. However,
recent data report a population shift toward non-C. albicans
yeast species, such as C. glabrata, C. tropicalis, or C. krusei (15). Among the
non-C. albicans species, C. glabrata has emerged
as an important nosocomial pathogen. Berrouane et al. (7)
reported that among Candida species, the proportion of
C. glabrata infections in the Iowa University Hospitals from
1988 to 1994 increased significantly, while it remained unchanged for
other yeast species and even decreased for C. albicans.
Other investigators have noted similar increases in the frequency of
infections caused by C. glabrata, mostly in conjunction with
the use of azoles (34, 39, 40). We also observed that
C. glabrata was often recovered from cultures originating from AIDS patients with OPC. C. glabrata is known to be less
susceptible to fluconazole than most of the C. albicans
fluconazole-susceptible isolates. Rex et al. (43) reported
that the minimal inhibitory concentration inhibiting 50% of the yeast
population investigated (MIC50) of fluconazole for 31 C. glabrata isolates was 16 µg/ml, while the
MIC50 was 0.25 µg/ml for 129 C. albicans
isolates. In several patients who responded poorly to fluconazole
therapy, we noticed that C. glabrata isolates could persist
and that their susceptibility to azoles was decreased. Since mechanisms
of resistance to azoles have been less intensively investigated in
non-C. albicans species such as C. glabrata, we
addressed here the molecular basis of resistance in two pairs of
isolates taken from two different AIDS patients with documented azole
antifungal treatment failure. We first isolated C. glabrata
azole resistance genes by complementation of hypersusceptibility of a
Saccharomyces cerevisiae ABC transporter mutant. From the
three different azole resistance genes isolated, only
CgCDR1, which resembles the C. albicans ABC
transporter CDR genes, was upregulated in the
azole-resistant C. glabrata isolates from these two
patients. By introducing a genetic marker in an azole-resistant
clinical isolate, not only could evidence for the participation of this
gene in azole resistance be obtained, but the nature of the mutation or
mutations implicated in the upregulation of CgCDR1 could be predicted.
 |
MATERIALS AND METHODS |
Strains and media.
The yeast strains used in this study are
listed in Table 1. They were grown at
30°C on yeast extract-peptone-dextrose (YEPD) complex medium
containing 2% glucose, 1% Bacto peptone (Difco Laboratories, Detroit,
Mich.), and 0.5% yeast extract (Difco). YEPD agar plates contained 2%
agar (Difco) as a supplement. Yeast nitrogen base (YNB [Difco]) with
2% glucose and 2% agar (Difco) with appropriate amino acids and bases
was used as a selective medium after transformation of S. cerevisiae YKKB-13 and C. glabrata. Agar plates
containing 50 µg of 5-fluoroorotic acid (5-FOA) per ml were made for
the introduction of the ura3 genetic marker in YNB selective
medium with 50 µg of uridine per ml. Escherichia coli
DH5
(19) was used as a host for plasmid constructions and
propagation and was grown on standard media.
Fluconazole and rhodamine 6G accumulation.
Fluconazole
accumulation testing was performed in duplicate with
3H-labelled fluconazole (Amersham Life Science, Little
Chalfont, Buckinghamshire, United Kingdom) as described previously
(53), but with a single incubation time of 20 min. Rhodamine
6G (Sigma, Fluka Chemie AG, Buchs, Switzerland) accumulation testing
was performed with yeast cells grown to the logarithmic phase in 14 ml
of sterile polystyrene tubes with 2 ml of YEPD at 30°C under constant
agitation. Rhodamine 6G labelling of cells was performed in 1 ml of
YEPD with 107 cells and containing 10 µM rhodamine 6G.
The mixture was incubated for 30 min at 30°C, after which it was
stopped by placing the tubes on ice. These conditions have been
optimized for minimal incubation time and maximal rhodamine 6G
accumulation (data not shown). The reaction mixture was then diluted
40-fold in cold sterile 0.1 M phosphate-buffered saline (PBS) at pH 7.0 and then directly subjected to flow cytometry in a FACScan
fluorescence-activated cell sorter (FACS) (Becton Dickinson, San Jose,
Calif.). Fluorescence was measured at an excitation wavelength of 488 nm and an emission wavelength of 515 nm (F1 detector). The sheath fluid
was Isotone II. Data were acquired for 1,500 cells with the FACScan
Lysis II software. Rhodamine 6G efflux was determined with
107 cells previously loaded by incubation with 10 µM
rhodamine 6G at 30°C in YEPD. Cells were washed three times with YEPD
medium at 4°C to remove excess rhodamine 6G, and efflux was started
by incubation at 30°C in the same medium. The decrease in
fluorescence of loaded cells was then recorded at regular time intervals.
Drug susceptibility tests.
Tests of susceptibility to azole
antifungals were performed by broth microdilution assay according to
the National Committee for Clinical Laboratory Standards (NCCLS)
protocol M27-A (33) with RPMI-1640 medium (Difco) and
incubation at 35°C for 48 h. Endpoint readings were recorded
with a microplate reader (Bio-Rad, Hercules, Calif.), and the azole
concentration yielding at least 50% growth inhibition compared to the
growth in drug-free medium was defined as the MIC. Amphotericin B
susceptibility was measured according to growth in Antibiotic Medium 3 broth (Difco) as recommended previously (42).
Susceptibility to different compounds of the
C. glabrata
isolates and of
S. cerevisiae strains containing
C. glabrata drug
resistance genes was also tested qualitatively by
spotting serial
dilutions of yeast cultures onto complex YEPD medium
agar plates.
This provides an easy visualization of growth differences
between
different yeast strains. Since
S. cerevisiae does
not grow well
in the RPMI medium described in the NCCLS protocol M27-A,
the
use of the qualitative plate assay for drug susceptibility is
more
adequate. The following drugs were solubilized in dimethyl
sulfoxide:
ketoconazole and itraconazole (Janssen Pharmaceuticals,
Beerse,
Belgium), 4-nitroquinoline-
N-oxide (Sigma), and benomyl
(Riedel-de-Haën, Seelze, Germany). Fluconazole (Pfizer UK,
Sandwich,
United Kingdom), cycloheximide, fluphenazine, and crystal
violet
(Sigma) were dissolved in water. Each plate contained 15 ml of
agar. The drugs were diluted in the corresponding solvents to
achieve
the concentrations used in YEPD plates. Preliminary tests
were
performed to optimize drug concentrations in YEPD plates
so that growth
differences between the different
S. cerevisiae and
C. glabrata strains used in this study could be observed.
To perform
the susceptibility tests, yeasts were grown overnight
at 30°C with
constant shaking in YEPD liquid medium. The cultures
were diluted to
2 × 10
7 cells per ml in 0.9% NaCl. Five microliters
of this suspension
and of serial dilutions of each yeast culture was
spotted onto
each type of plate and incubated for 48 h at 30°C.
Ergosterol biosynthesis inhibition.
Ergosterol biosynthesis
inhibition assays were performed with cellular extracts from C. glabrata strains. Cellular extracts were from cells grown in 50 ml
of YEPD medium and were obtained by mechanical disruption with glass
beads (0.3 to 0.5 mm in diameter) in phosphate buffer (0.1 M sodium
phosphate [pH 7.5]). The extracts were centrifuged at
10,000 × g for 10 min at 4°C. The assays were performed with increasing fluconazole concentrations by the method described by Vanden Bossche et al. (56). Each assay mixture contained 5 mg of cellular proteins from the individual strain which
was measured by the Bradford assay (Bio-Rad, Hercules, Calif.).
Isolation of DNA and RNA.
The small-scale isolation of DNA
and RNA from C. glabrata was performed from cultures grown
to the logarithmic growth phase in YEPD medium at 30°C under constant
shaking. One milliliter of each culture was centrifuged in Eppendorf
tubes at 4°C. After a washing step with TE (10 mM Tris-HCl [pH
7.5], 1 mM EDTA), yeast DNA was extracted by adding 0.3 g of
glass beads (0.3 to 0.5 mm in diameter), 200 µl of a breaking buffer
(2% Triton X-100, 1% sodium dodecyl sulfate [SDS], 10 mM Tris-HCl
[pH 8.0], 1 mM EDTA, 100 mM NaCl), and 200 µl of
phenol-chloroform-isoamyl alcohol (24:24:1). After 1 min of vortexing
in a Mini-Beadbeater (Biospec Products, Inc., Bartlesville, Okla.), the
tubes were centrifuged at maximum speed for 10 min in a
microcentrifuge, and the supernatant was reextracted with
chloroform-isoamyl alcohol (24:1). Nucleic acids were then precipitated
with 20 µl of 3 M sodium acetate (pH 5.0) and 400 µl of ethanol at
20°C, washed with 70% ethanol, and resuspended in 50 µl of TE.
For the extraction of RNA, the yeast cell pellet was mixed with
0.3 g of glass beads, 300 µl of RNA extraction buffer (0.1 M
Tris-HCl [pH 7.5], 0.1 M LiCl, 10 mM EDTA, 0.5% SDS) and 300 µl of
phenol-chloroform-isoamyl alcohol (24:24:1). After 1 min of vortexing
in the Mini-Beadbeater, the aqueous phase was reextracted with
phenol-chloroform-isoamyl alcohol, and RNA was precipitated with 600 µl of ethanol at
20°C for 1 h. The RNA pellet was
resuspended in 50 µl of diethyl pyrocarbonate-treated H2O, and the concentration was measured
spectrophotometrically at A260 and
A280. RNA was stored at
80°C.
Typing of C. glabrata clinical isolates.
Two
different methods were utilized for the typing analysis of the C. glabrata clinical isolates. The first method was based on
restriction fragment length polymorphism (RFLP) with HinfI as restriction enzyme as described by others (5, 11). The second method was based on the use of repetitive probes Cg6 and Cg12 as
described previously (29). In this method, 5 µg of
C. glabrata genomic DNA, prepared as described above, was
cut with EcoRI. The digested DNA was electrophoresed in a
0.7% agarose gel. Transfer was made by vacuum blotting on GeneScreen
Plus membranes (DuPont NEN, Boston, Mass.) after depurination of the
DNA with HCl. The Cg6 and Cg12 repetitive probes were prepared from
phage DNA by liquid lysate with the Qiagen
kit (Qiagen, Chatsworth, Calif.). The probes were labelled with [32P]dATP by nick
translation with a nick translation system (Gibco BRL, Life
Technologies, Inc., Rockville, Md.). After prehybridization for 30 min,
membranes were hybridized overnight at 65°C in 5× SSPE (1× SSPE is
0.15 M NaCl with 10 mM NaH2PO4 and 1 mM EDTA) containing 5% dextran sulfate and 0.3% SDS. The membranes were washed
four times for 30 min each at 48°C in 2× SSPE containing 0.2% SDS.
