This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billman-Jacobe, H.
Right arrow Articles by Coppel, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billman-Jacobe, H.
Right arrow Articles by Coppel, R. L.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, December 1999, p. 3011-3013, Vol. 43, No. 12
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Characterization of a Mycobacterium smegmatis Mutant Lacking Penicillin Binding Protein 1

Helen Billman-Jacobe,* Ruth E. Haites, and Ross L. Coppel

Department of Microbiology, Monash University, Clayton, Victoria 3168, Australia

Received 19 July 1999/Returned for modification 24 August 1999/Accepted 23 September 1999


    ABSTRACT
Top
Abstract
Text
References

The ponA gene of Mycobacterium smegmatis encodes a 95-kDa penicillin binding protein, PBP1, that is similar to PBP1s of Mycobacterium tuberculosis and Mycobacterium leprae. Transposon disruption of ponA in M. smegmatis resulted in a PBP1-deficient mutant that was sensitive to beta -lactam antibiotics, was more permeable to glycine, and grew slowly in liquid culture.


    TEXT
Top
Abstract
Text
References

Most bacteria have several penicillin binding proteins (PBPs) that catalyze the final steps of peptidoglycan synthesis. In Escherichia coli PBP1a (encoded by ponA) and PBP1b (encoded by ponB) are similar high-molecular-weight (HMW) class A PBPs possessing transglycosylase and transpeptidase activities. E. coli can tolerate inactivation of either ponA or ponB without any significant phenotypic changes, but disruption of both is lethal (13). Both Mycobacterium leprae and Mycobacterium tuberculosis have pairs of genes encoding putative HMW class A PBP1s. In M. tuberculosis the genes are denoted ponA1 and ponA2 (4), while in M. leprae they are denoted ponA (2) and pon1* (8). We identified a ponA gene of Mycobacterium smegmatis that encodes a PBP1 and have characterized a mutant whose ponA was disrupted by transposon mutagenesis.

M. smegmatis mc2155 transposon mutants (3) were grown on media containing azocarmine to screen for mutants that had cell permeability defects. One mutant, designated MUT1, stained intensely and was tested for antibiotic sensitivity. The MICs were determined by an agar dilution method. MUT1 was markedly more sensitive to beta -lactam antibiotics than the parental strain; however, it had normal levels of sensitivity to the other antibiotics tested (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   MICs of antimicrobial agents for M. smegmatis mc2155 and mutants MUT1 and MUT2

beta -Lactam antibiotics covalently bind and inactivate PBPs, resulting in cell death. M. smegmatis is naturally resistant to beta -lactam antibiotics. beta -Lactam sensitivity in MUT1 may result from increased cell penetration, loss of beta -lactamase activity, or alteration of the target PBPs. The beta -lactamase activity in cell lysates was determined by monitoring the rate of hydrolysis of the chromogenic cephalosporin nitrocefin (6). Assays were done three times in duplicate. The levels of beta -lactamase activity were equivalent in mc2155 (0.291 ± 0.035 µmol/min/mg [mean ± standard deviation]) and MUT1 (0.273 ± 0.035 µmol/min/mg); therefore, beta -lactam antibiotic sensitivity was not due to reduced beta -lactamase activity.

The permeability of the cell envelopes was determined by measurement of the rate permeation by [14C]glycine into the cell (6, 15). The rate of [14C]glycine uptake by MUT1 (15.33 ± 0.79 nmol/min/mg) was twice the rate of uptake by mc2155 (7.70 ± 0.46 nmol/min/mg), indicating that the mutant was more permeable than the wild type. The increased permeability of the cell envelope of the mutant may contribute to its antibiotic sensitivity by allowing more beta -lactam antibiotic to enter the cell.

