Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, February 1999, p. 406-409, Vol. 43, No. 2
Biological Research
Laboratories1 and
Biomedical Research
Laboratories,2 Sankyo Co., Ltd., 2-58 Hiromachi 1-chome, Shinagawa-ku, Tokyo 140-8710, Japan
Received 6 July 1998/Returned for modification 3 September
1998/Accepted 12 November 1998
gyrA point mutations in 335 clinical Pseudomonas
aeruginosa isolates were examined mainly by nonisotopic
single-strand conformation polymorphism analysis and direct sequencing.
Seven types of missense gyrA mutations were
observed in 70 of 335 strains (20.9%), and ciprofloxacin MICs were
Fluoroquinolones have potent
antimicrobacterial activity against gram-positive and -negative
bacteria including Pseudomonas aeruginosa, a clinically
important pathogen (10). Their targets are considered to be
DNA gyrase and topoisomerase IV. Both are essential bacterial type II
topoisomerases that catalyze the passage of DNA strands through
one another by topological transformation and that are required
for cell growth and division. DNA gyrase consists of two each of
the A and B subunits, which are encoded by the gyrA and
gyrB genes, respectively, and these constitute the active
form of the enzyme, A2B2 (4, 21, 23,
28).
The emergence of fluoroquinolone resistance in P. aeruginosa
since the introduction of fluoroquinolones into clinical use and the
development of resistant mutants during drug therapy have been
reported (for reviews, see references 9, 20, and
30). The resistance of this organism has become of
clinical importance, because it is associated with therapeutic
failures. In P. aeruginosa, several quinolone
resistance mechanisms have been proposed. Genetic studies
revealed that the gyrA mutation is responsible for quinolone resistance and that the GyrA alteration leads to the resistance of DNA
gyrase to inhibition by quinolones (8, 11, 22). Some
investigators have reported that the GyrA alteration played a major
role in fluoroquinolone resistance in clinical isolates of P. aeruginosa (2, 34).
Single-strand conformation polymorphism (SSCP) analysis is based on the
theory that denatured PCR fragments with different sequences
migrate differently in a nondenaturing polyacrylamide gel
because of their altered folded structures due to a sequence alteration(s) (6, 17). Several investigators have applied SSCP analysis to the detection of gyrA mutations in several
bacterial species (3, 14, 19, 24, 25, 29).
In 1994 and 1995, 335 strains of P. aeruginosa were randomly
collected from clinical specimens from individual patients at 30 hospitals in Japan. The MICs for the strains were determined by the
agar dilution method (12) with approximately 5 × 103 CFU in Mueller-Hinton II agar (BBL, Cockeysville, Md.)
after 20 h of incubation at 37°C.
A pair of primers, PaGA1 (5'-TGACGGCCTGAAGCCGGTGCAC)
and PaGA4 (5'-TATCGCATGGCTGCGGCGTTG), was
synthesized. Their sequences were reported by Kureishi et al.
(13). We amplified the region that included codons 38 to 122 to encompass the region containing codons 67 through 106, which has
been proved to be the quinolone resistance-determining region in
Escherichia coli (33). PCR was carried out as
described previously (24), with some modifications.
The SacII site (CCGCGG) is present between
nucleotides 248 and 253 in the wild-type gyrA gene,
whereas it is absent from the mutant gyrA gene. For
restriction fragment length polymorphism (RFLP) analysis, the PCR
products were treated with SacII (ToYoBo, Tokyo, Japan) at
37°C for 2 h, and the fragments were separated on a 3%
low-melting-point agarose gel, followed by ethidium bromide staining.
For SSCP analysis, the PCR products (2 µl) were mixed with 10 µl of
sample buffer (24). After heat denaturation at 94°C for 5 min, samples (11 µl) were separated on a polyacrylamide gel (10% T
[total monomer concentration], 2% C [cross-linker concentration]; 12 cm by 13.7 cm by 0.75 mm) containing 5% glycerol in 25 mM
Tris-192 mM glycine-2 mM EDTA (18) at 24 ± 0.2°C
at a constant voltage of 200 for 9 h and 20 min. The gels
were stained with SYBR Green II RNA Gel Stains (TaKaRa Biomedicals,
Shiga, Japan) for 20 min to selectively detect single-stranded DNA.