Fuji RX film was used for visualization of hybridization patterns.
Yeast transformations.
S. cerevisiae and C. glabrata were transformed by the lithium acetate procedure as
described by Sanglard et al. (51).
Cloning of C. glabrata azole resistance genes.
The C. glabrata gene library was constructed in the plasmid
YEp24 (GenBank accession no. L09156). C. glabrata genomic
DNA from strain ATCC 90030 was partially digested with Sau3A
to obtain fragment lengths ranging from 6 to 9 kb. The fragments were
purified by agarose gel electrophoresis and ligated to YEp24 previously digested with BamHI. The gene library was amplified in
E. coli DH5
. C. glabrata genes conferring
resistance to azole antifungals were cloned by complementation of
hypersusceptibility to fluconazole of the S. cerevisiae
strain YKKB-13. First, about 80,000 Ura+ clones were
selected after transformation of YKKB-13 with the C. glabrata genomic library. The Ura+ clones were then
pooled in separate aliquots, part of which were spotted onto YEPD
medium containing 5 and 10 µg of fluconazole per ml, while the
remaining cells were kept frozen at
80°C.
Plasmid rescue from S. cerevisiae.
Episomal plasmids
from the parent vector YEp24 were rescued from S. cerevisiae
transformants by electroporation in E. coli. Yeast cells
were grown in selective YNB medium to late log phase, and total DNA was
extracted as outlined above. One microliter of the DNA suspension (50 µl) was electroporated into E. coli DH5
, and
ampicillin-resistant clones from each transformant were analyzed by
restriction enzyme analysis.
Construction of C. glabrata vectors.
To enable
the replication of YEp24-derived plasmids in C. glabrata and
particularly of pNB126, the CgCEN and CgARS
sequences contained in pCgACU-5 were subcloned in these vectors.
pCgACU-5 (a kind gift of K. Kitada) was generated by inserting
CgURA3 into the XhoI site of pCgAC-5
(25). The presence of the CgCEN and CgARS sequences in plasmids contributes to their stable
replication in C. glabrata in one copy per cell. The
CgCEN and CgARS sequences were recovered from
pCgACU-5 by digestion with SalI and
XhoI and subcloned into the single SalI site
of pNB126 to generate pDS670. pDS670 contains CgCDR1
and could transform successfully ura3 mutants from both
S. cerevisiae and C. glabrata.
Disruption of CgCDR1.
For the disruption of
CgCDR1 in C. glabrata, a 4.9-kb fragment from
pNB126 was cloned into the same sites of pMTL21 (10), yielding pDS458. An 800-bp fragment was removed from pDS458 by digestion with BglII, thus creating a deletion in
CgCDR1. The 3.7-kb BamHI-BglII
fragment from pNKY51, which contained a hisG-URA3-hisG cassette with the S. cerevisiae URA3 gene, was inserted in
the BglII-treated pDS458, thus yielding pDS460. Digestion of
pDS460 with PvuII and XhoI, the latter cutting in
the polylinker site of pMTL21, generated a fragment of 5.3 kb which was
used to transform DSY1029 by lithium acetate.
Northern and Southern blots.
DNA was separated by
conventional 1% agarose gel electrophoresis in TAE buffer (40 mM
Tris-acetate [pH 7.5], 1 mM EDTA). For RNA electrophoresis, RNA
samples were resuspended in a loading buffer (50% formamide, 100 mM
morpholinepropanesulfonic acid [MOPS] [pH 7.0], 6.4% formaldehyde,
5% glycerol, 5% of a water solution saturated with bromophenol blue),
denatured at 85°C for 5 min, and separated by 1% agarose gel
electrophoresis. The agarose was melted in a buffer containing 0.1 M
MOPS, 0.6 M formaldehyde, and 10 µg of ethidium bromide per ml. The
electrophoresis buffer was 0.1 M MOPS (pH 7.0). After completion of
electrophoresis, RNA was visualized under UV light, and the position of
the rRNA was determined. Both Northern and Southern blots were
performed by vacuum blotting onto GeneScreen Plus membranes (DuPont
NEN, Boston, Mass.). Membranes containing RNA were baked under vacuum for 2 h at 80°C. Membranes were prehybridized at 42°C with a
buffer consisting of 50% formamide, 1% SDS, 4× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 10% dextran sulfate, and 100 µg
of salmon sperm DNA per ml. 32P-DNA-labelled probes were
generated by random priming (14) and added to the
hybridization solution overnight. Washing steps were performed at high
stringency identical to those recommended by the supplier (DuPont NEN,
Boston, Mass.). Stripping of probes off Northern blots for sequential
hybridizations was achieved by boiling the membranes for 10 min in TE
buffer with 0.1% SDS.
The DNA probes used in Southern and Northern blots were as follows:
CgCDR1, 1.8-kb
XbaI-
BamHI fragment
from pNB126;
CgYAP1,
2.3-kb
PstI-
NruI
fragment from pNB125; and
CgMDR1, 1.2-kb
EcoRV
fragment from pNB124. The
CgERG11 and
CgURA3
probes were generated
from fragments amplified by PCR from genomic DNA.
The primers
for
CgURA3 (GenBank accession no.
L13661) were
5' CTCGAGAACCAATTGCATCA
3' and 5'
CTAGCTTCCTATTGGATATG 3' and amplified a 900-bp fragment.
The
primers for
CgERG11 (GenBank accession no.
L40389) were
5' ATGTCCACTGAAAACACTTCTTTG 3' and 5'
CTAGTACTTTTGTTCTGGATGTCT
3' and amplified the 1.6-kb
CgERG11 open reading frame
(ORF).
Quantifications of Northern blot bands were performed by scanning the
hybridized membranes in an Instant Imager (Packard Instrument
Company,
Meriden, Conn.). Signals were integrated by the software
supplied by
the manufacturer and normalized to the corresponding
values of an
internal standard. In the case of
C. glabrata, the
internal
standard was the
CgURA3 probe.
DNA sequencing.
Sequence data were obtained with DNA
fragments subcloned from pNB124, pNB125, and pNB126 into pBluescript
(Stratagene GmbH, Zürich, Switzerland). Sequence data were
generated on both DNA strands by using reverse or universal primers and
customized primers by automated sequencing in a Li-Cor 4200 sequencer
(Li-Cor, Inc., Lincoln, Nebr.).
 |
RESULTS |
Origin and azole susceptibility of C. glabrata
isolates.
For the study of mechanisms of resistance to azoles,
C. glabrata clinical isolates were selected retrospectively
from a collection of yeasts recovered from AIDS patients with OPC. The
C. glabrata strains were chosen from two different patients
with recurrent OPC and were first selected on the basis of decreased
susceptibility to azole antifungals.
Patient 1 had his first OPC episode in October 1990 and was diagnosed
with AIDS.
C. albicans was isolated initially from the
patient's oral cavity in December 1993 and was subsequently found
in
recurrent episodes of OPC. In April 1994, the first
C. glabrata strain (DSY528) was isolated. At that time, patient 1 had
received
a cumulative dose of 17.3 g of fluconazole, and his CD4
count
in blood was 4 cells per mm
3. After treatment with
400 mg of fluconazole for 7 consecutive
days, OPC was still persistent
47 days later. DSY530 was isolated
at this time and showed a reduced
susceptibility to fluconazole
compared to DSY528 (Table
2). Patient 2 had his first clinically
documented episode of OPC in November 1991 and was diagnosed with
AIDS.
C. albicans was first isolated from the oral cavity in
February
1993. In May 1995,
C. glabrata DSY562 was isolated
for the first
time together with
C. albicans. The patient
had received a cumulative
dose of 4.1 g of fluconazole, and his
CD4 count in blood was 34
cells per mm
3. After two courses
of treatment with 200 mg of fluconazole for
7 consecutive days each,
OPC was still persistent 50 days later,
and the
C. glabrata
strain DSY565 was isolated, which showed reduced
susceptibility to
fluconazole compared to that of DSY562 (Table
2). In both patients,
C. glabrata isolates were isolated in mixed
culture with
C. albicans. The less susceptible
C. glabrata
isolate
of each patient will be designated in this study as azole
resistant,
without reference to the clinical MIC breakpoints proposed
by
Rex et al. (
44).
The
C. glabrata strains from these two patients were typed
by two different methods. The results shown in Fig.
1 demonstrate
that identical banding
patterns for the two
C. glabrata strains
from a given
patient could be obtained by these methods and thus
suggest that the
azole-susceptible and azole-resistant isolates
from these two patients
were related to each other. This implies
that no strain replacement
occurred during azole therapy in these
patients, but rather that azole
resistance developed from the
original azole-susceptible isolates. The
stability of the resistance
phenotype did not change after more than 50 consecutive passages
(over 500 generations) in drug-free medium. Thus,
azole resistance
in the azole-resistant isolates could be due to genome
alterations
rather than to transient adaptation to azole antifungals.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Typing of C. glabrata clinical isolates used
in this study. (A) Restriction enzyme analysis of C. glabrata genomic DNA digested with HinfI. Restriction
fragments were separated by 1% agarose gel electrophoresis and stained
with ethidium bromide. (B) Profiles of band patterns revealed by
hybridization with the repetitive element probes Cg6 and Cg12 as
described by Lockhart et al. (29). Molecular size standards
were depicted on each photograph.
|
|
Fluconazole and rhodamine 6G accumulations in C. glabrata isolates.
We performed several experiments in order
to determine the mechanisms of azole resistance in the azole-resistant
isolates. First, no changes in amphotericin B susceptibility were
observed in the four clinical strains used in this study (Table 2).
Therefore, since some alterations in the ergosterol biosynthetic
pathway are coupled with amphotericin B resistance (17, 35),
it is likely that no alterations in this pathway were occurring in
these strains. In agreement with this hypothesis was the detection of this sterol in ergosterol biosynthesis inhibition assays. Second, fluconazole concentrations at which the ergosterol biosynthesis was
inhibited in cellular extracts by 50% (IC50) did not vary significantly between azole-susceptible and azole-resistant isolates (Table 3). This led us to deduce that an
alteration in the affinity of the C. glabrata CYP51A1
proteins to azoles was not the cause of azole resistance in these
isolates. We therefore tested the accumulation of two different
substances in the azole-susceptible and azole-resistant isolates. As
shown in Table 3, the azole-resistant isolates were accumulating less
fluconazole than their azole-susceptible parents. The accumulation of
fluconazole was reduced by factors of 3.8 and 3.1 in DSY565 and DSY530
compared to those in DSY562 and DSY528, respectively. Failure in drug
accumulation was not restricted to a single compound, since
intracellular levels of rhodamine 6G were also affected in the
azole-resistant isolates (Fig. 2). The
decreases in rhodamine 6G accumulation were 6.1- and 5.1-fold in DSY565
and DSY530 compared to those in DSY562 and DSY528, respectively.
