Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, March 1999, p. 537-542, Vol. 43, No. 3
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Reduced Pyrazinamidase Activity and the Natural
Resistance of Mycobacterium kansasii to the
Antituberculosis Drug Pyrazinamide
Zhonghe
Sun and
Ying
Zhang*
Department of Molecular Microbiology and
Immunology, School of Hygiene and Public Health, Johns Hopkins
University, Baltimore, Maryland 21205
Received 9 February 1998/Returned for modification 9 April
1998/Accepted 14 December 1998
 |
ABSTRACT |
Pyrazinamide (PZA), an analog of nicotinamide, is a prodrug that
requires conversion to the bactericidal compound pyrazinoic acid (POA)
by the bacterial pyrazinamidase (PZase) activity of nicotinamidase to
show activity against Mycobacterium tuberculosis. Mutations
leading to a loss of PZase activity cause PZA resistance in M. tuberculosis. M. kansasii is naturally resistant to PZA and has
reduced PZase activity along with an apparently
detectable nicotinamidase activity. The role of the reduction in PZase
activity in the natural PZA resistance of M. kansasii
is unknown. The MICs of PZA and POA for M. kansasii
were determined to be 500 and 125 µg/ml, respectively. Using
[14C]PZA and [14C]nicotinamide, we
found that M. kansasii had about 5-fold-less PZase activity and about 25-fold-less nicotinamidase activity than
M. tuberculosis. The M. kansasii
pncA gene was cloned on a 1.8-kb
BamHI DNA fragment, using M. avium pncA
probe. Sequence analysis showed that the M. kansasii pncA gene encoded a protein with homology to
its counterparts from M. tuberculosis (69.9%), M. avium (65.6%), and Escherichia coli
(28.5%). Transformation of naturally PZA-resistant M. bovis BCG with M. kansasii pncA conferred
partial PZA susceptibility. Transformation of M. kansasii with M. avium pncA caused functional
expression of PZase and high-level susceptibility to PZA, indicating
that the natural PZA resistance in M. kansasii results
from a reduced PZase activity. Like M. tuberculosis,
M. kansasii accumulated POA in the cells at an acidic pH; however, due to its highly active POA efflux pump, the naturally PZA-resistant species M. smegmatis did not. These
findings suggest the existence of a weak POA efflux mechanism in
M. kansasii.
 |
INTRODUCTION |
Mycobacterium kansasii is
a slow-growing opportunistic human pathogen that often causes pulmonary
lesions similar to those caused by M. tuberculosis in
immunocompromised patients, such as those with AIDS (24).
Unlike M. tuberculosis, M. kansasii is
naturally resistant to the antituberculosis drug pyrazinamide (PZA), an
analog of nicotinamide, at 50 µg/ml, a concentration at which
M. tuberculosis is susceptible (4). In
M. tuberculosis, the susceptibility to PZA
correlates with the presence of a single enzyme, nicotinamidase,
that also has pyrazinamidase (PZase) activity (8, 9, 11,
22). We recently identified the M. tuberculosis PZase/nicotinamidase gene (pncA) (13) and
showed that mutation of pncA is a major mechanism of PZA
resistance in M. tuberculosis (14, 17).
M. bovis and M. bovis BCG, whose
genomes are almost identical to that of M. tuberculosis, are naturally resistant to PZA. We have demonstrated
that the natural PZA resistance of M. bovis is due to a
single point mutation of C to G at nucleotide position 169 of the
M. bovis pncA gene, causing an amino acid substitution
of aspartate for histidine at amino acid position 57 compared
with the M. tuberculosis pncA sequence (13,
14). In this sense, M. bovis strains can be
regarded as a special case of PZA-resistant M. tuberculosis. In contrast, the natural PZA resistance in
nontuberculous mycobacteria such as M. smegmatis and M. avium is not caused by a defective PZase as in
M. tuberculosis with acquired PZA resistance, since
these mycobacteria have significant PZase activity (5, 20).
Natural PZA resistance, at least in the case of M. smegmatis, is due to a highly active efflux mechanism that rapidly
extrudes pyrazinoic acid (POA), the active form of PZA, from the cell
after conversion of PZA by the bacterial PZase (27).