The growth rate of MUT1 was compared to that of the parent strain in several liquid media, including brain heart infusion broth (Oxoid), Middlebrook 7H9 (Difco), Penassay broth (Difco), and Luria-Bertani (LB) broth (Oxoid). The NaCl content of all media was adjusted to 0.17 M NaCl. Growth of the culture was monitored by counting viable cells or measuring biomass accumulation (9). In all media, the mutant MUT1 grew slower than the wild type and failed to reach the same final cell density at stationary phase, suggesting that PBP1 was required for normal growth. Representative data for cultures grown in LB broth are shown (Fig. 1A).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.   Growth in liquid culture of M. smegmatis mc2155 compared to that of MUT1 (A) and MUT2 (B). Bacteria were seeded into LB broth, and cultures were grown with aeration at 39°C for 78 h. Curves were plotted from the total cellular protein content (in micrograms) per milliliter of culture. Each datum point represents the average of two measurements. Error bars show standard deviations of the means.

The gene disrupted in MUT1 by Tn611 was determined by inverse-PCR amplification of the chromosomal sequence flanking the site of insertion with the Tn611-specific oligonucleotide primers 5' GAACCGCTTCGCTGCCTTG and 5' AACCACCATTTCGCAGCAGC on a genomic DNA template that had been digested with RsaI and then self-ligated. The nucleotide sequence of the PCR product showed identity to M. tuberculosis ponA1 and M. leprae ponA. The PCR product was used as a probe to screen a Lambda Fix II (Stratagene) M. smegmatis genomic library by plaque hybridization (11). Two clones were further analyzed by restriction endonuclease digestion and Southern hybridization with the PCR-generated probe. Two overlapping fragments, a 4-kb XhoI fragment and a 5-kb BamHI fragment, were subcloned into pBluescript SK (Stratagene) for sequence analysis. The resulting plasmids, named pHBJ154 and pHBJ155, were used to derive the complete sequence of ponA and that of a neighboring gene designated orf2 (Fig. 2). A Southern blot of MUT1 genomic DNA, probed with sequences from Tn611, showed that only one copy of Tn611 had inserted into the chromosome (data not shown).


View larger version (9K):
[in this window]
[in a new window]
 
FIG. 2.   Maps of plasmids used in this study are shown in relation to the coding regions of ponA and orf2 in M. smegmatis. The position where Tn611 inserted in ponA in MUT1 is shown with a black triangle. Restriction endonuclease sites are shown for sequenced regions (solid line). B, BamHI; X, XhoI; Bg, BglII. Relevant restriction endonuclease sites within the vector, pBluescript SK, are indicated with small, italicized capital letters as follows: X for XhoI and K for KpnI.

The ponA gene encoded a protein (715 amino acids) with high sequence similarity to the PBP1s of M. tuberculosis ponA1 (83%) and M. leprae ponA (78%). Similarity to the E. coli PBP1a was low and was restricted mainly to motifs that are conserved in HMW class A PBPs (5). An open reading frame (ORF) with a putative coding region of 1,662 bp was adjacent to ponA. The ORF encoded a product of unknown function and was provisionally designated orf2 (Fig. 2). The orf2 gene product had high amino acid sequence similarity to the proteins encoded by CY21D4.14 in M. tuberculosis (80%) and MLCB1913.22c in M. leprae (63%) but was not similar to other sequences in GenBank. The organizations of the ponA and orf2 homologues were conserved in all three of the mycobacterial species. In each case the orf2-like ORF overlapped the 3' end of ponA.

A PBP detection assay was performed to determine if the disruption of ponA altered the PBP profile in M. smegmatis. Membranes were extracted from wild-type and MUT1 cells that had been grown to mid-log phase (1), and the membrane-associated PBPs were labelled with [14C]benzylpenicillin (12). Labelled PBPs were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (7) and fluorography. Five major PBPs were detected in the wild type, as was seen previously for this species (1) (Fig. 3). The most intense bands on the fluorogram corresponded to PBP1 (95 kDa), PBP2 (80 kDa), and PBP4 (55 kDa). The ponA mutant completely lacked the 95-kDa PBP1 (Fig. 3). Bands corresponding to PBP3 (66 kDa) and PBP5 (40 kDa) (Fig. 3) were less intense and varied between experiments, possibly due to differences in sample preparation.