Failure in accumulating several unrelated drugs in the azole-resistant
isolates was reminiscent of the effect of multidrug efflux transporters
observed in C. albicans, and therefore we exploited the
possibility that multidrug efflux transporter genes were upregulated in
the azole-resistant C. glabrata isolates.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Fluconazole accumulation and inhibition of ergosterol
biosynthesis by fluconazole in C. glabrata isolates
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Rhodamine 6G accumulation in C. glabrata
clinical isolates. Cells were labelled with rhodamine 6G and analyzed
by FACS as indicated in Materials and Methods. FACS histograms are
given for the unlabelled control (DSY562) and for each yeast strain
labelled with rhodamine 6G. The mean fluorescence values for DSY562 and
DSY565 were 691 and 113, respectively, and those for DSY528 and DSY530
were 566 and 110, respectively. Accumulation experiments with rhodamine
6G were repeated five times with these strains. DSY565 and DSY530 mean
fluorescence reached 16% ± 1.8% and 12% ± 3% of the values
obtained with DSY562 and DSY528, respectively.
|
|
Cloning of C. glabrata azole resistance genes.
Given the observations mentioned above, we first attempted to isolate
multidrug efflux transporter genes from C. glabrata, since
at the time these studies were initiated, no C. glabrata gene encoding a transporter was available. We used a strategy consisting of isolation of C. glabrata genes which could
confer azole resistance to an S. cerevisiae multidrug efflux
transporter mutant. Since the absence of ABC transporter Pdr5p in
S. cerevisiae yields hypersusceptibility to azole
antifungals, this genetic background was suitable to isolate genes
involved in azole resistance in C. glabrata. From a total of
about 80,000 Ura+ S. cerevisiae transformants,
more than 200 individual yeasts able to grow on media containing 5 and
10 µg of fluconazole per ml were selected. Each fluconazole-resistant
clone was then tested for different drug resistance profiles by using
agar plates containing 10 and 25 µg of fluconazole per ml, 0.1 and 1 µg of itraconazole per ml, 0.2 and 2 µg of ketoconazole per ml,
0.25 µg of cycloheximide per ml, 10 µg of fluphenazine per ml, 50 µg of benomyl per ml, 0.5 µg of crystal violet per ml, and 0.5 µg
of nitroquinoline-N-oxide per ml. Among the 200 fluconazole-resistant clones, only 20 were specifically resistant to
fluconazole among the azole drugs tested while remaining resistant to
cycloheximide, benomyl, and nitroquinoline-N-oxide. The
other yeast transformants were able to grow on medium containing different azole antifungals and other drugs, such as cycloheximide and
fluphenazine. Plasmids rescued from these isolates were extracted and
separated by gel electrophoresis. To group these plasmids into
different categories, C. albicans probes for
CDR1, MDR1, and CAP1, which were genes
recovered by the same functional complementation (50), were
used in low-stringency hybridizations of Southern blots of the C. glabrata plasmids (data not shown). Three different classes of
plasmids were recovered, each containing a DNA fragment hybridizing
with these probes. From each of these groups, a single plasmid was
chosen for further restriction map and sequence analysis. Figure
3A shows the restriction maps of these
three plasmids (pNB124, pNB125, and pNB126) with their respective azole
resistance genes. pNB124 contained a gene with similarity to C. albicans MDR1 (formerly named BENr), a gene
belonging to the class of major facilitator multidrug transporters.
This gene was named CgMDR1 (52). pNB125 contained a gene with similarity to the S. cerevisiae YAP1 gene, a
transcription factor with a leucine dimerization motif. This gene was
therefore named CgYAP1 (52). pNB126 contained a
gene with similarity to fungal ABC transporters such as the S. cerevisiae PDR5 gene (8), the C. albicans
CDR1 and CDR2 genes (50, 53) or the recently cloned CgPDH1 gene (32). This C. glabrata gene was named CgCDR1 for Candida
drug resistance gene, by analogy with the C. albicans CDR
genes. Figure 3B shows the drug resistance profiles obtained because of
the presence of each plasmid in YKKB-13. All plasmids could confer
resistance to fluconazole, but only pNB126 containing CgCDR1
conferred resistance to different azole antifungals and fluphenazine.
pNB124 and pNB125 conferred similar drug resistance profiles, but only
pNB124 containing CgMDR1 was able to confer slight
resistance to benomyl.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Cloning of azole resistance genes in C. glabrata. (A) Restriction maps of C. glabrata insert
DNA from plasmids pNB124, pNB125, and pNB126 conferring azole
resistance in the S. cerevisiae pdr5 mutant YKKB-13. The
plasmid backbone is YEp24. Sau3A-digested C. glabrata DNA was introduced at the BamHI site of YEp24
in the construction of the gene library. The transcription directions
of the ORF of each azole resistance gene deduced from nucleotide
sequencing are shown by arrows. Ba, BamHI; Bg,
BglII; E, EcoRI; Ev, EcoRV; Xba,
XbaI; [Ba/Sa], BamHI site of YEp24 destroyed by
insertion of a genomic Sau3A site. (B) Drug resistance
profiles of S. cerevisiae YKKB-13 transformed with plasmids
pNB124, pNB125, and pNB126. Yeast strains were spotted in serial
dilutions onto YEPD medium containing the drug at the indicated
concentration. Plates were incubated at 30°C for 48 h.
|
|
Expression of azole resistance genes in C. glabrata.
We
next performed Northern blot analysis of total RNA extracted from
C. glabrata clinical isolates DSY562, DSY565, DSY528, and
DSY530 with DNA probes for each of the azole resistance genes. This
experiment was aimed to show a possible correlation between the
expression of an azole resistance gene and azole resistance in the
clinical isolates. The CgURA3 gene was used as an internal control for the standardization of signals. The CgERG11 gene
was also included as a probe in this analysis, since it was reported by
others that CgERG11 overexpression can moderately establish azole resistance in C. glabrata (31). Figure
4A shows that only CgCDR1
expression was elevated in both azole-resistant isolates from the two
different patients. The relative increases in CgCDR1 expression obtained in DSY565 and DSY530 were eight- and fivefold compared to those in DSY562 and DSY528, respectively (Fig. 4B). The
expression of the other genes was not significantly affected by azole
resistance. CgMDR1 expression was increased in both DSY528 and DSY530 compared to the level in DSY562 and DSY565, but indicated that it did not vary between azole-susceptible and azole-resistant isolates from the same patient.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of azole resistance genes in C. glabrata clinical isolates. (A) Northern blot analysis. Five
micrograms of RNA from each strain was separated and blotted as
indicated in Materials and Methods. The blotted membrane was probed
sequentially with 32P-labelled probes for
CgCDR1, CgYAP1, CgMDR1,
CgERG11, and CgURA3. Labelled DNA probes are
described in Materials and Methods. Washed membranes were exposed to
Fuji RX films for 1 to 10 h. (B) Quantification of hybridization
signals detected by each 32P-labelled probe. Signals given
by each probe were counted with an Instant Imager and normalized to the
counts obtained with the CgURA3 probe. The values of the
normalized counts for CgMDR1 were too small to be reported
in the figure. These values were 0.0093 for DSY528 and 0.012 for
DSY530, and 0.037 for DSY562 and 0.026 for DSY565.
|
|
Analysis of nucleotide and amino acid sequences of
CgCDR1.
Since only CgCDR1 expression was enhanced
in azole-resistant isolates, this gene was submitted to closer
analysis. Figure 5
shows the nucleotide sequence of a 5.3-kb fragment isolated from pNB126
starting from the Sau3A cloning site on YEp24 and ending at
the single BamHI site of the same plasmid. An uninterrupted ORF of 4,500 bp encoding a protein with 1,499 amino acids was detected
from the most upstream ATG codon. The 5' region starting from this ATG
codon displayed typical features of yeast promoters: an adenosine at
position
3 and a TATA box at position
83 could be distinguished
(Fig. 5). We noticed the presence of four putative Pdr1p and Pdr3p
binding sites in the 5' flanking region of CgCDR1. The
positions of these sites were as
follows:
516GTCCACGGAA
507
387TTCCACGGAA
378
228TTCCACGGGA
219
134CTCCACGGGA
125

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 5.
Nucleotide and deduced amino acid sequences of the
CgCDR1 gene and its encoded polypeptide. Nucleotides and
amino acids are numbered to the left and to the right, respectively.
The sequence starts from a Sau3A site and ends with a
BamHI site. The CgCDR1 ORF is indicated below the
nucleotide sequence, and its position in the pNB126 restriction map
corresponds to the arrow shown in Fig. 3A. In the deduced protein
sequence, putative membrane-spanning domains are underlined, and the
Walker A and B ATP-binding motifs and ABC signatures are boxed in the
N- and C-terminal regions. A TATA box in the 5' flanking region is
underlined. Putative Pdr1p and Pdr3p binding sites in the 5' flanking
region are boxed. The CgCDR1 sequence is available in the
GenBank database under accession no. AF109723.
|
|
The consensus of the Pdr1p and Pdr3p binding sites in the
S. cerevisiae PDR5 gene was
TTCCG(C/T)
GGAA.
Nucleotides
conserved among the Pdr1p and Pdr3p binding sites are shown
in
boldface letters. Palindromes are underlined. These sites (and
conserved nucleotide sequences) have been shown to be important
in the
regulation of ABC transporter genes in
S. cerevisiae by
the
transcription factors Pdr1p and Pdr3p (
23). These sites
may
therefore play a similar role in the regulation of
CgCDR1.
The
CgCDR1 ORF encodes a protein of 169 kDa (CgCdr1p) and
displays a structure and domain organization typical of membrane
proteins of the ABC superfamily (Fig.
5). A blast search of the
CgCDR1 ORF against the entire GenBank database gave the
highest
score with
PDR5 from
S. cerevisiae. C. glabrata CgCdr1p is 75%
identical to Pdr5p. CgCdr1p is composed
of two homologue halves,
each comprising a C-hydrophilic domain and a
N-hydrophobic domain.
The hydropathy plot of CgCdr1p identified
six putative transmembrane
domains for each of the hydrophobic domains
(Fig.
5). Each hydrophilic
domain included ATP-binding motifs found in
ATP-binding cassette
domains. In the N-terminal ABC domain, the Walker
A (LGRPGSGCTTLL)
and B (QCWDNATRGLD) motifs and the ABC
signature (SGGERKRVSIAE)
could be recognized. In the
C-terminal ABC domain, both the Walker
A (GASGAGKTTLL)
and Walker B (VFLDEPSGLD) regions are present,
but an atypical ABC signature (NVEQRKRLTIGV) is present where
the
usual SXGQ/E is replaced by NVEQ. Recently Miyazaki et al.