The basis for the natural resistance of M. kansasii to
PZA is unknown. M. kansasii is known to have reduced
PZase activity along with a detectable nicotinamidase activity (5,
20). The role of the reduced PZase activity in the natural PZA
resistance of M. kansasii is uncertain. In this study
using radioactive [14C]PZA and
[14C]nicotinamide, we found that M. kansasii, while having a reasonable amount of nicotinamidase
activity, had a very low level of PZase activity that was undetectable
by a conventional PZase assay (23). In addition, we cloned the
M. kansasii PZase gene (pncA) and
showed that it could partially restore PZA susceptibility in naturally PZA-resistant BCG. Furthermore, transformation of M. kansasii with M. avium pncA (known to
restore complete susceptibility to BCG) conferred a high degree of
susceptibility to PZA in M. kansasii. These results
suggest that the natural resistance of M. kansasii to
PZA is due to a deficient PZase activity of its nicotinamidase enzyme.
 |
MATERIALS AND METHODS |
Growth of mycobacteria and isolation of genomic DNA.
Mycobacterial strains were grown in 7H9 liquid medium with
albumin-dextrose-catalase enrichment (Difco) at 37°C for about 2 weeks for M. kansasii ATCC type strain 12478 and for 3 to 4 weeks for M. tuberculosis or M. bovis BCG-Pasteur. Mycobacterial genomic DNA was isolated as
described previously (25).
PZA and POA susceptibility testing.
A PZA stock solution (25 mg/ml) was prepared in water. POA was dissolved in dimethyl sulfoxide
(1) at a concentration of 100 mg/ml. The susceptibility of
M. kansasii, M. kansasii transformants, and BCG transformants to PZA or POA was determined on 7H11 agar plates
of acidic pH (pH 5.5) (10, 21) containing 31, 62.5, 125, 250, 500, or
1,000 µg of PZA or POA/ml. Two dilutions (10
2 and
10
4) of early-stationary-phase mycobacterial cultures
diluted in 7H9 liquid medium were plated onto the 7H11 plates, which
were then incubated at 37°C for about 10 to 14 days for M. kansasii or for 21 to 28 days for BCG. The MICs were determined by
the proportional method (indirect test) (6), which is based
on determining the lowest concentration of PZA or POA at which
bacterial growth (CFU) is inhibited by >99%.
Preparation of protein extracts and determination of protein
concentrations.
Protein extracts from M. tuberculosis H37Ra and M. kansasii ATCC type
strain 12478 were prepared from late-log-phase cultures by sonication.
Briefly, 50-ml cultures were washed with 50 mM potassium phosphate
buffer (pH 7.4) twice, and cell pellets were resuspended in 0.4 ml of
the same buffer. The concentrated cell suspension was sonicated on ice
for 3 min and then centrifuged at 10,000 rpm for 20 min. The protein
concentrations of the supernatant fractions (cell lysates) were
determined by the Bradford method, using a Bio-Rad protein estimation
kit according to the manufacturer's protocol. The lysates were then
used for enzyme activity determinations as described below.
Determination of PZase and nicotinamidase activities.
[14C]carbonyl-PZA ([14C]PZA; 52 mCi/mmol) was provided by the National Institutes of Health (NIH) AIDS
Reagents Program, Rockville, Md.
[14C]carbonyl-nicotinamide ([14C]NAm; 45.4 mCi/mmol) was purchased from Sigma Chemical Co. To determine the
relative PZase and nicotinamidase activities in the bacterial cells,
2 µCi of [14C]PZA or [14C]NAm
was added to an equal amount (225 µg of protein) of M. kansasii or M. tuberculosis protein extract in 50 mM potassium phosphate buffer (pH 7.4) in a volume of 100 µl and the
mixture was incubated at 37°C for various time periods. Following
incubation, 4-µl volumes of the radioactive extracts were spotted
onto a 0.25-mm-thick silica G gel 60 thin-layer chromatography (TLC)
plate (Whatman), and the plate was air dried and then developed in a
solvent system consisting of butanol and 10% ammonium hydroxide (5:1).
Following chromatography, the plate was air dried and exposed to X-ray
film for autoradiography. The area on the TLC plate where radioactive spots were located, as determined by aligning the autoradiograph with
the TLC plate, was cut out and subjected to scintillation counting. The
amount of PZase or nicotinamidase in the protein extract was defined
and calculated according to the method of Tanigawa et al.
(19). One unit of PZase or nicotinamidase was defined as the
amount of enzyme required to produce 1 nmol of POA or nicotinic acid
(NA) per h.
Southern blot analysis.
Southern blot analysis of
mycobacterial genomic DNA was performed as described previously
(25). Briefly, genomic DNA from various mycobacterial
species was isolated, digested with BamHI, and run on a
0.8% agarose gel. Genomic-DNA fragments from the gel
were transferred to a nylon membrane by vacuum blotting, and the membrane was fixed by UV irradiation. The DNA probe for the Southern blotting analysis was prepared by a PCR approach, using primers that were derived from the M. avium pncA gene.
