Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 1999, p. 2960-2963, Vol. 43, No. 12
Infectious Disease Discovery Research,
Wyeth-Ayerst Research, Pearl River, New York 10965
Received 10 May 1999/Returned for modification 22 July
1999/Accepted 21 September 1999
Genes encoding SHV-1 and SHV-2 were sequenced by different methods.
Nucleotide sequencing of the coding strand by standard dideoxy-chain
termination methods resulted in errors in the interpretation of the
nucleotide sequence and the derived amino acid sequence in two main
regions which corresponded to nucleotide and amino acid changes that
had been reported previously. The automated thermal cycling method was
clearly superior and consistently resulted in the correct sequences for
these genes.
SHV
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Automated Thermal Cycling Is Superior to
Traditional Methods for Nucleotide Sequencing of
blaSHV Genes
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
-lactamases confer resistance
to a broad spectrum of -lactam antibiotics and are of great
therapeutic concern for infections caused by many species of the family
Enterobacteriaceae. SHV-1, the original member of the SHV
-lactamase family, is present in most strains of Klebsiella
pneumoniae and may be either chromosomally or plasmid mediated. A
plasmid-mediated SHV-1 is also commonly found in Escherichia
coli and is seen in other genera as well. The first
extended-spectrum -lactamase to be described was an SHV-type enzyme
that differed from the SHV-1 amino acid sequence by a single residue
and was subsequently designated SHV-2 (10). Since that time,
at least 12 SHV-type derivatives have been described. The various
derivatives of SHV-type -lactamases differ from SHV-1 by amino acid
substitutions at only a few amino acid residues (Table
1). From the beginning of the study of
the SHV-type enzymes, there has been confusion about the amino acid
sequence of some of the SHV derivatives. There have been a number of
sequences reported that have amino acid deletions or additions in
portions of the SHV protein that are usually conserved (11, 17,
18). In addition, the amino acid sequence derived from the
nucleotide sequence published by Mercier et al. for SHV-1 differs from
those that were obtained by direct amino acid sequencing of the protein (4).
TABLE 1.
Comparison of amino acid sequences of SHV derivatives
During a previous sequencing project involving an SHV-type
extended-spectrum -lactamase, it was noted that when nucleotide sequencing was performed by traditional dideoxy-chain termination methods, the sequencing gels contained a large number of areas of
compressions that were difficult to read (7). It was
observed that some of these compressions occurred in the exact
locations where the amino acid additions or deletions had been reported previously by other investigators. It was theorized that the confusion among various blaSHV sequences occurred because
of the difficulty in interpretation of the DNA sequence. Therefore, a
study was done to attempt to resolve the differences seen with the
various reported sequences of SHV derivatives and to evaluate the
sequencing methodologies.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Bacterial strains.
The bacterial strain used for the
sequencing of SHV-1 by traditional dideoxy-chain termination methods
was E. coli DH5
(pCLL3411) (7). The strains
used for automated thermal cycle sequencing were PCR clones generated
from E. coli HB101(pMON 38) expressing SHV-1 (11)
and JC2926(pBP60-1) expressing SHV-2 (10) (kindly provided
by George A. Jacoby.)
Nucleic acid techniques. To generate the clones used in the thermal cycling experiments, the SHV genes were first amplified by PCR by standard methods (20). The primers used were as follows: forward, 5'GTATTGAATTCATGCGTTATATTCGCCTGTGTA3'; and reverse, 5'CAGAATTCGGCTAGCGTTGCCAGTGCTCGAT3'. The primers were designed to flank the start and stop codons of the blaSHV-1 gene to amplify the entire coding region. The resulting PCR products were cloned into pCR 2.1-TOPO by using the TOPO TA cloning kit (Invitrogen, Carlsbad, Calif.). Clones from three independent PCRs were generated and sequenced.