(
32) reported the nucleotide sequence of an ABC transporter
gene from
C. glabrata called
PDH1. Pdh1p,
however, was not identical
to CgCdr1p, as revealed by pairwise
alignment (data not shown).
Both proteins showed 73% identity, which
was most prominent in
the ABC signatures and Walker A and B
domains.
Construction of CgCDR1 mutants in C. glabrata.
Given the overexpression of CgCDR1 in the
azole-resistant clinical isolates, we addressed the involvement of this
ABC transporter in azole resistance by the deletion of this gene in one
azole-resistant isolate. First, an auxotrophic mutant for uracil was
generated by positive selection of resistance to 5-FOA. 5-FOA-resistant colonies in S. cerevisiae are usually deficient for the
URA3 gene, and this selection was applied successfully
to C. glabrata. 5-FOA-resistant colonies from DSY565
were obtained with a low reversion frequency (>10
8). The
identity of the ura3 auxotrophy could be confirmed, since, by transformation of one 5-FOA-resistant DSY565 derivative (DSY1029) with a C. glabrata plasmid containing the CgURA3
gene, Ura+ colonies were obtained (data not shown). DSY1029
was further utilized for the deletion of CgCDR1. A linear
fragment which contained the hisG-URA3-hisG cassette from
pNKY51 (2) replacing an internal deletion of
CgCDR1 (Fig. 6A) was used to
transform DSY1029. Ura+ colonies were selected, and
analysis of the CgCDR1 locus in one of the Ura+
transformants (DSY1041) confirmed that the correct gene replacement had
occurred (Fig. 6B). The wild-type CgCDR1 6-kb
EcoRI fragment observed in both DSY562 and DSY565 was not
observed in DSY1041 and was replaced by a 9.4-kb band expected from the
insertion of the hisG-URA3-hisG cassette. To verify if the
deletion made in CgCDR1 affected its expression, total RNA
from DSY1041 was analyzed by Northern analysis with a CgCDR1
probe. As shown in Fig. 7, a weak signal
could still be detected in RNA from DSY1041, but with a slightly
reduced migration when compared to the CgCDR1 mRNA signals
observed in DSY562 and DSY565. The intensity of this signal was,
however, much reduced compared to that of the CgCDR1 mRNA
signal in DSY565. Therefore, deletion of CgCDR1 in DSY565 affected the expression of this gene to a large extent. The weak signal
still observed in DSY1041 could be attributed to the formation of
aberrant CgCDR1 mRNA or to the presence of additional
mRNA(s) from an additional ABC transporter gene or genes hybridizing
weakly with the CgCDR1 probe.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Disruption of CgCDR1 in C. glabrata. (A) Genomic map of the CgCDR1 locus before
and after internal deletion of a 0.8-kb BglII site. The
CgCDR1 ORF is represented by an arrow, on which boxes give
the location of the N- and C-terminal Walker A and B domains. The
BglII deletion destroys the C-terminal domain. The size of
the wild-type EcoRI genomic fragment containing
CgCDR1 is about 6 kb. The insertion of the
hisG-URA3-hisG cassette after deletion of the 0.8-kb
BglII fragment yields a product of about 9.4 kb. (B)
Southern blot of genomic DNA from C. glabrata isolates.
Genomic DNA was extracted from the clinical strains DSY562 and DSY562,
from the laboratory strain DSY671, and from the CgCDR1
deletion mutants DSY1041 and DSY1033, both of which were derived from
DSY565 and DSY671, respectively. The CgCDR1 probe is
described in Materials and Methods. Signals revealed by the labelled
probe correspond to those expected from the genomic restriction map.
The origin of each DNA is indicated.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 7.
Expression of CgCDR1 in C. glabrata clinical strains and from the CgCDR1 deletion
mutant DSY1041. Total RNA was extracted from each strain and separated
by gel electrophoresis. Membranes were probed sequentially with
CgCDR1 and CgURA3 labelled probes (same as
described in the legend to Fig. 4) and after washing were exposed to
Fuji RX films.
|
|
DSY1041 was subjected to azole susceptibility tests and drug
accumulation experiments in parallel to DSY562 and DSY565. As
shown in
Fig.
8, the deletion of
CgCDR1
in DSY1041 had a significant
effect on the susceptibility to azoles.
DSY1041 could not grow
at drug concentrations permissive for DSY565 in
medium containing
fluconazole, itraconazole, or ketoconazole. DSY1041
was also more
susceptible to azole antifungal agents in this assay than
the
azole-susceptible isolate DSY562, as revealed by the difference
in
growth between both yeasts in the azole-containing YEPD medium
tested.
Since
CgCDR1 was still expressed in DSY562 as opposed
to
DSY1041, this result could, however, be expected. MICs of azole
antifungals for DSY1041 measured with the NCCLS standard protocol
in
RPMI medium were lower than those for DSY565 and were in the
range of
those measured for DSY562 (Table
4). We
noticed that
the MICs of fluconazole were lower for DSY1041 than for
DSY562,
when other incubation media were used, in particular YNB (data
not shown). Intracellular levels of fluconazole and rhodamine
6G were
restored in DSY1041 compared to those in DSY565 and reached
or exceeded
the levels found in DSY562. As shown in Table
3,
fluconazole
accumulation was increased by 5.6-fold in DSY1041
compared to that in
DSY565. The accumulation of rhodamine 6G in
DSY1041 was increased by a
factor of 16.5 compared to that in
DSY565 (Fig.
9). We also observed that the efflux of
rhodamine
6G in DSY1041 loaded with this substance was much reduced
compared
to that in DSY565 or DSY562 (data not shown). Taken together,
these results showed that the deletion of
CgCDR1 in the
azole-resistant
isolate DSY565 dramatically affected azole resistance
and drug
accumulation and thus support the idea that the expression of
CgCDR1 was the major cause of azole resistance in this
isolate.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 8.
Azole susceptibility of C. glabrata clinical
isolates and of CgCDR1 deletion mutant DSY1041. Yeast
strains were spotted in serial dilutions, as indicated, on YEPD medium
containing the drug at the corresponding concentration. Plates were
incubated at 30°C for 48 h.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 9.
Rhodamine 6G accumulation in C. glabrata
clinical isolates and the CgCDR1 deletion mutant DSY1041.
Cells were labelled with rhodamine 6G and analyzed by FACS as indicated
in Materials and Methods. FACS histograms are given for the unlabelled
control (DSY562) and for each yeast strain labelled with rhodamine 6G.
Mean values for fluorescence in DSY562, DSY565, and DSY1041 were 300, 47, and 780, respectively.
|
|
Rescue of fluconazole resistance phenotype by CgCDR1.
In
order to identify the nature of the mutation or mutations responsible
for the increase in CgCDR1 mRNA in the azole-resistant clinical isolate DSY565, CgCDR1 isolated from an
azole-susceptible C. glabrata strain was reintroduced in the
CgCDR1 deletion mutant DSY1053 (the ura3
derivative of DSY1041) with the help of a replicating vector. Since
2µm-derived vectors do not efficiently replicate in C. glabrata, pNB126, which contains CgCDR1 on a
2µm-based vector, was equipped with the CgCEN and
CgARS centromeric elements from C. glabrata, thus
enabling the replication of the resulting construction (pDS670) in a
single copy in C. glabrata (25). As shown in Fig. 10A, the presence of pDS670 in DSY1053
(DSY1717) restored the azole resistance phenotype. This phenotype was
followed by a 6.5-fold increase in CgCDR1 mRNA in DSY1717
(Fig. 10B). The same plasmid, pDS670, was used to transform DSY1067,
which is the ura3 derivative of DSY1033, a CgCDR1
deletion mutant derived from the azole-susceptible laboratory
strain DSY671 (61). The resulting strain, DSY1718, was as
susceptible as DSY671 (Fig. 10A). CgCDR1 mRNA levels in DSY1718 were 1.6-fold higher than those in DSY671 and thus were comparable (Fig. 10B). Taken together, these results suggest that the
higher CgCDR1 expression levels in DSY1717 should be the
consequence of a trans-acting mutation(s) rather than of a
cis-acting mutation or mutations on CgCDR1.
cis-acting mutations on CgCDR1 from DSY565 would have
been revealed if pDS670 had produced similar azole susceptibility and
similar CgCDR1 mRNA levels in both DSY1717 and DSY1718. The
results obtained in Fig. 10 reflect the pleiotropic drug resistance
phenomenon in S. cerevisiae, which is controlled by several
mutations of transcription factors acting in trans on
several ABC transporter genes (9).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 10.
Rescue of azole resistance by CgCDR1 in
CgCDR1 deletion mutants. (A) Azole susceptibility of
C. glabrata strains and mutants transformed with pDS670,
which contains CgCDR1, CgCEN, and
CgARS elements. Yeast strains were spotted in serial
dilutions, as indicated, onto YEPD medium with or without fluconazole
at the given concentration. Plates were incubated at 30°C for 48 h. (B) Northern blot analysis of C. glabrata strains and
CgCDR1 deletion mutants transformed with pDS670. Five
micrograms of total RNA from individual strains was loaded as
indicated. The CgCDR1 and CgURA3 probes are
described in Materials and Methods. Washed membranes were exposed to
Fuji RX films. mRNA signals were quantified as mentioned in the legend
to Fig. 4 and indicated that CgCDR1 levels of expression
were 8.3-fold and 6.5-fold higher in DSY565 and DSY1717, respectively,
than that in DSY562. CgCDR1 expression was 1.6-fold higher
in DSY1718 than in DSY671.
|
|
 |
DISCUSSION |
OPC represents one of the main mucosal infections in AIDS
patients. While C. albicans remains the principal agent of
OPC, C. glabrata is often recovered from clinical samples in
addition to C. albicans. Among 298 human immunodeficiency
virus-positive patients monitored in our institution for the occurrence
of OPC over a period of 4 years (1990 to 1994), approximately 30% had at least one C. glabrata-positive culture. In our
institution, C. glabrata was the second most frequent yeast
species recovered after C. albicans. Nguyen et al.
(34) also showed that C. glabrata has become the
second most frequent yeast species isolated from blood cultures of
patients with candidemia. This ranking has been confirmed by more
recent studies (39). Gleason et al. (18) reported
that C. glabrata was isolated significantly more frequently in patients treated with fluconazole in the surgical intensive care
unit of a university hospital. Vennewald et al. (59) noted in their mycological laboratory there was an increase in the occurrence of C. glabrata isolates from 0.5% in 1990 to 22.2% in
1996, mainly originating from high-risk patients in the intensive care
unit and the oncology ward. A recent study retrospectively reviewing medical records of patients with hematogenous candidiasis revealed a
relative decrease in C. albicans and C. tropicalis infections, but an increase in C. krusei and
C. glabrata infections (1). Fluconazole
prophylaxis was the single most important determinant for the relative
increase in C. krusei and C. glabrata infections. Similar shifts in yeast population favoring the increased appearance of
C. glabrata have been reported by others (22,
26). These trends suggest that C. glabrata is becoming
increasingly important, and due to the intrinsic low susceptibility of
this yeast to azole derivatives, the management of fungal diseases by
azole antifungals is rendered more difficult.