The forward primer (5'GCATCAACGCCTACCTGGAC3') was taken from
bp 87 to 107 and the reverse primer (5'TGCACCAGCACCCGGGTGGT3')
was taken from bp 474 to 455 of the M. avium pncA
coding sequence (GenBank accession no. U80820) (18). The
391-bp PCR fragment was labeled with [32P]dCTP by
using a Random Primer DNA Labeling System (GIBCO BRL) in accordance
with the manufacturer's protocol. The blot was probed with the
[32P]dCTP-labeled PCR fragment, washed under
low-stringency conditions, and subjected to autoradiography.
Cloning of the M. kansasii pncA gene.
M. kansasii genomic DNA digested with BamHI
produced a 1.8-kb fragment that hybridized with the M. avium
pncA gene (see Results). The M. kansasii pncA gene
was cloned after screening a partial genomic DNA library made by
cloning 1.5- to 2-kb BamHI genomic-DNA fragments
into pUC19, using a [32P]dCTP-labeled 391-bp PCR fragment
from the M. avium pncA gene (18) as a probe,
by colony hybridization as described previously (25). A
pncA-positive plasmid clone containing the M. kansasii pncA gene was isolated and subjected to DNA sequence
analysis as described below. The standard molecular cloning techniques were carried out as described by Sambrook et al. (12).
DNA sequence analysis.
The complete M. kansasii
pncA gene sequence was determined for both strands from the 1.8-kb
BamHI-pUC19 construct by primer walking in an automatic DNA
sequencer (ABI model 377; Applied Biosystems) at the Johns Hopkins
University Genetic Core Facility. A multiple-sequence alignment of the
M. kansasii, M. avium, M. tuberculosis, and E. coli PncA sequences was performed
by the Clustal method, using MegAlign/DNASTAR software.
Transformation of mycobacteria.
The pncA plasmid
constructs used for transformation of M. bovis BCG and
M. kansasii were made as follows. The 1.8-kb
BamHI fragment containing the M. kansasii
pncA gene was cloned into the hygromycin resistance-encoding
mycobacterial shuttle vector p16R1 (3) as described
elsewhere (12). The M. kansasii pncA gene's
start codon is located 584 bp downstream from the 5'-end BamHI site of the 1.8-kb BamHI fragment (see
Results) and should contain its own promoter for expression in BCG. The
p16R1-1.8-kb M. kansasii pncA construct and the same
vector harboring the M. tuberculosis pncA gene on a
3.2-kb EcoRI-PstI fragment (13), along
with the vector control, were transformed by electroporation into the
naturally PZA-resistant M. bovis BCG as described
previously (26). After being subjected to electroporation
and incubation at 37°C overnight, the transformed BCG cells were
plated on 7H11 agar plates containing 50 µg of hygromycin/ml and
incubated at 37°C for 3 to 4 weeks. The M. avium pncA
gene, on a 1.6-kb BamHI fragment, was similarly cloned into
p16R1, and the p16R1-M. avium pncA construct, along
with the p16R1 vector control, was electroporated into M. kansasii as described above. The transformed M. kansasii cells were plated on 7H11 plates containing 100 µg of
hygromycin/ml, and the plates were incubated at 37°C for 2 weeks.
[14C]POA accumulation by mycobacteria.
[14C]POA was prepared via [14C]PZA
conversion by PZase from an M. smegmatis protein
extract. The conversion of [14C]PZA to
[14C]POA was complete as judged by TLC.
[14C]POA was added at 1 µCi/ml to comparable
numbers of bacterial cells (about 2 × 109 each)
prepared from late-log-phase cultures of M. kansasii,
M. tuberculosis H37Ra, and M. smegmatis
at both pH 5.0 and pH 7.0. The radioactive bacterial-cell suspensions
were incubated at 37°C for various periods of time, ranging from 0.5 to 6 h. At each time point, portions (100 µl) of bacterial
suspension were removed, and the bacterial cells were washed with
phosphate-buffered saline onto nitrocellulose membranes (0.45-µm
pores) by filtration with the aid of a vacuum pump. The radioactivity
associated with bacterial cells on the membranes was determined by
scintillation counting.
Nucleotide sequence accession number.
The coding sequence of
the M. kansasii pncA gene has been deposited in the
GenBank database under accession no. AF002663.
 |
RESULTS |
MICs of PZA and POA for M. kansasii.