DNA sequencing was performed on double-stranded plasmid DNA by several methods. Both strands of the entire SHV-1 gene on pCLL3411 were sequenced by traditional sequencing methods with a nested set of primers identical to and complementary to the blaSHV-1 coding sequence. These were selected so that they did not anneal to regions of the gene corresponding to base pair changes associated with previously determined extended-spectrum SHV gene DNA sequences. The oligonucleotide primers used in traditional sequencing reactions were as follows: SHV-F1, 5'CGGCCCTCACTCAAGGATG3' SHV-F2, 5'GGGTGGATGCCGGTGACG3' SHV-F3, 5'CCGCTGGGAAACGGAACTG3' SHV-F4, 5'GGGATTGTCGCCCTGCTTGG3' SHV-R1, 5'GCGGCTGCGGGCTGGCGTG3' SHV-R2, 5'CCTGCGGGGCCGCCGACGG3' SHV-R3, 5'CCACTGCAGCAGCTGCCG3' SHV-R4, 5'GCACGGAGCGGATCAACGG3' SHV-R5, 5'CGCCCGGCACGCTGCGAGG3' Traditional dideoxy-chain termination sequencing was performed with a Sequenase kit (United States Biochemicals, Cleveland, Ohio) with 35S-dATP label (Amersham, Arlington Heights, Ill.) according to the manufacturer's instructions (23). The Sequenase kit was used with three different nucleotide triphosphate mixtures containing dGTP, dITP, or 7-deaza-dGTP. Thermal cycle sequencing reactions of PCR-cloned blaSHV-1 and blaSHV-2 genes were performed according to the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA polymerase, FS (Applied Biosystems, Inc., Foster City, Calif.), according to the manufacturer's instructions (22). The cycle sequencing reaction was performed with GeneAmp PCR system 9600 (ABI-PE), also according to the protocol. Spin columns were employed to remove unincorporated dye-labeled nucleotides after cycle sequencing. Automated DNA sequencing-grade 4.75% polyacrylamide gels were run for DNA sequencing samples by using ABI 373 DNA sequencers.Nucleotide sequence accession number. The nucleotide sequence data for blaSHV-1 and blaSHV-2 determined in this study are listed in GenBank under accession no. AF148850 and AF148851, respectively.
| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
The nucleotide sequence obtained by traditional dideoxy-chain termination with blaSHV-1 resulted in numerous compressions on the sequencing film. Interestingly, two of these areas of compression were found in regions of the blaSHV-1 gene sequence that corresponded to amino acid substitutions noted in previously published reports (11, 17, 18). As shown in Fig. 1 and 2, the nucleotides comprising the codon for amino acid 54 appeared to be absent when a sequencing film was examined visually. This apparent deletion of glycine 54 was reported in several SHV-type sequences (17, 18). However, these nucleotides were present when the sequence was determined for the noncoding strand or when the sequence was generated by the automated thermal cycling method.
|
|
For some of the areas, the observed compressions gave different results on individual testing days (Fig. 3). For example, nucleotides encoding amino acids 187 to 189 were quite different, depending on the day of the test. These differences could be due to variations in individual sequencing reactions or the resolving capabilities of individual gels. Furthermore, this area of discrepancy was not resolved by sequencing the noncoding strand. However, the correct sequence was obtained by substitution of dITP or 7-deaza-dGTP for dGTP in the sequencing reaction by the dideoxy-chain termination method. The correct sequence was also obtained by automated thermal cycling.
|
Amino acid substitutions of Lys192Asn and Leu193Val have been described by several investigators (11, 17, 18). In addition, these investigators reported the addition of a glycine residue between amino acids 193 and 194. As shown in Fig. 3, every time that sequencing was performed by dideoxy-chain termination on the coding strand of DNA, the resultant amino acid sequence was this exact combination of derived amino acids (Lys192Asn, Leu193Val, and the addition of glycine between residues 193 and 194). However, if nucleotide sequencing was performed with the noncoding strand, by substituting dITP or 7-deaza-dGTP for GTP, or by automated sequencing methods, the derived amino acid sequence was identical to that obtained by protein sequencing of SHV-1 (4). The latter sequence appears to be completely conserved for this region of the protein among all of the other reported sequences for SHV derivatives (Table 1).
This study indicates that errors in sequences for SHV-type derivatives can easily arise due to a common difficulty in reading films generated by the dideoxy-chain termination method. These errors have been shown to result in the deletion of an amino acid residue at position 54, the addition of a residue between amino acids 193 and 194, and substitutions at positions 192 and 193. Many of these compressions were particularly insidious, because to the eye they did not appear to be the usual G-C-type compressions, in that it was not inherently obvious that a compression had occurred. Only after sequencing the noncoding strand or by using an alternative deoxynucleotide triphosphate for dGTP in the sequencing reactions did the discrepancy come to light. It must be noted, however, that the sequencing of the noncoding strand and the use of the alternative deoxynucleotide triphosphates dITP and 7-deaza-dGTP introduced compressions and tended to introduce ambiguity at other locations (data not shown). Therefore, it is essential that one or more of the methods used to resolve the sequence for the dideoxy-chain termination method be used in conjunction with the original forward sequencing method.