We describe here a mechanism of resistance to azole antifungals in two
distinct azole-resistant C. glabrata isolates from two
different AIDS patients with OPC. The C. glabrata strains used in this study were chosen on the basis of two criteria. First, two
pairs of isolates in which changes in azole susceptibility were
measured during fluconazole therapy were selected. Second, the isolates
of each pair were compared by two typing methods to verify their
relatedness. The isolates of the present study satisfied these
criteria. We observed retrospectively that the times that elapsed
between the recovery of the first azole-susceptible C. glabrata isolate and the azole-resistant isolate were not only short (47 versus 50 days) but were also similar in the two patients. Miyazaki et al. (32) in their investigations of azole
resistance in C. glabrata reported an elapsed time of 2 weeks between the sampling of azole-susceptible and the azole-resistant
isolates in one AIDS patient under fluconazole therapy. This feature
has been also noticed in our collection of C. glabrata
isolates and suggests rapid changes in azole susceptibility in C. glabrata strains exposed to azole antifungals. This observation
needs to be confirmed by other laboratories.
The preliminary experiments which helped us to determine the cause of
resistance in the azole-resistant C. glabrata isolates excluded changes of affinity to azoles in CYP51A1 and also eliminated alteration of sterol biosynthesis, since no differences in amphotericin B susceptibility between azole-susceptible and azole-resistant isolates
were measured. Failure of drug accumulation in the azole-resistant isolates was the remaining known mechanism and proved to be present in
both azole-resistant isolates. Drug accumulation studies were performed
with two different substances, [3H]fluconazole and
rhodamine 6G. Rhodamine 6G is a substrate for several ABC transporters
and has been used for efflux studies with intact S. cerevisiae cells through the convenient method of flow cytometry
(12, 13). The use of rhodamine 6G for measuring accumulation
differences by FACS analysis in the C. glabrata isolates of
this study has proved to be a very simple method which is much less
time-consuming than the method utilizing 3H-labelled
fluconazole. By the use of both substrates, not only could the cause of
reduced azole susceptibility in isolates DSY530 and DSY565 be explained
as a drug accumulation failure, but the nature of this process as an
effect due to multidrug transport could be determined as well. FACS
analysis of rhodamine 6G-labelled yeast cells can represent a rapid
method for the study of azole resistance in a large collection of
clinical isolates; however, this method first needs to be validated
with more azole-resistant isolates.
The functional cloning of azole resistance genes from C. glabrata greatly assisted the identification of genes involved in azole resistance in the clinical isolates. This strategy had been used
already for the cloning of similar genes in C. albicans and revealed six genes, among which CDR1, CDR2, and
C. albicans MDR1 were shown to be upregulated in
azole-resistant strains (50, 53). In this study, we could
identify three different C. glabrata azole resistance genes:
a transcription factor (CgYAP1), a multidrug transporter of
the major facilitator family (CgMDR1), and a multidrug transporter of the ABC transporter family (CgCDR1). Only the
transcription of CgCDR1 was increased in the azole-resistant
isolates examined in this study. This effect has also been observed in
at least 15 other azole-resistant C. glabrata isolates from
AIDS patients of our institution (47), thus suggesting that
this mechanism of resistance is common in C. glabrata.
Reports on the characterization of azole resistance in C. glabrata from other laboratories have pointed to a failure of drug
accumulation as a cause of resistance. Hitchcock et al.
(20), Parkinson et al. (38), and Miyazaki et al.
(32) reported differences of fluconazole accumulation in
azole-resistant C. glabrata isolates due to enhanced drug
efflux. Vanden Bossche et al. (56) documented as well a
reduced accumulation of fluconazole in another azole-resistant strain
as one of the causes of azole resistance. Reduced accumulation of
fluconazole in these isolates might have been due to the effect of
CgCDR1 upregulation. Other mechanisms of azole resistance
have been reported in C. glabrata: Marichal et al.
(31) measured an eightfold increase in ERG11 mRNA
in an azole-resistant C. glabrata isolate, paralleled by a
fourfold increase in gene copy number. Alterations in the ergosterol
biosynthesis pathway have not yet been detected in C. glabrata clinical strains. However, laboratory strains with altered sterol profiles have been constructed by deletion of the ERG3 and ERG11 genes (17). Only the
simultaneous deletion of both genes yielded mutants with azole and
amphotericin B resistance, the latter being consistent with the absence
of ergosterol in these cells. Thus, the pathway of azole resistance
involving ergosterol biosynthesis may be utilized in clinical strains,
but requires multiple gene alterations.
As mentioned above, another ABC transporter gene from C. glabrata called PDH1 has recently been isolated
(32). PDH1, which is distinct from
CgCDR1, was cloned by using PCR primers matching a consensus
in conserved elements among ABC transporters and not by functional
complementation as performed in this study. The function of
PDH1 as a multidrug transporter has not yet been
demonstrated, as opposed to CgCDR1, which is able to confer
resistance to multiple drugs when expressed in S. cerevisiae
(Fig. 3B). In the report of Miyazaki et al. (32),
PDH1 expression was increased between azole-susceptible and
azole-resistant C. glabrata isolates, as is the case here
for CgCDR1. What is the relevance of both ABC transporter
genes for the development of azole resistance in clinical C. glabrata isolates? In the light of our results, since the deletion of CgCDR1 in DSY565 rendered the mutant strain as
susceptible to azoles as the susceptible parent isolate (DSY562), it
indicates that PDH1 should play a moderate role in the azole
resistance of this isolate. This hypothesis is further validated by
Northern blot analysis, in which PDH1 mRNA signals were
absent in total RNA from DSY562 while present in DSY565, but with a
much reduced intensity compared to CgCDR1 mRNA signals
(46). PDH1 may, however, be expressed at higher
levels in other not-yet-investigated C. glabrata
azole-resistant strains, a possibility which remains to be tested. The
presence of multiple ABC transporter genes being coordinately
upregulated is a feature known in other azole-resistant yeasts, such as
C. albicans (50). CDR1 and
CDR2, which are two ABC transporter genes with high
similarity, are upregulated in azole-resistant isolates, while only
CDR1 expression is detected in azole-susceptible strains,
thus paralleling the properties of CgCDR1 and
PDH1.
The rescue of the azole resistance phenotype by CgCDR1 in
the ABC transporter mutant DSY1041 (Fig. 10) is an important result which will aid the further molecular characterization of the azole resistance mechanism in C. glabrata. By identifying
trans-acting factors rather than cis-acting
factors implicated in the upregulation of CgCDR1 in the
azole-resistant isolate DSY565, the role of transcription factors
regulating the expression of CgCDR1 becomes more relevant. The presence of putative Pdr1p and Pdr3p binding sites in the promoter
region of CgCDR1 suggests strongly that these types of transcription factors might operate in C. glabrata.
Interestingly, these binding sites have also been recognized in the
promoter region of PDH1 (32). The function of
Pdr1p and Pdr3p in S. cerevisiae has been well investigated
for the regulation of the ABC transporter gene PDR5. The
absence of Pdr1p and Pdr3p binding sites in the promoter of
PDR5 decreases the expression of this gene to almost undetectable levels (23). PDR1 and
PDR3 gain-of-function alleles have been reported in S. cerevisiae to confer hyperresistance to multiple drugs by
increasing the transcription of several target genes, among which is
the ABC transporter gene PDR5 (9, 36). A similar
situation may occur in C. glabrata. PDR1 and PDR3
homologues are likely to be present in C. glabrata, and
gain-of-function alleles of these genes could activate in
trans the expression of CgCDR1 or PDH1
in azole-resistant strains.
In summary, this study demonstrates for the first time that azole
resistance in clinical C. glabrata isolates is mediated by
the upregulation of an ABC transporter gene. It is likely that not-yet-characterized multidrug efflux transporters may participate in
this process, a hypothesis currently being addressed in our laboratory.
A study of the molecular mechanisms of resistance to azoles in C. glabrata is attractive not only because this yeast has become an
important human pathogen in recent years but also because recently
developed genetic tools allow the testing of different working hypotheses.
 |
ACKNOWLEDGMENTS |
We thank K. Kitada (Nipon Roche Ltd.) and D. Thiele for the gift
of plasmids and strains, D. Kaufmann and C. Durussel for assistance
with the medical records of patients and management of the yeast
collection database at the CHUV, and M. Monod for critical reading of
the manuscript.
This work was supported by a grant from the Swiss Research National
Foundation (no. 3100-045716) to D.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Microbiology, University Hospital Lausanne (CHUV), Rue de Bugnon 44, CH-1011 Lausanne, Switzerland. Phone: 0041 21 3144083. Fax: 0041 21 3144060. E-mail: Dominique.Sanglard{at}chuv.hospvd.ch.
 |
REFERENCES |
| 1.
|
Abisaid, D.,
E. Anaissie,
O. Uzun,
I. Raad,
H. Pinzcowski, and S. Vartivarian.
1997.
The epidemiology of hematogenous candidiasis caused by different Candida species.
Clin. Infect. Dis.
24:1122-1128[Medline].
|
| 2.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 3.
|
Albertson, G. D.,
M. Niimi,
R. D. Cannon, and H. F. Jenkinson.
1996.
Multiple efflux mechanisms are involved in Candida albicans fluconazole resistance.
Antimicrob. Agents Chemother.
40:2835-2841[Abstract].
|
| 4.
|
Arias, A.,
M. P. Arevalo,
A. Andreu,
C. Rodriguez, and A. Sierra.
1996.
Candida glabrata in vitro susceptibility of 84 isolates to eight antifungal agents.
Chemotherapy
42:107-111[Medline].
|
| 5.
|
Arif, S.,
T. Barkham,
E. G. Power, and S. A. Howell.
1996.
Techniques for investigation of an apparent outbreak of infections with Candida glabrata.
J. Clin. Microbiol.
34:2205-2209[Abstract].
|
| 6.
|
Barchiesi, F.,
D. Arzeni,
M. S. Delprete,
A. Sinicco,
L. F. Difrancesco,
M. B. Pasticci,
L. Lamura,
M. M. Nuzzo,
F. Burzacchini,
S. Coppola,
F. Chiodo, and G. Scalise.
1998.
Fluconazole susceptibility and strain variation of Candida albicans isolates from HIV-infected patients with oropharyngeal candidosis.
J. Antimicrob. Chemother.
41:541-548[Abstract/Free Full Text].
|
| 7.
|
Berrouane, Y. F.,
L. A. Herwaldt, and M. A. Pfaller.
1999.