Site-directed mutations were introduced into a plasmid
carrying the wild-type P. aeruginosa gyrA gene, pGL2B5
(13), by using the QuickChange Site Directed
Mutagenesis Kit (Stratagene, La Jolla, Calif.) according to the
manufacturer's instructions. Two pairs of primers,
5'-CGTGCTACCACA(C/A)CATCTGGCGCTACAGCGGCACG
(the desired mutations are underlined) and their respective
complementary oligonucleotides were used to introduce the
Thr-83 Direct sequencing of the PCR products was carried out as described
previously (24), with minor modifications.
Oligonucleotides PaGA1 and PaGA4 and oligonucleotide PaGA7
(5'-AACTACGATGGCACCGAG) were used as primers for DNA sequencing.
The 335 clinical isolates were examined under the optimized conditions,
and PCR products of the expected size were obtained from all strains
tested. By SSCP analysis, 18 band patterns could be differentiated, and
each pattern corresponded to a distinct mutation. Figure
1 shows the SSCP patterns of the 18 types
of sequences. The band patterns were reproducible and distinct
from each other. Because RFLP-SSCP analysis is simple and
rapid, it would be suitable for epidemiological surveillance.
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Detection of gyrA Mutations among 335 Pseudomonas aeruginosa Strains Isolated in Japan and Their
Susceptibilities to Fluoroquinolones
ABSTRACT
Top
Abstract
Text
References
3.13 µg/ml for 63 of 70 strains (90.0%). These included two double
point mutations and three novel mutations (Ala-67
Ser plus
Asp-87Gly, Ala-84Pro, and Gln-106Leu). Thr-83Ile mutants
were predominantly observed (63 of 70 mutants) and showed high-level fluoroquinolone resistance (ciprofloxacin MIC at which 50%
of isolates are inhibited, 25 µg/ml).
TEXT
Top
Abstract
Text
References
Ile plus Asp-87His mutation and the Thr-83Ile
plus Asp-87Asn mutation, respectively; these mutations have
been reported previously (31) but were not observed in our
335 strains.
View larger version (35K):
[in a new window]
FIG. 1.
Detection of gyrA mutations by PCR-RFLP
analysis (a) and PCR-SSCP analysis of SacII site-positive
(b) and -negative (c) DNA. Lanes M, molecular size standard
(HaeIII-digested 
X174); lane +, SacII
site-positive DNA fragment; lane 
, SacII site-negative DNA
fragment; lanes 1, wild type; lane 2, mutant containing alteration of
GCCGCT at codon 67 (silent); lane 3, mutant containing alteration of
CGTCGA at codon 68 (silent); lane 4, mutant containing alteration of
CCGCCA at codon 79 (silent); lane 5, mutant containing alteration of
CGCCGT at codon 91 (silent); lane 6, mutant containing alteration of
Asp-87Asn; lane 7, mutant containing alterations of CCGCCA at
codon 79 (silent) plus Asp-87Gly; lane 8, mutant containing
alterations of Ala-67Ser plus Asp-87Gly; lane 9, mutant
containing alteration of Gln-106Leu; lane 10, mutant containing
alteration of Thr-83Ile; lane 11, mutant containing alterations of
CGTCGA at codon 68 (silent) plus Thr-83Ile; lane 12, mutant
containing alterations of Thr-83Ile plus CGCCGT at codon 91 (silent); lane 13, mutant containing alterations of Thr-83Ile plus
Asp-87Gly; lane 14, mutant containing alterations of Thr-83Ile
plus Asp-87Asn; lane 15, mutant containing alterations of
Thr-83Ile plus Asp-87His; lane 16, mutant containing alteration
of GCGGCA at codon 84 (silent); lane 17, mutant containing
alteration of Ala-84Pro; lane 18, mutant containing alterations of
GCGGCA at codon 84 (silent) plus Asp-87Tyr. Lanes 6 through 13, 17, and 18, quinolone-resistant clinical strains; lanes 14 and 15, mutated plasmids derived from pGL2B5; lanes 16 and 18, generous gifts
from T. Schollaardt, namely, P4394 and Y4492, respectively.