In this study, the automated thermal cycling method consistently
produced results that were in line with the consensus for blaSHV gene sequences. The
blaSHV genes are more G-C rich (G+C content = 61%) than other class A -lactamases (G+C content = 49, 41, and 50% for blaTEM-1,
blaPSE-1, and blaOXA-1,
respectively). The large amount of guanine and cytosine residues found
in blaSHV-1 accounts for the increased number of
compressions that were observed in traditional sequencing methods. The
automated system uses a thermal cycling reaction that melts the DNA
molecule during the sequencing reaction, thereby reducing the number
and/or the severity of compressions that occur with more standard
sequencing methods. This problem would not be unique to the T7 DNA
polymerase found in the Sequenase kit, but would be common to all
polymerases that work at low temperatures.
The results of this study show that the sequencing of genes encoding
SHV-type -lactamases is not as straightforward as the sequencing of
other -lactamase genes. It has been demonstrated that sequencing
errors may be reported if only the forward sequencing reaction of
manual methods is performed. Therefore, at the very least, it is
essential to sequence both strands of the blaSHV gene, although not all of the discrepancies were resolved by sequencing the noncoding strand.
| |
ACKNOWLEDGMENTS |
|---|
I thank Eric Beer for excellent technical assistance with the automated sequencing, Tim Murphy for help with photography, and Steven J. Projan for critical review of the manuscript.
| |
FOOTNOTES |
|---|
* Mailing address: Wyeth-Ayerst Research, 401 N. Middletown Rd., Pearl River, NY 10965. Phone: (914) 732-4396. Fax: (914) 732-5671. E-mail: bradfop{at}war.wyeth.com.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
| 1. |
Ambler, R. P.,
A. F. W. Coulson,
J.-M. Frére,
J.-M. Ghuysen,
B. Joris,
M. Forsman,
R. C. Levesque,
G. Tiraby, and S. G. Waley.
1991.
A standard numbering scheme for the class A -lactamases.
Biochem. J.
276:269-270.
|
| 2. |
Arakawa, Y.,
M. Ohta,
N. Kido,
Y. Fujii,
T. Komatsu, and N. Kato.
1986.
Close evolutionary relationship between the chromosomally encoded -lactamase gene of Klebsiella pneumoniae and the TEM -lactamase gene mediated by R plasmids.
FEBS Lett.
207:69-74[Medline].
|
| 3. |
Arlet, G.,
M. Rouveau, and A. Philippon.
1997.
Substitution of alanine for aspartate at position 179 in the SHV-6 extended-spectrum -lactamase.
FEMS Microbiol. Lett.
152:163-167[Medline].
|
| 4. |
Barthélémy, M.,
J. Peduzzi, and R. Labia.
1988.
Complete amino acid sequence of p453-plasmid-mediated PIT-2 -lactamase (SHV-1).
Biochem. J.
251:73-79[Medline].
|
| 5. |
Barthélémy, M.,
J. Péduzzi,
H. B. Yaghlane, and R. Labia.
1988.
Single amino acid substitution between SHV-1 -lactamase and cefotaxime-hydrolyzing SHV-2 enzyme.
FEBS Lett.
231:217-220[Medline].
|
| 6. |
Billot-Klein, D.,
L. Gutmann, and E. Collatz.
1990.
Nucleotide sequence of the SHV-5 -lactamase gene of a Klebsiella pneumoniae plasmid.
Antimicrob. Agents Chemother.
34:2439-2441 |
| 7. |
Bradford, P. A.,
C. Urban,
A. Jaiswal,
N. Mariano,
B. A. Rasmussen,
S. J. Projan,
J. J. Rahal, and K. Bush.
1995.
SHV-7, a novel cefotaxime-hydrolyzing -lactamase, identified in Escherichia coli isolates from hospitalized nursing home patients.
Antimicrob. Agents Chemother.
39:899-905[Abstract].
|
| 8. |
Garbarg-Chenon, A.,
V. Godard,
R. Labia, and J.-C. Nicolas.
1990.
Nucleotide sequence of SHV-2 -lactamase gene.
Antimicrob. Agents Chemother.
34:1444-1446 |
| 9. |
Huletsky, A.,
F. Couture, and R. C. Levesque.
1990.
Nucleotide sequence and phylogeny of SHV-2 -lactamase.