Trends in antifungal use and epidemiology of nosocomial yeast infections in a university hospital.
J. Clin. Microbiol.
37:531-537[Abstract/Free Full Text].
|
| 8.
|
Bissinger, P. H., and K. Kuchler.
1994.
Molecular cloning and expression of the Saccharomyces cerevisiae STS1 gene product. A yeast ABC transporter conferring mycotoxin resistance.
J. Biol. Chem.
269:4180-4186[Abstract/Free Full Text].
|
| 9.
|
Carvajal, E.,
H. B. Van den Hazel,
A. Cybularz-Kolaczkowska,
E. Balzi, and A. Goffeau.
1997.
Molecular and phenotypic characterization of yeast PDR1 mutants that show hyperactive transcription of various ABC multidrug transporter genes.
Mol. Gen. Genet.
256:406-415[Medline].
|
| 10.
|
Chambers, S. P.,
S. E. Prior,
D. A. Barstow, and N. P. Minton.
1988.
The pMTL nic cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing.
Gene.
68:139-149[Medline].
|
| 11.
|
Cormican, M. G.,
R. J. Hollis, and M. A. Pfaller.
1996.
DNA macrorestriction profiles and antifungal susceptibility of Candida (Torulopsis) glabrata.
Diagn. Microbiol. Infect. Dis.
25:83-87[Medline].
|
| 12.
|
Decottignies, A.,
A. M. Grant,
J. W. Nichols,
H. de Wet,
D. B. McIntosh, and A. Goffeau.
1998.
ATPase and multidrug transport activities of the overexpressed yeast ABC protein Yor1p.
J. Biol. Chem.
273:12612-12622[Abstract/Free Full Text].
|
| 13.
|
Egner, R.,
F. E. Rosenthal,
A. Kralli,
D. Sanglard, and K. Kuchler.
1998.
Genetic separation of FK506 susceptibility and drug transport in the yeast PDR5 ATP-binding cassette multidrug resistance transporter.
Mol. Biol. Cell
9:523-543[Abstract/Free Full Text].
|
| 14.
|
Feinberg, A., and B. Vogelstein.
1984.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
137:266-267[Medline].
|
| 15.
|
Fidel, P. L., Jr.,
J. A. Vazquez, and J. D. Sobel.
1999.
Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans.
Clin. Microbiol. Rev.
12:80-96[Abstract/Free Full Text].
|
| 16.
|
Fortun, J.,
A. Lopez-San Roman,
J. J. Velasco,
A. Sanchez-Sousa,
E. Devicente,
J. Nuno,
C. Quereda,
R. Barcena,
G. Monge,
A. Candela,
A. Honrubia, and A. Guerrero.
1997.
Selection of Candida glabrata strains with reduced susceptibility to azoles in four liver transplant patients with invasive candidiasis.
Eur. J. Clin. Microbiol. Infect. Dis.
16:314-318[Medline].
|
| 17.
|
Geber, A.,
C. A. Hitchcock,
J. E. Swartz,
F. S. Pullen,
K. E. Marsden,
K. J. Kwon-Chung, and J. E. Bennett.
1995.
Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility.
Antimicrob. Agents Chemother.
39:2708-2717[Abstract].
|
| 18.
|
Gleason, T. G.,
A. K. May,
D. Caparelli,
B. M. Farr, and R. G. Sawyer.
1997.
Emerging evidence of selection of fluconazole-tolerant fungi in surgical intensive care units.
Arch. Surg.
132:1197-1201[Abstract/Free Full Text].
|
| 19.
|
Hanahan, D.
1985.
Techniques for transformation of E. coli, p. 109-135.
In
D. M. Glover (ed.), DNA cloning. A practical approach. IRL Press, Oxford, United Kingdom
|
| 20.
|
Hitchcock, C. A.,
G. W. Pye,
P. F. Troke,
E. M. Johnson, and D. W. Warnock.
1993.
Fluconazole resistance in Candida glabrata.
Antimicrob. Agents Chemother.
37:1962-1965[Abstract/Free Full Text].
|
| 21.
|
Johnson, E. M.,
D. W. Warnock,
J. Luker,
S. R. Porter, and C. Scully.
1995.
Emergence of azole drug resistance in Candida species from HIV-infected patients receiving prolonged fluconazole therapy for oral candidosis.
J. Antimicrob. Chemother.
35:103-114[Abstract/Free Full Text].
|
| 22.
|
Kaben, U.,
R. Blaschke-Hellmessen, and S. Hellwig.
1997.
Persistence and variability of yeast isolations from hospitalized patients a comparison of results from Rostock and Dresden, Germany.
Mycoses
40:421-423.
|
| 23.
|
Katzmann, D. J.,
T. C. Hallstrom,
Y. Mahe, and W. S. Moye-Rowley.
1996.
Multiple Pdr1p/Pdr3p binding sites are essential for normal expression of the ATP binding cassette transporter protein-encoding gene PDR5.
J. Biol. Chem.
271:23049-23054[Abstract/Free Full Text].
|
| 24.
|
Kelly, S. L.,
D. C. Lamb,
D. E. Kelly,
J. Loeffler, and H. Einsele.
1996.
Resistance to fluconazole and amphotericin in Candida albicans from AIDS patients.
Lancet
348:1523-1524[Medline].
|
| 25.
|
Kitada, K.,
E. Yamaguchi, and M. Arisawa.
1996.
Isolation of a Candida glabrata centromere and its use in construction of plasmid vectors.
Gene
175:105-108[Medline].
|
| 26.
|
Knoke, M.,
K. Schulz, and H. Bernhardt.
1997.
Dynamics of Candida isolations from humans from 1992-1995 in Greifswald, Germany.
Mycoses
40:105-110[Medline].
|
| 27.
|
Lamb, D. C.,
A. Corran,
B. C. Baldwin,
J. Kwon-Chung, and S. L. Kelly.
1995.
Resistant P45051A1 activity in azole antifungal tolerant Cryptococcus neoformans from AIDS patients.
FEBS Lett.
368:326-330[Medline].
|
| 28.
|
Law, D.,
C. B. Moore,
L. A. Joseph,
M. Keaney, and D. W. Denning.
1996.
High incidence of antifungal drug resistance in Candida tropicalis.
Int. J. Antimicrob. Agents
7:241-245[Medline].
|
| 29.
|
Lockhart, S. R.,
S. Joly,
C. Pujol,
J. D. Sobel,
M. A. Pfaller, and D. R. Soll.
1997.
Development and verification of fingerprinting probes for Candida glabrata.
Microbiology
143:3733-3746[Abstract/Free Full Text].
|
| 30.
|
Lopez-Ribot, J. L.,
R. K. McAtee,
L. N. Lee,
W. R. Kirkpatrick,
T. C. White,
D. Sanglard, and T. F. Patterson.
1998.
Distinct patterns of gene expression associated with development of fluconazole resistance in serial Candida albicans isolates from human immunodeficiency virus-infected patients with oropharyngeal candidiasis.
Antimicrob. Agents Chemother.
42:2932-2937[Abstract/Free Full Text].
|
| 31.
|
Marichal, P.,
H. Vanden Bossche,
F. C. Odds,
G. Nobels,
D. W. Warnock,
V. Timmerman,
C. Vanbroeckhoven,
S. Fay, and P. Mosel-Larsen.
1997.
Molecular biological characterization of an azole-resistant Candida glabrata isolate.
Antimicrob. Agents Chemother.
41:2229-2237[Abstract].
|
| 32.
|
Miyazaki, H.,
Y. Miyazaki,
A. Geber,
T. Parkinson,
C. Hitchcock,
D. J. Falconer,
D. J. Ward,
K. Marsden, and J. E. Bennett.
1998.
Fluconazole resistance associated with drug efflux and increased transcription of a drug transporter gene, PDH1, in Candida glabrata.
Antimicrob. Agents Chemother.
42:1695-1701[Abstract/Free Full Text].
|
| 33.
|
National Committee for Clinical Laboratory Standards.
1995.
Reference method for broth dilution antifungal susceptibility testing of yeast, vol. 12.
Tentative standard M27-A, National Committee for Clinical Laboratory Standards, Villanova, Pa.
|
| 34.
|
Nguyen, M. H.,
J. E. Peacock,
A. J. Morris,
D. C. Tanner,
M. L. Nguyen,
D. R. Snydman,
M. M. Wagener,
M. G. Rinaldi, and V. L. Yu.
1996.
The changing face of candidemia emergence of non-Candida albicans species and antifungal resistance.
Am. J. Med.
100:617-623[Medline].
|
| 35.
|
Nolte, F. S.,
T. Parkinson,
D. J. Falconer,
S. Dix,
J. Williams,
C. Gilmore,
R. Geller, and J. R. Wingard.
1997.
Isolation and characterization of fluconazole- and amphotericin B-resistant Candida albicans from blood of two patients with leukemia.
Antimicrob. Agents Chemother.
41:196-199[Abstract].
|
| 36.
|
Nourani, A.,
D. Papajova,
A. Delahodde,
C. Jacq, and J. Subik.
1997.
Clustered amino acid substitutions in the yeast transcription regulator Pdr3p increase pleiotropic drug resistance and identify a new central regulatory domain.
Mol. Gen. Genet.
256:397-405[Medline].
|
| 37.
|
Odds, F. C.
1996.
Resistance of clinically important yeasts to antifungal agents.
Int. J. Antimicrob. Agents
6:145-147.
|
| 38.
|
Parkinson, T.,
D. J. Falconer, and C. A. Hitchcock.
1995.
Fluconazole resistance due to energy-dependent drug efflux in Candida glabrata.
Antimicrob. Agents Chemother.
39:1696-1699[Abstract].
|
| 39.
|
Pfaller, M. A.,
R. N. Jones,
S. A. Messer,
M. B. Edmond, and R. P. Wenzel.
1998.
National surveillance of nosocomial blood stream infection due to species of Candida other than Candida albicans frequency of occurrence and antifungal susceptibility in the SCOPE program.
Diagn. Microbiol. Infect. Dis.
30:121-129[Medline].
|
| 40.
|
Pfaller, M. A.,
S. A. Messer,
A. Houston,
M. S. Rangelfrausto,
T. Wiblin,
H. M. Blumberg,
J. E. Edwards,
W. Jarvis,
M. A. Martin,
H. C. Neu,
L. Saiman,
J. E. Patterson,
J. C. Dibb,
C. M. Roldan,
M. G. Rinaldi, and R. P. Wenzel.
1998.
National epidemiology of mycoses survey a multicenter study of strain variation and antifungal susceptibility among isolates of Candida species.
Diagn. Microbiol. Infect. Dis.
31:289-296[Medline].
|
| 41.
|
Redding, S.,
J. Smith,
G. Farinacci,
M. Rinaldi,
A. Fothergill,
J. Rhinechalberg, and M. Pfaller.
1994.