Previous
studies have shown that M. kansasii is resistant to PZA
at concentrations higher than 50 µg/ml (4), a
concentration at which M. tuberculosis is susceptible
(10). However, the exact MIC of PZA for M. kansasii was not reported. In this study, the MIC of PZA for
M. kansasii was found to be about 500 µg/ml. The MIC
of POA (the active derivative of PZA) for M. kansasii
was about 125 µg/ml. As controls, M. bovis BCG and
M. tuberculosis H37Ra were both found to have similar
POA MICs of about 62 µg/ml.
Relative nicotinamidase and PZase activities of the M. kansasii PncA enzyme.
By the conventional Wayne agar method
(23), M. kansasii has been shown to have nicotinamidase
activity but no detectable PZase activity (5, 20), but some
PZase activity was detectable by a more sensitive high-performance
liquid chromatography method (16). We compared the
relative PZase and nicotinamidase activities of M. kansasii by using [14C]PZA and
[14C]NAm, with M. tuberculosis as a
control. As shown in Fig. 1A, M. kansasii converted virtually all
[14C]NAm to NA at 2 h, whereas conversion of
[14C]PZA to POA was hardly seen even by 5 h.
However, there was definite conversion of PZA to POA by M. kansasii at 16 h. In contrast, while M. tuberculosis H37Ra converted [14C]NAm to NA by
1 h, M. tuberculosis had much stronger PZase
activity, since it converted PZA to POA at 1 to 2 h (Fig. 1B). PZA
alone, in the absence of PZase/nicotinamidase (as a control), did not degrade spontaneously into POA even after incubation at 37°C for several days (data not shown). It is worth noting that when
[14C]PZA was added to M. tuberculosis
or M. kansasii, only two spots were seen on TLC plates;
one was PZA itself, and the other was POA. The identities of the spots
were confirmed by running "cold" PZA and POA as controls in
parallel with samples containing "hot" PZA and POA by TLC, after
which the chromatogram was then examined under UV light. Cold PZA and
POA gave fluorescence spots, which were marked with pencil, and the TLC
plate was then subjected to autoradiography. Under the given set of
experimental conditions, no radioactive compounds except PZA or POA
were seen.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of nicotinamide and PZA conversions by the
PncAs of M. kansasii and M. tuberculosis. [14C]NAm and
[14C]PZA were added to M. kansasii
(A) and M. tuberculosis H37Ra (B) cultures, and the
degrees of conversion of NAm to NA and of PZA to POA were monitored at
various time points by TLC. Duplicate samples were taken at each time
point. The radioactive NAm and PZA and their derivatives, NA and POA,
are indicated by arrows.
|
|
To determine the relative amount of nicotinamidase and PZase activities
in
M. kansasii more quantitatively, we used a more
sensitive radioactive assay to measure the enzyme activities in
the
M. kansasii protein extract, employing
[
14C]PZA and [
14C]NAm, with an
equal amount of
M. tuberculosis H37Ra protein
extract
being utilized as a control. The specific activity of the
M. kansasii nicotinamidase was about 18-fold higher
than its PZase activity
(means ± standard deviations,
0.1 ± 0.03 and 1.8 ± 0.12 U/mg of
protein,
respectively), whereas the
M. tuberculosis
nicotinamidase
activity was about 94-fold higher than its PZase
activity (47.4
± 5.3 and 0.5 ± 0.04 U/mg of protein,
respectively). On the other
hand, the
M. kansasii PZase
activity was about 5-fold less than
that of the
M. tuberculosis PZase, and the
M. kansasii
nicotinamidase
activity was about 25-fold less than that of the
M. tuberculosis enzyme.
Cloning and sequence analysis of the M. kansasii
pncA gene.
Southern blotting analysis of M. kansasii genomic DNA indicated that a 1.8-kb BamHI
fragment hybridized with the 391-bp PCR fragment from the
M. avium pncA gene (Fig.
2, lane 6). To clone the
M. kansasii pncA gene, a partial genomic-DNA library
was constructed by cloning 1.5- to 2-kb BamHI
genomic-DNA fragments of M. kansasii into pUC19,
and the library was screened with the M. avium
pncA gene probe. A positive plasmid clone containing the
1.8-kb BamHI fragment was identified and sequenced. The
complete M. kansasii pncA gene was found to be 561 bp
long and to encode a protein of about 19.8 kDa (GenBank accession
no. AF002663). The M. kansasii PncA showed 69.9, 65.6, and 28.5% amino acid identity with its counterparts
from M. tuberculosis, M. avium, and
E. coli, respectively (Fig.
3).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Determination of the presence of pncA
homologues in mycobacterial species by Southern blot analysis. Genomic
DNA from various mycobacterial species was digested with
BamHI and subjected to hybridization with a
[32P]dCTP-labeled M. avium
pncA probe. Lanes: 1, M. avium; 2, M. smegmatis; 3, M. tuberculosis H37Rv; 4, M. bovis BCG; 5, M. fortuitum; 6, M. kansasii.