Antimicrob. Agents Chemother.
34:1725-1732 |
| 9a. | Jacoby, G., and K. Bush. 1999. Amino acid sequences
for TEM, SHV and OXA extended-spectrum and inhibitor resistant
-lactamases. [Online.] http://www.lahey.org/studies/webt.htm SHV.
[1 November 1999, last date accessed.]
|
| 10. |
Kliebe, C.,
B. A. Nies,
J. F. Meyer,
R. M. Tolxdorff-Neutzling, and B. Wiedemann.
1985.
Evolution of plasmid-coded resistance to broad-spectrum cephalosporins.
Antimicrob. Agents Chemother.
28:302-307 |
| 11. |
Mercier, J., and R. C. Levesque.
1990.
Cloning of SHV-2, OHIO-1, and OXA-6 -lactamases and cloning and sequencing of SHV-1 -lactamase.
Antimicrob. Agents Chemother.
34:1577-1583 |
| 12. |
Nicolas, M.-H.,
V. Jarlier,
N. Honore,
A. Philippon, and S. T. Cole.
1989.
Molecular characterization of the gene encoding SHV-3 -lactamase responsible for transferable cefotaxime resistance in clinical isolates of Klebsiella pneumoniae.
Antimicrob. Agents Chemother.
33:2096-2100 |
| 13. |
Nüesch-Inderbinen, M. T.,
F. H. Kayser, and H. Hächler.
1997.
Survey and molecular genetics of SHV--lactamases in Enterobacteriaceae in Switzerland: two novel enzymes, SHV-11 and SHV-12.
Antimicrob. Agents Chemother.
41:943-949[Abstract].
|
| 14. |
Péduzzi, J.,
M. Barthélémy,
K. Tiwari,
D. Mattioni, and R. Labia.
1989.
Structural features related to hydrolytic activity against ceftazidime of plasmid-mediated SHV-type CAZ-5 -lactamase.
Antimicrob. Agents Chemother.
33:2160-2163 |
| 15. |
Podbielski, A., and B. Melzer.
1990.
Nucleotide sequence of the gene encoding the SHV-2 -lactamase (blaSHV-2) of Klebsiella ozaenae.
Nucleic Acids Res.
18:4916 |
| 16. |
Podbielski, A.,
J. Schönling,
B. Melzer,
K. Warnatz, and H.-G. Leusch.
1991.
Molecular characterization of a new plasmid-encoded SHV-type -lactamase (SHV-2 variant) conferring high-level cefotaxime resistance upon Klebsiella pneumoniae.
J. Gen. Microbiol.
137:569-578 |
| 17. |
Prinarakis, E. E.,
V. Miriagou,
E. Tzelepi,
M. Gazouli, and L. S. Tzouvelekis.
1997.
Emergence of an inhibitor-resistant -lactamase (SHV-10) derived from an SHV-5 variant.
Antimicrob. Agents Chemother.
41:838-840[Abstract].
|
| 18. |
Prinarakis, E. E.,
E. Tzelepi,
M. Gazouli,
A. F. Mentis, and L. S. Tzouvelekis.
1996.
Characterization of a novel SHV -lactamase variant that resembles the SHV-5 enzyme.
FEMS Microbiol. Lett.
139:229-234[Medline].
|
| 19. |
Rasheed, J. K.,
C. Jay,
B. Metchock,
F. Berkowitz,
L. Weigel,
J. Crellin,
C. Steward,
B. Hill,
A. A. Medeiros, and F. C. Tenover.
1997.
Evolution of extended-spectrum -lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia.
Antimicrob. Agents Chemother.
41:647-653[Abstract].
|
| 20. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 21. |
Shlaes, D. M.,
C. Currie-McCumber,
A. Hull,
I. Behlau, and M. Kron.
1990.
OHIO-1 -lactamase is part of the SHV-1 family.
Antimicrob. Agents Chemother.
34:1570-1576 |
| 22. | Spurgeon, S. L., S. Chen, and S. Koepf. 1996. Improvements in dye primer and dye terminator sequencing with AmpliTaq DNA polymerase, FS. Microb. Comp. Genomics 1:254-255. |
| 23. |
Tabor, S., and C. C. Richardson.
1987.
DNA sequence analysis with a modified bacteriophage T7 DNA polymerase.