Resistance of Candida albicans to fluconazole during treatment of oropharyngeal candidiasis in a patient with AIDS documentation by in vitro susceptibility testing and DNA subtype analysis.
Clin. Infect. Dis.
18:240-242[Medline].
|
| 42.
|
Rex, J. H.,
C. R. Cooper, Jr.,
W. G. Merz,
J. N. Galgiani, and E. J. Anaissie.
1995.
Detection of amphotericin B-resistant Candida isolates in a broth-based system.
Antimicrob. Agents Chemother.
39:906-909[Abstract].
|
| 43.
|
Rex, J. H.,
M. A. Pfaller,
A. L. Barry,
P. W. Nelson, and C. D. Webb.
1995.
Antifungal susceptibility testing of isolates from a randomized, multicenter trial of fluconazole versus amphotericin B as treatment of nonneutropenic patients with candidemia.
Antimicrob. Agents Chemother.
39:40-44[Abstract].
|
| 44.
|
Rex, J. H.,
M. A. Pfaller,
J. N. Galgiani,
M. S. Bartlett,
A. Espinel Ingroff,
M. A. Ghannoum,
M. Lancaster,
F. C. Odds,
M. G. Rinaldi,
T. J. Walsh, and A. L. Barry.
1997.
Development of interpretive breakpoints for antifungal susceptibility testing conceptual framework and analysis of in vitro in vivo correlation data for fluconazole, itraconazole, and Candida infections.
Clin. Infect. Dis.
24:235-247[Medline].
|
| 45.
|
Rex, J. H.,
M. G. Rinaldi, and M. A. Pfaller.
1995.
Resistance of Candida species to fluconazole.
Antimicrob. Agents Chemother.
39:1-8[Medline].
|
| 46.
| Sanglard, D. Unpublished data.
|
| 47.
| Sanglard, D., and D. Calabrese. Unpublished data.
|
| 48.
|
Sanglard, D.,
F. Ischer,
D. Calabrese,
M. De Micheli, and J. Bille.
1998.
Multiple resistance mechanisms to azole antifungals in yeast clinical isolates.
Drug Resist. Updates
1:255-265.
|
| 49.
|
Sanglard, D.,
F. Ischer,
L. Koymans, and J. Bille.
1998.
Amino acid substitutions in the cytochrome P-450 lanosterol 14 -demethylase (CYP51A1) from azole-resistant Candida albicans clinical isolates contribute to resistance to azole antifungal agents.
Antimicrob. Agents Chemother.
42:241-253[Abstract/Free Full Text].
|
| 50.
|
Sanglard, D.,
F. Ischer,
M. Monod, and J. Bille.
1997.
Cloning of Candida albicans genes conferring resistance to azole antifungal agents characterization of CDR2, a new multidrug ABC transporter gene.
Microbiology
143:405-416[Abstract/Free Full Text].
|
| 51.
|
Sanglard, D.,
F. Ischer,
M. Monod, and J. Bille.
1996.
Susceptibilities of Candida albicans multidrug transporter mutants to various antifungal agents and other metabolic inhibitors.
Antimicrob. Agents Chemother.
40:2300-2305[Abstract].
|
| 52.
|
Sanglard, D.,
F. Ischer, and J. Bille.
1997.
Isolation of Candida glabrata genes conferring resistance to azole antifungals and their involvement in the azole resistance of clinical isolates, abstr. C-10, p. 47.
In
Abstracts of the 37th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C.
|
| 53.
|
Sanglard, D.,
K. Kuchler,
F. Ischer,
J.-L. Pagani,
M. Monod, and J. Bille.
1995.
Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters.
Antimicrob. Agents Chemother.
39:2378-2386[Abstract].
|
| 54.
|
Troillet, N.,
C. Durussel,
J. Bille,
M. P. Glauser, and J. P. Chave.
1993.
Correlation between in vitro susceptibility of Candida albicans and fluconazole-resistant oropharyngeal candidiasis in HIV-infected patients.
Eur. J. Clin. Microbiol. Infect. Dis.
12:911-915[Medline].
|
| 55.
|
Vanden Bossche, H.,
F. Dromer,
I. Improvisi,
M. Lozanochiu,
J. H. Rex, and D. Sanglard.
1998.
Antifungal drug resistance in pathogenic fungi.
Med. Mycol.
36:119-128.
|
| 56.
|
Vanden Bossche, H.,
P. Marichal,
F. C. Odds,
L. Le Jeune, and M.-C. Coene.
1992.
Characterization of an azole-resistant Candida glabrata isolate.
Antimicrob. Agents Chemother.
36:2602-2610[Abstract/Free Full Text].
|
| 57.
|
Venkateswarlu, K.,
D. W. Denning, and S. L. Kelly.
1997.
Inhibition and interaction of cytochrome P450 of Candida krusei with azole antifungal drugs.
J. Med. Vet. Mycol.
35:19-25[Medline].
|
| 58.
|
Venkateswarlu, K.,
D. W. Denning,
N. J. Manning, and S. L. Kelly.
1996.
Reduced accumulation of drug in Candida krusei accounts for itraconazole resistance.
Antimicrob. Agents Chemother.
40:2443-2446[Abstract].
|
| 59.
|
Vennewald, I.,
C. Seebacher, and E. Roitzsch.
1998.
Post-mortem findings in patients with repeatedly mycological demonstration of Candida glabrata.
Mycoses
41:125-132[Medline].
|
| 60.
|
White, T. C.
1997.
Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus.
Antimicrob. Agents Chemother.
41:1482-1487[Abstract].
|
| 61.
|
Zhou, P. B.,
M. S. Szczypka,
R. Young, and D. J. Thiele.
1994.
A system for gene cloning and manipulation in the yeast Candida glabrata.
Gene
142:135-140[Medline].
|
Antimicrobial Agents and Chemotherapy, November 1999, p. 2753-2765, Vol. 43, No. 11
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pfaller, M. A., Messer, S. A., Hollis, R. J., Boyken, L., Tendolkar, S., Kroeger, J., Diekema, D. J.
(2009). Variation in Susceptibility of Bloodstream Isolates of Candida glabrata to Fluconazole According to Patient Age and Geographic Location in the United States in 2001 to 2007. J. Clin. Microbiol.
47: 3185-3190
[Abstract]
[Full Text]
-
Posteraro, B., Martucci, R., La Sorda, M., Fiori, B., Sanglard, D., De Carolis, E., Florio, A. R., Fadda, G., Sanguinetti, M.
(2009). Reliability of the Vitek 2 Yeast Susceptibility Test for Detection of In Vitro Resistance to Fluconazole and Voriconazole in Clinical Isolates of Candida albicans and Candida glabrata. J. Clin. Microbiol.
47: 1927-1930
[Abstract]
[Full Text]
-
Cannon, R. D., Lamping, E., Holmes, A. R., Niimi, K., Baret, P. V., Keniya, M. V., Tanabe, K., Niimi, M., Goffeau, A., Monk, B. C.
(2009). Efflux-Mediated Antifungal Drug Resistance. Clin. Microbiol. Rev.
22: 291-321
[Abstract]
[Full Text]
-
Tumbarello, M., Sanguinetti, M., Trecarichi, E. M., La Sorda, M., Rossi, M., de Carolis, E., de Gaetano Donati, K., Fadda, G., Cauda, R., Posteraro, B.
(2008). Fungaemia caused by Candida glabrata with reduced susceptibility to fluconazole due to altered gene expression: risk factors, antifungal treatment and outcome. J Antimicrob Chemother
62: 1379-1385
[Abstract]
[Full Text]
-
Gygax, S. E., Vermitsky, J.-P., Chadwick, S. G., Self, M. J., Zimmerman, J. A., Mordechai, E., Adelson, M. E., Trama, J. P.
(2008). Antifungal Resistance of Candida glabrata Vaginal Isolates and Development of a Quantitative Reverse Transcription-PCR-Based Azole Susceptibility Assay. Antimicrob. Agents Chemother.
52: 3424-3426
[Abstract]
[Full Text]
-
Vermitsky, J.-P., Self, M. J., Chadwick, S. G., Trama, J. P., Adelson, M. E., Mordechai, E., Gygax, S. E.
(2008). Survey of Vaginal-Flora Candida Species Isolates from Women of Different Age Groups by Use of Species-Specific PCR Detection. J. Clin. Microbiol.
46: 1501-1503
[Abstract]
[Full Text]
-
Pfaller, M. A., Messer, S. A., Boyken, L., Tendolkar, S., Hollis, R. J., Diekema, D. J.
(2008). Selection of a Surrogate Agent (Fluconazole or Voriconazole) for Initial Susceptibility Testing of Posaconazole against Candida spp.: Results from a Global Antifungal Surveillance Program. J. Clin. Microbiol.
46: 551-559
[Abstract]
[Full Text]
-
Shin, J. H., Chae, M. J., Song, J. W., Jung, S.-I., Cho, D., Kee, S. J., Kim, S. H., Shin, M. G., Suh, S. P., Ryang, D. W.
(2007). Changes in Karyotype and Azole Susceptibility of Sequential Bloodstream Isolates from Patients with Candida glabrata Candidemia. J. Clin. Microbiol.
45: 2385-2391
[Abstract]
[Full Text]
-
Li, L., Redding, S., Dongari-Bagtzoglou, A.
(2007). Candida glabrata, an Emerging Oral Opportunistic Pathogen. JDR
86: 204-215
[Abstract]
[Full Text]
-
Alexander, B. D., Byrne, T. C., Smith, K. L., Hanson, K. E., Anstrom, K. J., Perfect, J. R., Reller, L. B.
(2007). Comparative Evaluation of Etest and Sensititre YeastOne Panels against the Clinical and Laboratory Standards Institute M27-A2 Reference Broth Microdilution Method for Testing Candida Susceptibility to Seven Antifungal Agents. J. Clin. Microbiol.
45: 698-706
[Abstract]
[Full Text]
-
Ray, D., Goswami, R., Banerjee, U., Dadhwal, V., Goswami, D., Mandal, P., Sreenivas, V., Kochupillai, N.
(2007). Prevalence of Candida glabrata and Its Response to Boric Acid Vaginal Suppositories in Comparison With Oral Fluconazole in Patients With Diabetes and Vulvovaginal Candidiasis. Diabetes Care
30: 312-317
[Abstract]
[Full Text]
-
Rognon, B., Kozovska, Z., Coste, A. T., Pardini, G., Sanglard, D.
(2006). Identification of promoter elements responsible for the regulation of MDR1 from Candida albicans, a major facilitator transporter involved in azole resistance. Microbiology
152: 3701-3722
[Abstract]
[Full Text]
-
Posteraro, B., Tumbarello, M., La Sorda, M., Spanu, T., Trecarichi, E. M., De Bernardis, F., Scoppettuolo, G., Sanguinetti, M., Fadda, G.