|
|

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the sequence of M. kansasii PncA (MKPNCA.PR) with those of its counterparts from
M. tuberculosis, M. avium, and E. coli (TBPNCA.PR, MAPNCA.PR, and ECPNCA.PR, respectively). Sequence
alignment was performed by the Clustal method. Highlighted areas
indicate identical amino acid residues of the PncA enzymes. Accession
numbers for the pncA genes of M. kansasii,
M. avium, M. tuberculosis, and E. coli are AF002663, U80820, U59967, and P21369, respectively.
|
|
Transformation of BCG with the M. kansasii pncA
gene partially restored PZA susceptibility.
BCG is naturally
resistant to PZA (MIC > 500 µg/ml) due to the presence of a single
point mutation in the pncA gene (13). To assess
the relative contribution of the pncA genes of M. kansasii and BCG to PZA susceptibility, we transformed BCG with
the M. kansasii pncA gene on the 1.8-kb
BamHI fragment cloned into p16R1 and also with the
M. tuberculosis pncA construct as a positive control.
While the M. tuberculosis pncA gene conferred full
susceptibility to PZA in BCG (MIC, ca. 31 to 62 µg/ml),
the M. kansasii pncA gene could only
partially restore PZA susceptibility to BCG (MIC, ca. 125 µg/ml)
(Table 1). This indicates that the
M. kansasii PncA enzyme indeed has some level of PZase
activity, which can enhance the conversion of PZA to active POA, and
thus is involved in partial restoration of PZA susceptibility to BCG.
Transformation with the pncA gene from either M. tuberculosis or M. kansasii did not alter the POA
MIC for BCG (Table 1).
Transformation of M. kansasii with M. avium pncA conferred a high degree of PZA susceptibility.
M. avium pncA has previously been shown to confer
to BCG a level of PZA susceptibility similar to that of the
PZA-susceptible bacterium M. tuberculosis,
indicating that M. avium has a functional PZase/nicotinamidase enzyme capable of potentiating PZA
action. To determine whether the natural PZA resistance of
M. kansasii is due to the reduced PZase activity of its
nicotinamidase enzyme, we transformed M. kansasii (ATCC
type strain) with the M. avium pncA gene in the
hygromycin vector p16R1. Transformation of the M. kansasii with M. avium pncA caused functional
overexpression of the M. avium PZase enzyme, as
revealed by an increased conversion of [14C]PZA to
[14C]POA compared to that of the vector control
(data not shown). The overexpression of the M. avium PZase enzyme rendered the M. kansasii strain
more susceptible to PZA (MIC, 31 to 62 µg/ml [a concentration to
which the susceptible species M. tuberculosis is
sensitive]). This suggests that the natural PZA resistance of
M. kansasii (at least in the case of the ATCC type
strain) results from its reduced PZase activity, which does not result in efficient conversion of the prodrug PZA to the bactericidal compound POA.
Weak POA efflux activity in M. kansasii.
The
natural PZA resistance of fast-growing M. smegmatis
correlates with a highly active POA efflux mechanism which does not allow POA to accumulate in cells of this species at an acidic pH
(27). In contrast, the PZA-susceptible species
M. tuberculosis has been found to have a much weaker
POA efflux mechanism, as revealed by the increasing accumulation of POA
by this organism at an acidic pH (5.0 to 5.5) (27). To
determine the potential POA efflux activity in M. kansasii, we compared the POA accumulation patterns of
M. tuberculosis, M. smegmatis, and
M. kansasii at pH 5.0 and pH 7.0. As shown in
Fig. 4, M. kansasii
behaved like the susceptible species M. tuberculosis in
accumulating POA at pH 5.0 (Fig. 4A and B); in contrast,
M. smegmatis cells did not accumulate a significant
amount of POA even at an acidic pH (5.0) (Fig. 4C).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of [14C]POA accumulations
in M. kansasii (M. kan) (A), M. tuberculosis H37Ra (Ra) (B), and M. smegmatis
(M. sm) (C) at an acidic pH (5.0) and at neutral pH (7.0). Closed
circles and open circles represent the amounts of radioactivity
associated with bacterial cells at pH 5.0 and pH 7.0, respectively.