Table 1 presents the incidence of the
wild-type strains and the 17 mutations, including three novel types
(Ala-67Ser plus Asp-87Gly, Ala-84Pro, and Gln-106Leu),
observed among all the strains and plasmids examined. The Thr-83Ile
mutation was the most frequent, while other mutations were rare.
Twenty-six strains contained silent mutations, which do not lead to
amino acid substitutions.
|
Table 2 shows the susceptibilities of the
335 clinical strains and strain Y4492 to 10 fluoroquinolones. Most of
the strains containing wild-type GyrA were susceptible to all
fluoroquinolones tested. Among the drugs tested, ciprofloxacin was the
most potent against them (MIC at which 50% of isolates are inhibited
[MIC50], 0.20 µg/ml), followed by tosufloxacin and then
CS-940 and norfloxacin. When ciprofloxacin resistance was designated as
an MIC of 3.13 µg/ml, the proportion of resistant strains was 9 of
265 (3.4%) among the strains containing wild-type GyrA. In contrast,
this ratio increased to 63 of 70 (90.0%) for GyrA mutants, and this ratio was significantly higher than that for strains containing wild-type GyrA (by the 
2 test, P < 0.001).
|
Mutants with a Thr-83Ile alteration showed high-level resistance to
all 10 fluoroquinolones tested. The MIC50s for mutants with a Thr-83Ile alteration were from 32-fold higher
(ofloxacin and gatifloxacin [AM-1155]) to 128-fold higher (with
norfloxacin, ciprofloxacin, tosufloxacin, and lomefloxacin) than
the MIC50s for strains containing wild-type GyrA.
Although few strains contained point mutations other than the
Thr-83Ile mutation, the following tendencies were observed. Every
type of GyrA mutant containing a missense mutation(s) showed cross-resistance to all fluoroquinolones tested. GyrA mutants containing a Thr-83Ile alteration showed higher levels of resistance to fluoroquinolones than mutants containing a different single point
mutation. Comparing the degree of rise in the MICs or
MIC50s of the fluoroquinolones tested for the mutants with
the different mutations, the level of deterioration of antibacterial
activity was relatively small with gatifloxacin, CS-940, and
sparfloxacin, whereas it was high with lomefloxacin, ciprofloxacin, and norfloxacin.
In this study we found that most of the fluoroquinolone-resistant
strains of P. aeruginosa possessed a point mutation of the Thr-83Ile type; this was in accordance with previous reports (15, 32). This mutation was therefore considered to be
selected more frequently, such as the Ser-83Leu mutation in an
E. coli mutant selected in a single step (7), and
to survive under clinical, selective pressure. Point mutations were
localized at codons 67, 83, 84, 87, and 106 and were closely related to
fluoroquinolone resistance. In E. coli, gyrA
mutations have been reported at codons 67, 81, 82, 83, 84, 87, and 106 (1, 5, 7, 16, 26, 27, 33). The sites of the point mutations
in the gyrA gene of P. aeruginosa were nearly
identical to those in E. coli. The results indicate that
this restricted region probably plays a significant role in the
quinolone-gyrase-DNA interaction, although contributions of mutations
in other regions of the gyrA gene cannot be completely excluded.