(2006). Azole Resistance of Candida glabrata in a Case of Recurrent Fungemia.. J. Clin. Microbiol.
44: 3046-3047
[Abstract]
[Full Text]
-
Posteraro, B., Sanguinetti, M., Fiori, B., La Sorda, M., Spanu, T., Sanglard, D., Fadda, G.
(2006). Caspofungin activity against clinical isolates of azole cross-resistant Candida glabrata overexpressing efflux pump genes. J Antimicrob Chemother
58: 458-461
[Abstract]
[Full Text]
-
Pfaller, M. A., Diekema, D. J., Sheehan, D. J.
(2006). Interpretive Breakpoints for Fluconazole and Candida Revisited: a Blueprint for the Future of Antifungal Susceptibility Testing. Clin. Microbiol. Rev.
19: 435-447
[Abstract]
[Full Text]
-
Tsai, H.-F., Krol, A. A., Sarti, K. E., Bennett, J. E.
(2006). Candida glabrata PDR1, a Transcriptional Regulator of a Pleiotropic Drug Resistance Network, Mediates Azole Resistance in Clinical Isolates and Petite Mutants.. Antimicrob. Agents Chemother.
50: 1384-1392
[Abstract]
[Full Text]
-
Helmerhorst, E. J., Venuleo, C., Sanglard, D., Oppenheim, F. G.
(2006). Roles of Cellular Respiration, CgCDR1, and CgCDR2 in Candida glabrata Resistance to Histatin 5. Antimicrob. Agents Chemother.
50: 1100-1103
[Abstract]
[Full Text]
-
Sanguinetti, M., Posteraro, B., Fiori, B., Ranno, S., Torelli, R., Fadda, G.
(2005). Mechanisms of Azole Resistance in Clinical Isolates of Candida glabrata Collected during a Hospital Survey of Antifungal Resistance. Antimicrob. Agents Chemother.
49: 668-679
[Abstract]
[Full Text]
-
Borst, A., Raimer, M. T., Warnock, D. W., Morrison, C. J., Arthington-Skaggs, B. A.
(2005). Rapid Acquisition of Stable Azole Resistance by Candida glabrata Isolates Obtained before the Clinical Introduction of Fluconazole. Antimicrob. Agents Chemother.
49: 783-787
[Abstract]
[Full Text]
-
Wada, S.-i., Tanabe, K., Yamazaki, A., Niimi, M., Uehara, Y., Niimi, K., Lamping, E., Cannon, R. D., Monk, B. C.
(2005). Phosphorylation of Candida glabrata ATP-binding Cassette Transporter Cdr1p Regulates Drug Efflux Activity and ATPase Stability. J. Biol. Chem.
280: 94-103
[Abstract]
[Full Text]
-
Coste, A. T., Karababa, M., Ischer, F., Bille, J., Sanglard, D.
(2004). TAC1, Transcriptional Activator of CDR Genes, Is a New Transcription Factor Involved in the Regulation of Candida albicans ABC Transporters CDR1 and CDR2. Eukaryot Cell
3: 1639-1652
[Abstract]
[Full Text]
-
Vermitsky, J.-P., Edlind, T. D.
(2004). Azole Resistance in Candida glabrata: Coordinate Upregulation of Multidrug Transporters and Evidence for a Pdr1-Like Transcription Factor. Antimicrob. Agents Chemother.
48: 3773-3781
[Abstract]
[Full Text]
-
Pfaller, M. A., Diekema, D. J.
(2004). Rare and Emerging Opportunistic Fungal Pathogens: Concern for Resistance beyond Candida albicans and Aspergillus fumigatus. J. Clin. Microbiol.
42: 4419-4431
[Full Text]
-
Stoyan, T., Carbon, J.
(2004). Inner Kinetochore of the Pathogenic Yeast Candida glabrata. Eukaryot Cell
3: 1154-1163
[Abstract]
[Full Text]
-
Karababa, M., Coste, A. T., Rognon, B., Bille, J., Sanglard, D.
(2004). Comparison of Gene Expression Profiles of Candida albicans Azole-Resistant Clinical Isolates and Laboratory Strains Exposed to Drugs Inducing Multidrug Transporters. Antimicrob. Agents Chemother.
48: 3064-3079
[Abstract]
[Full Text]
-
Shukla, S., Ambudkar, S. V., Prasad, R.
(2004). Substitution of threonine-1351 in the multidrug transporter Cdr1p of Candida albicans results in hypersusceptibility to antifungal agents and threonine-1351 is essential for synergic effects of calcineurin inhibitor FK520. J Antimicrob Chemother
54: 38-45
[Abstract]
[Full Text]
-
Kaur, R., Castano, I., Cormack, B. P.
(2004). Functional Genomic Analysis of Fluconazole Susceptibility in the Pathogenic Yeast Candida glabrata: Roles of Calcium Signaling and Mitochondria. Antimicrob. Agents Chemother.
48: 1600-1613
[Abstract]
[Full Text]
-
Bennett, J. E., Izumikawa, K., Marr, K. A.
(2004). Mechanism of Increased Fluconazole Resistance in Candida glabrata during Prophylaxis. Antimicrob. Agents Chemother.
48: 1773-1777
[Abstract]
[Full Text]
-
Brun, S., Berges, T., Poupard, P., Vauzelle-Moreau, C., Renier, G., Chabasse, D., Bouchara, J.-P.
(2004). Mechanisms of Azole Resistance in Petite Mutants of Candida glabrata. Antimicrob. Agents Chemother.
48: 1788-1796
[Abstract]
[Full Text]
-
Niimi, K., Harding, D. R. K., Parshot, R., King, A., Lun, D. J., Decottignies, A., Niimi, M., Lin, S., Cannon, R. D., Goffeau, A., Monk, B. C.
(2004). Chemosensitization of Fluconazole Resistance in Saccharomyces cerevisiae and Pathogenic Fungi by a D-Octapeptide Derivative. Antimicrob. Agents Chemother.
48: 1256-1271
[Abstract]
[Full Text]
-
Pfaller, M. A., Messer, S. A., Boyken, L., Rice, C., Tendolkar, S., Hollis, R. J., Diekema, D. J.
(2003). Caspofungin Activity against Clinical Isolates of Fluconazole-Resistant Candida. J. Clin. Microbiol.
41: 5729-5731
[Abstract]
[Full Text]
-
Shukla, S., Saini, P., Smriti, , Jha, S., Ambudkar, S. V., Prasad, R.
(2003). Functional Characterization of Candida albicans ABC Transporter Cdr1p. Eukaryot Cell
2: 1361-1375
[Abstract]
[Full Text]
-
Pinjon, E., Moran, G. P., Jackson, C. J., Kelly, S. L., Sanglard, D., Coleman, D. C., Sullivan, D. J.
(2003). Molecular Mechanisms of Itraconazole Resistance in Candida dubliniensis. Antimicrob. Agents Chemother.
47: 2424-2437
[Abstract]
[Full Text]
-
Nascimento, A. M., Goldman, G. H., Park, S., Marras, S. A. E., Delmas, G., Oza, U., Lolans, K., Dudley, M. N., Mann, P. A., Perlin, D. S.
(2003). Multiple Resistance Mechanisms among Aspergillus fumigatus Mutants with High-Level Resistance to Itraconazole. Antimicrob. Agents Chemother.
47: 1719-1726
[Abstract]
[Full Text]
-
Pfaller, M. A., Messer, S. A., Boyken, L., Tendolkar, S., Hollis, R. J., Diekema, D. J.
(2003). Variation in Susceptibility of Bloodstream Isolates of Candida glabrata to Fluconazole According to Patient Age and Geographic Location. J. Clin. Microbiol.
41: 2176-2179
[Abstract]
[Full Text]
-
Castano, I., Kaur, R., Pan, S., Cregg, R., Penas, A. D. L., Guo, N., Biery, M. C., Craig, N. L., Cormack, B. P.
(2003). Tn7-Based Genome-Wide Random Insertional Mutagenesis of Candida glabrata. Genome Res
13: 905-915
[Abstract]
[Full Text]
-
Redding, S. W., Kirkpatrick, W. R., Saville, S., Coco, B. J., White, W., Fothergill, A., Rinaldi, M., Eng, T., Patterson, T. F., Lopez-Ribot, J.
(2003). Multiple Patterns of Resistance to Fluconazole in Candida glabrata Isolates from a Patient with Oropharyngeal Candidiasis Receiving Head and Neck Radiation. J. Clin. Microbiol.
41: 619-622
[Abstract]
[Full Text]
-
Wada, S.-i., Niimi, M., Niimi, K., Holmes, A. R., Monk, B. C., Cannon, R. D., Uehara, Y.
(2002). Candida glabrata ATP-binding Cassette Transporters Cdr1p and Pdh1p Expressed in a Saccharomyces cerevisiae Strain Deficient in Membrane Transporters Show Phosphorylation-dependent Pumping Properties. J. Biol. Chem.
277: 46809-46821
[Abstract]
[Full Text]
-
Moran, G., Sullivan, D., Morschhauser, J., Coleman, D.
(2002). The Candida dubliniensis CdCDR1 Gene Is Not Essential for Fluconazole Resistance. Antimicrob. Agents Chemother.
46: 2829-2841
[Abstract]
[Full Text]
-
Lachke, S. A., Joly, S., Daniels, K., Soll, D. R.
(2002). Phenotypic switching and filamentation in Candida glabrata. Microbiology
148: 2661-2674
[Abstract]
[Full Text]
-
Nakayama, H., Nakayama, N., Arisawa, M., Aoki, Y.
(2001). In Vitro and In Vivo Effects of 14alpha -Demethylase (ERG11) Depletion in Candida glabrata. Antimicrob. Agents Chemother.
45: 3037-3045
[Abstract]
[Full Text]
-
Stoyan, T., Gloeckner, G., Diekmann, S., Carbon, J.
(2001). Multifunctional Centromere Binding Factor 1 Is Essential for Chromosome Segregation in the Human Pathogenic Yeast Candida glabrata. Mol. Cell. Biol.
21: 4875-4888
[Abstract]
[Full Text]
-
Sanglard, D., Ischer, F., Bille, J.
(2001). Role of ATP-Binding-Cassette Transporter Genes in High-Frequency Acquisition of Resistance to Azole Antifungals in Candida glabrata. Antimicrob. Agents Chemother.
45: 1174-1183
[Abstract]
[Full Text]
-
Calabrese, D., Bille, J., Sanglard, D.
(2000). A novel multidrug efflux transporter gene of the major facilitator superfamily from Candida albicans (FLU1) conferring resistance to fluconazole. Microbiology
146: 2743-2754
[Abstract]
[Full Text]