View larger version (79K):
[in this window]
[in a new window]
 
FIG. 3.   Penicillin binding assays were performed with M. smegmatis mc2155 (lane 1) and MUT1 (lane 2). Membranes, labelled with [14C]benzylpenicillin, were solublized in 1% sodium lauroyl sarcosinate, and the supernatant was loaded onto sodium dodecyl sulfate-polyacrylamide gels. The gels were dried and subjected to fluorography. The masses of protein markers are shown in kilodaltons on the right, and PBP numbers are on the left.

The Tn611 insertion in ponA could have had polar effects on orf2 and downstream genes. Such effects may contribute to the observed phenotype of MUT1. In order to test for polar effects, another mutant was made by targeted disruption of orf2 as follows. The plasmid pHBJ155, which contains orf2 on a 5-kb BamHI fragment in pBluescript SK (Fig. 2), was digested with BglII to remove a 752-bp fragment from the coding region of orf2. A streptomycin resistance cassette was excised from pUC19Omega (10) by BamHI digestion and ligated into BglII-digested pHBJ155, resulting in pHBJ163 (Fig. 2). A kanamycin resistance marker was excised from pUC4K (14) with SalI and cloned blunt ended into XhoI-cut pHBJ163. The product of this cloning, pHBJ183, had orf2 disrupted by the streptomycin resistance gene and had a kanamycin resistance gene to facilitate screening for double-crossover events into the mycobacterial chromosome (Fig. 2). Wild-type M. smegmatis was transformed with pHBJ183, and some streptomycin-resistant, kanamycin-sensitive transformants were obtained. One such transformant, designated MUT2, had undergone double homologous recombination with pHBJ183 (data not shown), resulting in the disruption of the chromosomal copy of orf2. MUT2 was essentially the same as the wild-type strain with regard to growth rate, salt requirements (Fig. 1B), and antibiotic sensitivity (Table 1). These results indicate that polar effects of Tn611 insertion in ponA did not influence the phenotype observed in MUT1.

In summary, we have identified an ORF, ponA, in M. smegmatis that encodes a 95-kDa protein named PBP1. Insertional inactivation of ponA resulted in a mutant that lacked PBP1, was sensitive to beta -lactam antibiotics, and had increased cell wall permeability. The 95-kDa PBP1 must not be essential to M. smegmatis, and other isoenzymes may partially substitute for PBP1 during peptidoglycan synthesis.

Nucleotide sequence accession number. The nucleotide sequences of ponA and orf2 were submitted to the Genbank, EMBL, and DDBL databases and assigned accession no. AF187306.


    ACKNOWLEDGMENTS

This work was supported by a project grant from the National Health and Medical Research Council and equipment grants from The Victorian Tuberculosis and Lung Association and the Rebecca L. Cooper Foundation Ltd.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology, Monash University, Wellington Rd., Clayton, Victoria 3168, Australia. Phone: 61 3 9905 4842. Fax: 61 3 9905 4811. E-mail: Helen.BJ{at}med.monash.edu.au.