Because the amino acid sequences of the quinolone
resistance-determining region of P. aeruginosa is identical
to that of E. coli except for that at position 83, the
functional role of each residue is also likely to be identical. A
Thr-83Ile mutation in P. aeruginosa and the
corresponding Ser-83Leu, Trp, and Ala mutations reported in
E. coli are all polar, uncharged (PU)-to-nonpolar, hydrophobic (NH) amino acid substitutions. Asp-87Gly,
Asn, and Tyr mutations, which are negatively charged-to-PU
substitutions, were found in both P. aeruginosa and
E. coli. However, Asp-87His, a negatively
charged-to-positively charged substitution, was also observed in
P. aeruginosa, and Asp-87Val, a negatively charged-to-NH substitution, was observed in E. coli. It is likely that a
negatively charged amino acid at this position does not express the
quinolone resistance phenotype (31). Ala-67Ser,
an NH-to-PU substitution, and Ala-84Pro, an NH-to-NH
substitution, found in this study were the same as those reported for
E. coli, although the single mutation at position 67 was not found in our study. Exceptionally, at position 106, GlnLeu,
a PU-to-NH substitution, was observed in this study, while GlnHis
and Arg, PU-to-positively charged substitutions, were reported in
E. coli; the significance of this difference remains unknown.
Because clinical isolates have various genetic backgrounds, the MIC of a given fluoroquinolone sometimes varied more than 1,024-fold for strains with the same GyrA protein. To elucidate the definite relationship between types of GyrA mutations and the magnitude of resistance, a genetic investigation is under way.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to T. Schollaardt, the University of Calgary, for generously providing plasmid pGL2B5 and clinical isolates P4394 and Y4492. We also thank K. Fujiwara and M. Ohtsuki, Sankyo Co., Ltd., for meaningful suggestions on DNA manipulations.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Biological Research Laboratories, Sankyo Co., Ltd., 2-58 Hiromachi 1-chome, Shinagawa-ku, Tokyo 140-8710, Japan. Phone: 81-3-3492-3131. Fax: 81-3-5436-8566. E-mail: takeno{at}shina.sankyo.co.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Cambau, E.,
F. Bordon,
E. Collatz, and L. Gutmann.
1993.
Novel gyrA point mutation in a strain of Escherichia coli resistant to fluoroquinolones but not to nalidixic acid.
Antimicrob. Agents Chemother.
37:1247-1252 |
| 2. | Cambau, E., E. Perani, C. Dib, C. Petinon, J. Trias, and V. Jarlier. 1995. Role of mutations in DNA gyrase genes in ciprofloxacin resistance of Pseudomonas aeruginosa susceptible or resistant to imipenem. Antimicrob. Agents Chemother. 39:2248-2252[Abstract]. |
| 3. | Charvalos, E., E. Peteinaki, I. Spyridaki, S. Manetas, and Y. Tselentis. 1996. Detection of ciprofloxacin resistance mutations in Campylobacter jejuni gyrA by nonradioisotopic single-strand conformation polymorphism and direct DNA sequencing. J. Clin. Lab. Anal. 10:129-133[Medline]. |
| 4. | Drlica, K., and X. Zhao. 1997. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol. Mol. Biol. Rev. 61:377-392[Abstract]. |
| 5. |
Hallett, P., and A. Maxwell.
1991.
Novel quinolone resistance mutations of Escherichia coli DNA gyrase A protein: enzymatic analysis of the mutant proteins.
Antimicrob. Agents Chemother.
35:335-340 |
| 6. | Hayashi, K. 1991. PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA. PCR Methods Appl. 1:34-38[Medline]. |
| 7. |
Heisig, P., and R. Tschorny.
1994.
Characterization of fluoroquinolone-resistant mutants of Escherichia coli selected in vitro.
Antimicrob. Agents Chemother.
38:1284-1291 |
| 8. |
Hirai, K.,
S. Suzue,
T. Irikura,
S. Iyobe, and S. Mitsuhashi.
1987.
Mutations producing resistance to norfloxacin in Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
31:582-586 |
| 9. | Hooper, D. C., and J. S. Wolfson. 1989. Bacterial resistance to the quinolone antimicrobial agents. Am. J. Med. 87(Suppl. 6C):17S-23S. |
| 10. | Hooper, D. C., and J. S. Wolfson. 1991. Fluoroquinolone antimicrobial agents. N. Engl. J. Med. 324:384-394[Medline]. |
| 11. |
Inoue, Y.,
K. Sato,
T. Fujii,
K. Hirai,
M. Inoue,
S. Iyobe, and S. Mitsuhashi.
1987.
Some properties of subunits of DNA gyrase from Pseudomonas aeruginosa PAO1 and its nalidixic acid-resistant mutant.