This experiment was repeated at least three times, and the results of a
representative experiment are shown here.
|
|
 |
DISCUSSION |
M. kansasii is known to have a deficient PZase
activity in conventional PZase testing by the Wayne agar method,
despite having an apparently normal nicotinamidase activity (5,
20). In this study, using a more sensitive radioactive method
involving the use of [14C]PZA as a substrate, we
showed that M. kansasii definitely has a weak PZase
activity that is undetectable by the Wayne method. This finding is in
agreement with the results of Speirs et al., who found weak PZase
activity in M. kansasii by a sensitive high-performance liquid chromatography analytical method (16). The
M. kansasii nicotinamidase activity was about 18-fold
higher than its PZase activity, whereas the M. tuberculosis nicotinamidase activity was 94-fold higher than its
PZase activity. The PZase activity of M. kansasii was
about fivefold lower than that of the M. tuberculosis enzyme. To identify the basis for the separation of PZase activity from
nicotinamidase activity of M. kansasii PncA and to
assess the role of the reduced PZase activity in the natural resistance of M. kansasii to PZA, we cloned the pncA
gene from M. kansasii. Sequence analysis showed that
the M. kansasii PncA exhibited a high degree of
homology to the M. tuberculosis (69.9%) and
M. avium (65.6%) enzymes, which have both PZase and
nicotinamidase activities (Fig. 3). However, sequence comparisons did
not allow direct identification of the amino acid residues responsible
for the weak PZase activity of the M. kansasii
nicotinamidase enzyme, because there are several residues in the
M. kansasii PncA that are different from the
corresponding residues of other mycobacterial PncAs (Fig. 3). The
physiological role of the nicotinamidase enzyme (PncA) is to degrade
nicotinamide to NA, which can be recycled to NAD via the Preiss-Handler
pathway of the pyridine nucleotide cycle in most prokaryotes
(2). Because PZase converts PZA to the bactericidal compound
POA, the amount of PZase activity, by affecting the rate of conversion
of PZA to POA, would be important in determining the susceptibility of
mycobacteria to PZA. The presence as well as the amount of PZase
activity of the nicotinamidase enzymes from various bacterial species
appears to be purely coincidental, because PZA, as an analog of
nicotinamide, is an artificial compound that does not exist in nature.
It so happens that M. tuberculosis has a nicotinamidase
enzyme with a reasonable amount of PZase activity, whereas
M. kansasii has a nicotinamidase enzyme with much
weaker PZase activity.
Because defective PZase activity caused by pncA mutations
correlates with PZA resistance in M. tuberculosis
(13, 15, 17), we determined whether the reduced level of
PZase activity in M. kansasii is responsible for its
natural resistance to PZA. Transformation of M. kansasii with the M. avium pncA gene caused
overexpression of PZase and concomitantly conferred a high level of
susceptibility to PZA (MIC, 31 to 62 µg/ml); in a previous study, the
same M. avium pncA construct was shown to make BCG
fully susceptible to PZA (18). This indicates that the
reduced PZase activity of M. kansasii is the cause of
its natural PZA resistance. On the other hand, transformation of BCG
with M. kansasii pncA made BCG more susceptible to PZA
(MIC, 125 µg/ml); however, the degree of susceptibility to PZA was
not as high as that achieved by transformation with the M. tuberculosis pncA gene (MIC, 31 to 62 µg/ml). This suggests that
while M. kansasii PncA has some PZase activity, its
PZase activity is lower than that of the M. tuberculosis PncA enzyme, a conclusion also supported by the
enzyme assays using [14C]PZA (see Results).
In addition to the level of PZase activity, the activity of efflux
pumps (7) could also affect the susceptibility of mycobacteria to PZA.
We have recently shown that the natural PZA resistance of M. smegmatis (MIC, >2,000 µg/ml) is not due to a defective PZase
but rather is attributable to a highly active efflux pump that extrudes
POA from the cell very rapidly (27). Likewise, the natural
PZA resistance of M. avium (MIC, 500 µg/ml) also
appears to involve an active efflux pump with an efficiency in between those of M. smegmatis and M. tuberculosis (unpublished observation), since the M. avium pncA gene, when transformed into BCG, completely restored
PZA susceptibility (18), indicating that the M. avium PZase is fully functional and the natural PZA resistance of
M. avium is not due to an inability of its PZase to
convert PZA to POA. In this study, M. kansasii, like
the PZA-susceptible species M. tuberculosis, could also
accumulate POA in the cells at an acidic pH (5.0) (Fig. 4A). The
accumulation of POA at an acidic pH, along with the observation that
the M. avium pncA gene can confer a high degree of PZA
susceptibility to M. kansasii, indicates that
M. kansasii has a weak POA efflux mechanism that is
unlikely to contribute to its natural PZA resistance. We conclude that the natural PZA resistance of M. kansasii is due to the
somewhat-deficient PZase activity of its nicotinamidase enzyme.