    REFERENCES
Top
Abstract
Text
References

1. Basu, J., R. Chattopadhyay, M. Kundu, and P. Chakrabarti. 1992. Purification and partial characterization of a penicillin-binding protein from Mycobacterium smegmatis. J. Bacteriol. 174:4829-4832[Abstract/Free Full Text].
2. Basu, J., S. Mahapatra, M. Kundu, S. Mukhopadhyay, M. Nguyendisteche, P. Dubois, B. Joris, J. Vanbeeumen, S. T. Cole, P. Chakrabarti, and J. M. Ghuysen. 1996. Identification and overexpression in Escherichia coli of a Mycobacterium leprae gene, pon1, encoding a high-molecular-mass class A penicillin-binding protein, PBP1. J. Bacteriol. 178:1707-1711[Abstract/Free Full Text].
3. Billman-Jacobe, H., J. Sloan, and R. L. Coppel. 1996. Analysis of isoniazid-resistant transposon mutants of Mycobacterium smegmatis. FEMS Microbiol. Lett. 144:47-52[Medline].
4. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornby, K. Jagels, A. Krogh, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[Medline].
5. Goffin, C., and J. M. Ghuysen. 1998. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62:1079-1093[Abstract/Free Full Text].
6. Jarlier, V., and H. Nikaido. 1990. Permeability barrier to hydrophilic solutes in Mycobacterium chelonei. J. Bacteriol. 172:1418-1423[Abstract/Free Full Text].
7. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
8. Lepage, S., P. Dubois, T. K. Ghosh, B. Joris, S. Mahapatra, M. Kundu, J. Basu, P. Chakrabarti, S. T. Cole, M. Nguyendisteche, and J. M. Ghuysen. 1997. Dual multimodular class A penicillin-binding proteins in Mycobacterium leprae. J. Bacteriol. 179:4627-4630[Abstract/Free Full Text].
9. Meyers, P. R., W. R. Bourn, L. M. Steyn, P. D. van Helden, A. D. Beyers, and G. D. Brown. 1998. Novel method for rapid measurement of growth of mycobacteria in detergent-free media. J. Clin. Microbiol. 36:2752-2754[Abstract/Free Full Text].
10. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313[Medline].
11. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
12. Spratt, B. G. 1977. Properties of the penicillin-binding proteins of Escherichia coli K12. Eur. J. Biochem. 72:341-352[Medline].
13. Suzuki, H., Y. Nishimura, and Y. Hirota. 1978. On the process of cellular division in Escherichia coli: a series of mutants of E. coli altered in the penicillin-binding proteins. Proc. Natl. Acad. Sci. USA 75:664-668[Abstract/Free Full Text].
14. Taylor, L. A., and R. E. Rose. 1988. A correction in the nucleotide sequence of the Tn903 kanamycin resistance determinant in pUC4K. Nucleic Acids Res. 16:358[Free Full Text].
15. Trias, J., and R. Benz. 1994. Permeability of the cell wall of Mycobacterium smegmatis. Mol. Microbiol. 14:283-290[Medline].


Antimicrobial Agents and Chemotherapy, December 1999, p. 3011-3013, Vol. 43, No. 12
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Hett, E. C., Rubin, E. J. (2008). Bacterial Growth and Cell Division: a Mycobacterial Perspective. Microbiol. Mol. Biol. Rev. 72: 126-156 [Abstract] [Full Text]  
  • Morita, Y. S., Sena, C. B. C., Waller, R. F., Kurokawa, K., Sernee, M. F., Nakatani, F., Haites, R. E., Billman-Jacobe, H., McConville, M. J., Maeda, Y., Kinoshita, T. (2006). PimE Is a Polyprenol-phosphate-mannose-dependent Mannosyltransferase That Transfers the Fifth Mannose of Phosphatidylinositol Mannoside in Mycobacteria. J. Biol. Chem. 281: 25143-25155 [Abstract] [Full Text]  
  • Patel, D., Danelishvili, L., Yamazaki, Y., Alonso, M., Paustian, M. L., Bannantine, J. P., Meunier-Goddik, L., Bermudez, L. E. (2006). The Ability of Mycobacterium avium subsp. paratuberculosis To Enter Bovine Epithelial Cells Is Influenced by Preexposure to a Hyperosmolar Environment and Intracellular Passage in Bovine Mammary Epithelial Cells.. Infect. Immun. 74: 2849-2855 [Abstract] [Full Text]  
  • Haites, R. E., Morita, Y. S., McConville, M. J., Billman-Jacobe, H. (2005). Function of Phosphatidylinositol in Mycobacteria. J. Biol. Chem. 280: 10981-10987 [Abstract] [Full Text]  
  • Goffin, C., Ghuysen, J.-M. (2002). Biochemistry and Comparative Genomics of SxxK Superfamily Acyltransferases Offer a Clue to the Mycobacterial Paradox: Presence of Penicillin-Susceptible Target Proteins versus Lack of Efficiency of Penicillin as Therapeutic Agent. Microbiol. Mol. Biol. Rev. 66: 702-738 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Billman-Jacobe, H.
Right arrow Articles by Coppel, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Billman-Jacobe, H.
Right arrow Articles by Coppel, R. L.