J. Bacteriol.
169:2322-2325 |
| 12. | Japanese Society of Chemotherapy. 1981. Revision of methods for determining minimum inhibitory concentrations. Chemotherapy (Tokyo) 29:76-79. (In Japanese.) |
| 13. |
Kureishi, A.,
J. M. Diver,
B. Beckthold,
T. Schollaardt, and L. E. Bryan.
1994.
Cloning and nucleotide sequence of Pseudomonas aeruginosa DNA gyrase gyrA gene from strain PAO1 and quinolone-resistant clinical isolates.
Antimicrob. Agents Chemother.
38:1944-1952 |
| 14. | Munakata, N., F. Morohoshi, M. Saitou, N. Yamazaki, and K. Hayashi. 1994. Molecular characterization of thirteen gyrA mutations conferring nalidixic acid resistance in Bacillus subtilis. Mol. Gen. Genet. 244:97-103[Medline]. |
| 15. | Nakano, M., T. Deguchi, T. Kawamura, M. Yasuda, M. Kimura, Y. Okano, and Y. Kawada. 1997. Mutations in the gyrA and parC genes in fluoroquinolone-resistant clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 41:2289-2291[Abstract]. |
| 16. |
Oram, M., and L. M. Fisher.
1991.
4-Quinolone resistance mutations in the DNA gyrase of Escherichia coli clinical isolates identified by using the polymerase chain reaction.
Antimicrob. Agents Chemother.
35:387-389 |
| 17. | Orita, M., Y. Suzuki, T. Sekiya, and K. Hayashi. 1989. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874-879[Medline]. |
| 18. | Oto, M., S. Miyake, and Y. Yuasa. 1993. Optimization of nonradioisotopic single strand conformation polymorphism analysis with a conventional minislab gel electrophoresis apparatus. Anal. Biochem. 213:19-22[Medline]. |
| 19. | Ouabdesselam, S., D. C. Hooper, J. Tankovic, and C. J. Soussy. 1995. Detection of gyrA and gyrB mutations in quinolone-resistant clinical isolates of Escherichia coli by single-strand conformational polymorphism analysis and determination of levels of resistance conferred by two different single gyrA mutations. Antimicrob. Agents Chemother. 39:1667-1670[Abstract]. |
| 20. | Peterson, L. R. 1993. Quinolone resistance in clinical practice: occurrence and importance. In D. C. Hooper, and J. S. Wolfson (ed.), Quinolone antimicrobial agents, 2nd ed. American Society for Microbiology, Washington, D.C. |
| 21. | Reece, R. J., and A. Maxwell. 1991. DNA gyrase: structure and function. Crit. Rev. Biochem. Mol. Biol. 26:335-375[Medline]. |
| 22. |
Robillard, N. J., and A. L. Scarpa.
1988.
Genetic and physiological characterization of ciprofloxacin resistance in Pseudomonas aeruginosa PAO.
Antimicrob. Agents Chemother.
32:535-539 |
| 23. | Roca, J. 1995. The mechanisms of DNA topoisomerases. Trends Biochem. Sci. 20:156-160[Medline]. |
| 24. | Takenouchi, T., C. Ishii, M. Sugawara, Y. Tokue, and S. Ohya. 1995. Incidence of various gyrA mutants in 451 Staphylococcus aureus strains isolated in Japan and their susceptibilities to 10 fluoroquinolones. Antimicrob. Agents Chemother. 39:1414-1418[Abstract]. |
| 25. |
Tokue, Y.,
K. Sugano,
D. Saito,
T. Noda,
H. Ohkura,
Y. Shimosato, and T. Sekiya.
1994.
Detection of novel mutations in the gyrA gene of Staphylococcus aureus by nonradioisotopic single-strand conformation polymorphism analysis and direct DNA sequencing.
Antimicrob. Agents Chemother.
38:428-431 |
| 26. | Truong, Q. C., J.-C. N. Van, D. Shlaes, L. Gutmann, and N. J. Moreau. 1997. A novel, double mutation in DNA gyrase A of Escherichia coli conferring resistance to quinolone antibiotics. Antimicrob. Agents Chemother. 41:85-90[Abstract]. |
| 27. |
Vila, J.,
J. Ruiz,
F. Marco,
A. Barcelo,
P. Goni,
E. Giralt, and T. Jimenez de Anta.
1994.