Site-directed mutagenesis and comparative structural and enzymatic
analyses are needed to determine the amino acid residues in PncA that
underlie the weak PZase activity of the M. kansasii nicotinamidase.
 |
ACKNOWLEDGMENTS |
This work was supported by research grants from the American Lung
Association, Potts Memorial Foundation, and the NIH (RO1 AI40584 [to
Y.Z.]).
We thank Diane Griffin and Barbara Laughon for encouragement, Salman
Siddiqi for M. kansasii strains, and the NIH AIDS
Reagents Program for [14C]PZA. We also thank the
reviewers for helpful suggestions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology and Immunology, School of Hygiene and Public
Health, Johns Hopkins University, 615 N. Wolfe St., Baltimore, MD
21205. Phone: (410) 614-2975. Fax: (410) 955-0105. E-mail:
yzhang{at}jhsph.edu.
 |
REFERENCES |
| 1.
|
Cynamon, M. H.,
R. Gimi,
F. Gyenes,
C. A. Sharpe,
K. E. Bergermann,
H. J. Han,
L. B. Gregor,
R. Rapolu,
G. Luciano, and J. T. Welch.
1995.
Pyrazinoic acid esters with broad spectrum in vitro antimycobacterial activity.
J. Med. Chem.
38:3902-3907[Medline].
|
| 2.
|
Foster, J. W., and A. G. Moat.
1980.
Nicotinamide adenine dinucleotide biosynthesis and pyridine nucleotide cycle metabolism in microbial systems.
Microbiol. Rev.
44:83-105[Free Full Text].
|
| 3.
|
Garbe, T.,
J. Barathi,
S. Barnini,
Y. Zhang,
C. Abou-Zeid,
D. Tang,
R. Mukherjee, and D. Young.
1994.
Transformation of mycobacterial species using hygromycin resistance as selectable marker.
Microbiology
140:133-138[Abstract/Free Full Text].
|
| 4.
|
Good, R. C.,
V. A. Silcox,
J. O. Kilburn, and B. D. Plikaytis.
1985.
Identification and drug susceptibility test results for Mycobacterium spp.
Clin. Microbiol. Newslett.
7:133-136.
|
| 5.
|
Helbecque, D. M.,
V. Handzel, and L. Eidus.
1975.
Simple amidase test for identification of mycobacteria.
J. Clin. Microbiol.
1:50-53[Abstract/Free Full Text].
|
| 6.
|
Inderlied, C. B., and K. A. Nash.
1996.
Antimycobacterial agents: in vitro susceptibility testing, spectra of activity, mechanism of action and resistance, and assays for activity in biological fluids, p. 127-175.
In
V. Lorian (ed.), Antibiotics in laboratory medicine, 4th ed. Williams & Wilkins, Baltimore, Md.
|
| 7.
|
Jarlier, V., and H. Nikaido.
1994.
Mycobacterial cell wall: structure and role in natural resistance to antibiotics.
FEMS Microbiol. Lett.
123:11-18[Medline].
|
| 8.
|
Konno, K.,
F. M. Feldman, and W. McDermott.
1967.
Pyrazinamide susceptibility and amidase activity of tubercle bacilli.
Am. Rev. Respir. Dis.
95:461-469[Medline].
|
| 9.
|
McClatchy, J. K.,
A. Y. Tsang, and M. S. Cernich.
1981.
Use of pyrazinamidase activity in Mycobacterium tuberculosis as a rapid method for determination of pyrazinamide susceptibility.
Antimicrob. Agents Chemother.
20:556-557[Abstract/Free Full Text].
|
| 10.
|
McDermott, W., and R. Tompsett.
1954.
Activation of pyrazinamide and nicotinamide in acidic environment in vitro.
Am. Rev. Tuberc.
70:748-754.
[Medline] |
| 11.
|
Miller, M. A.,
L. Thibert,
F. Desjardins,
S. H. Siddiqi, and A. Dascal.
1995.
Testing of susceptibility of Mycobacterium tuberculosis to pyrazinamide: comparison of Bactec method with pyrazinamidase assay.