Proc. Natl. Acad. Sci. USA
84:4767-4771 |
Antimicrobial Agents and Chemotherapy, December 1999, p. 2960-2963, Vol. 43, No. 12
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dubois, V., Poirel, L., Demarthe, F., Arpin, C., Coulange, L., Minarini, L. A. R., Bezian, M.-C., Nordmann, P., Quentin, C.
(2008). Molecular and Biochemical Characterization of SHV-56, a Novel Inhibitor-Resistant {beta}-Lactamase from Klebsiella pneumoniae. Antimicrob. Agents Chemother.
52: 3792-3794
[Abstract] [Full Text] -
Spanu, T., Sanguinetti, M., Tumbarello, M., D'Inzeo, T., Fiori, B., Posteraro, B., Santangelo, R., Cauda, R., Fadda, G.
(2006). Evaluation of the New VITEK 2 Extended-Spectrum Beta-Lactamase (ESBL) Test for Rapid Detection of ESBL Production in Enterobacteriaceae Isolates.. J. Clin. Microbiol.
44: 3257-3262
[Abstract] [Full Text] -
al Naiemi, N., Schipper, K., Duim, B., Bart, A.
(2006). Application of Minimal Sequence Quality Values Prevents Misidentification of the blaSHV Type in Single Bacterial Isolates Carrying Different SHV Extended-Spectrum {beta}-Lactamase Genes.. J. Clin. Microbiol.
44: 1896-1898
[Abstract] [Full Text] -
Sturenburg, E., Storm, N., Sobottka, I., Horstkotte, M. A., Scherpe, S., Aepfelbacher, M., Muller, S.
(2006). Detection and Genotyping of SHV {beta}-Lactamase Variants by Mass Spectrometry after Base-Specific Cleavage of In Vitro-Generated RNA Transcripts.. J. Clin. Microbiol.
44: 909-915
[Abstract] [Full Text] -
Gangoue-Pieboji, J., Bedenic, B., Koulla-Shiro, S., Randegger, C., Adiogo, D., Ngassam, P., Ndumbe, P., Hachler, H.
(2005). Extended-Spectrum-{beta}-Lactamase-Producing Enterobacteriaceae in Yaounde, Cameroon. J. Clin. Microbiol.
43: 3273-3277
[Abstract] [Full Text] -
Dubois, V., Poirel, L., Arpin, C., Coulange, L., Bebear, C., Nordmann, P., Quentin, C.
(2004). SHV-49, a Novel Inhibitor-Resistant {beta}-Lactamase in a Clinical Isolate of Klebsiella pneumoniae. Antimicrob. Agents Chemother.
48: 4466-4469
[Abstract] [Full Text] -
Leverstein-van Hall, M. A., Fluit, A. C., Paauw, A., Box, A. T. A., Brisse, S., Verhoef, J.
(2002). Evaluation of the Etest ESBL and the BD Phoenix, VITEK 1, and VITEK 2 Automated Instruments for Detection of Extended-Spectrum Beta-Lactamases in Multiresistant Escherichia coli and Klebsiella spp.. J. Clin. Microbiol.
40: 3703-3711
[Abstract] [Full Text] -
Dubois, V., Poirel, L., Marie, C., Arpin, C., Nordmann, P., Quentin, C.
(2002). Molecular Characterization of a Novel Class 1 Integron Containing blaGES-1 and a Fused Product of aac(3)-Ib/aac(6"")-Ib"" Gene Cassettes in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.
46: 638-645
[Abstract] [Full Text] -
Bradford, P. A.
(2001). Extended-Spectrum {beta}-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clin. Microbiol. Rev.
14: 933-951
[Abstract] [Full Text] -
Chaves, J., Ladona, M. G., Segura, C., Coira, A., Reig, R., Ampurdanes, C.
(2001). SHV-1 {beta}-Lactamase Is Mainly a Chromosomally Encoded Species-Specific Enzyme in Klebsiella pneumoniae. Antimicrob. Agents Chemother.
45: 2856-2861
[Abstract] [Full Text] -
Rasheed, J. K., Anderson, G. J., Yigit, H., Queenan, A. M., Doménech-Sánchez, A., Swenson, J. M., Biddle, J. W., Ferraro, M. J., Jacoby, G. A., Tenover, F. C.
(2000). Characterization of the Extended-Spectrum beta -Lactamase Reference Strain, Klebsiella pneumoniae K6 (ATCC 700603), Which Produces the Novel Enzyme SHV-18. Antimicrob. Agents Chemother.
44: 2382-2388
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»