Association between double mutation in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs.
Antimicrob. Agents Chemother.
38:2477-2479 |
| 28. | Wang, J. C. 1996. DNA topoisomerases. Annu. Rev. Biochem. 65:635-692[Medline]. |
| 29. |
Wang, T.,
M. Tanaka, and K. Sato.
1998.
Detection of grlA and gyrA mutations in 344 Staphylococcus aureus strains.
Antimicrob. Agents Chemother.
42:236-240 |
| 30. | Wolfson, J. S., and D. C. Hooper. 1989. Bacterial resistance to quinolones: mechanisms and clinical importance. Rev. Infect. Dis. 11(Suppl. 5):S960-S968. |
| 31. | Yonezawa, M., M. Takahata, N. Banawa, N. Matsubara, Y. Watanabe, and H. Narita. 1995. Analysis of the NH2-terminal 87th amino acid of Escherichia coli GyrA in quinolone-resistance. Microbiol. Immunol. 39:517-520[Medline]. |
| 32. | Yonezawa, M., M. Takahata, N. Matsubara, Y. Watanabe, and H. Narita. 1995. DNA gyrase gyrA mutations in quinolone-resistant clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 39:1970-1972[Abstract]. |
| 33. |
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272 |
| 34. |
Yoshida, H.,
M. Nakamura,
M. Bogaki, and S. Nakamura.
1990.
Proportion of DNA gyrase mutants among quinolone-resistant strains of Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
34:1273-1275 |
Antimicrobial Agents and Chemotherapy, February 1999, p. 406-409, Vol. 43, No. 2
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lister, P. D., Wolter, D. J., Hanson, N. D.
(2009). Antibacterial-Resistant Pseudomonas aeruginosa: Clinical Impact and Complex Regulation of Chromosomally Encoded Resistance Mechanisms. Clin. Microbiol. Rev.
22: 582-610
[Abstract] [Full Text] -
Han, X. Y., Andrade, R. A.
(2005). Brevundimonas diminuta infections and its resistance to fluoroquinolones. J Antimicrob Chemother
55: 853-859
[Abstract] [Full Text] -
Kugelberg, E., Lofmark, S., Wretlind, B., Andersson, D. I.
(2005). Reduction of the fitness burden of quinolone resistance in Pseudomonas aeruginosa. J Antimicrob Chemother
55: 22-30
[Abstract] [Full Text] -
Lomholt, J A, Kilian, M
(2003). Ciprofloxacin susceptibility of Pseudomonas aeruginosa isolates from keratitis. Br J Ophthalmol
87: 1238-1240
[Abstract] [Full Text] -
Fluit, A. C., Visser, M. R., Schmitz, F.-J.
(2001). Molecular Detection of Antimicrobial Resistance. Clin. Microbiol. Rev.
14: 836-871
[Abstract] [Full Text] -
Lindler, L. E., Fan, W., Jahan, N.
(2001). Detection of Ciprofloxacin-Resistant Yersinia pestis by Fluorogenic PCR Using the LightCycler. J. Clin. Microbiol.
39: 3649-3655
[Abstract] [Full Text] -
Akasaka, T., Tanaka, M., Yamaguchi, A., Sato, K.
(2001). Type II Topoisomerase Mutations in Fluoroquinolone-Resistant Clinical Strains of Pseudomonas aeruginosa Isolated in 1998 and 1999: Role of Target Enzyme in Mechanism of Fluoroquinolone Resistance. Antimicrob. Agents Chemother.
45: 2263-2268
[Abstract] [Full Text] -
Loeffler, J., Hagmeyer, L., Hebart, H., Henke, N., Schumacher, U., Einsele, H.
(2000). Rapid Detection of Point Mutations by Fluorescence Resonance Energy Transfer and Probe Melting Curves in Candida Species. Clin. Chem.
46: 631-635
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»