J. Clin. Microbiol.
33:2468-2470[Abstract].
|
| 12.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 13.
|
Scorpio, A., and Y. Zhang.
1996.
Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.
Nat. Med.
2:662-667[Medline].
|
| 14.
|
Scorpio, A.,
D. Collins,
D. Whipple,
D. Cave,
J. Bates, and Y. Zhang.
1997.
Rapid differentiation of bovine and human tubercle bacilli based on a characteristic mutation in the bovine pyrazinamidase gene.
J. Clin. Microbiol.
35:106-110[Abstract].
|
| 15.
|
Scorpio, A.,
P. Lindholm-Levy,
L. Heifets,
R. Gilman,
S. Siddiqi,
M. Cynamon, and Y. Zhang.
1997.
Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
41:540-543[Abstract].
|
| 16.
|
Speirs, R. J.,
J. T. Welch, and M. H. Cynamon.
1995.
Activity of n-propyl pyrazinoate against pyrazinamide-resistant Mycobacterium tuberculosis: investigations into mechanism of action of and mechanism of resistance to pyrazinamide.
Antimicrob. Agents Chemother.
39:1269-1271[Abstract].
|
| 17.
|
Sreevatsan, S.,
X. Pan,
Y. Zhang,
B. N. Kreiswirth, and J. M. Musser.
1997.
Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms.
Antimicrob. Agents Chemother.
41:636-640[Abstract].
|
| 18.
|
Sun, Z. H.,
A. Scorpio, and Y. Zhang.
1997.
The pncA gene from the naturally pyrazinamide-resistant Mycobacterium avium encodes pyrazinamidase and confers pyrazinamide susceptibility to resistant M. tuberculosis complex organisms.
Microbiology
143:3367-3373[Abstract/Free Full Text].
|
| 19.
|
Tanigawa, Y.,
M. Shimoyama, and I. Ueda.
1980.
Nicotinamide deamidase from Flavobacterium peregrinum.
Methods Enzymol.
66:132-136[Medline].
|
| 20.
|
Tarnok, I., and E. Rohrscheidt.
1976.
Biochemical background of some enzymatic tests used for the differentiation of mycobacteria.
Tubercle
57:145-150[Medline].
|
| 21.
|
Tarshis, M. S., and W. A. Weed.
1953.
Lack of significant in vitro sensitivity of Mycobacterium tuberculosis to pyrazinamide on three different solid media.
Am. Rev. Tuberc.
67:391-395.
|
| 22.
|
Trivedi, S. S., and S. G. Desai.
1987.
Pyrazinamidase activity of Mycobacterium tuberculosis a test of sensitivity to pyrazinamide.
Tubercle
68:221-224[Medline].
|
| 23.
|
Wayne, L. G.
1974.
Simple pyrazinamidase and urease tests for routine identification of mycobacteria.
Am. Rev. Respir. Dis.
109:147-151[Medline].
|
| 24.
|
Witzig, R. S.,
B. A. Fazal,
R. M. Mera,
D. M. Mushatt,
P. M. Dejace,
D. L. Greer, and N. E. Hyslop.
1995.
Clinical manifestations and implications of coinfection with Mycobacterium kansasii and human immunodeficiency virus type 1.
Clin. Infect. Dis.
21:77-85[Medline].
|
| 25.
|
Zhang, Y.,
M. J. Garcia,
R. Lathigra,
B. Allen,
C. Moreno,
J. D. A. van Embden, and D. Young.
1992.
Alterations in the superoxide dismutase gene of an isoniazid-resistant strain of Mycobacterium tuberculosis.
Infect. Immun.
60:2160-2165[Abstract/Free Full Text].
|
| 26.
|
Zhang, Y.,
T. Garbe, and D. Young.
1993.
Transformation with katG restores isoniazid sensitivity in Mycobacterium tuberculosis isolates resistant to a range of drug concentrations.
Mol. Microbiol.
8:521-524[Medline].
|
| 27.
| Zhang, Y., A. Scorpio, H. Nikaido, and Z. Sun. Role
of acid pH and deficient efflux of pyrazinoic acid in the unique
susceptibility of Mycobacterium tuberculosis to the
front-line tuberculosis drug pyrazinamide. Submitted for publication.
|
Antimicrobial Agents and Chemotherapy, March 1999, p. 537-542, Vol. 43, No. 3
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Louw, G. E., Warren, R. M., Gey van Pittius, N. C., McEvoy, C. R. E., Van Helden, P. D., Victor, T. C.
(2009). A Balancing Act: Efflux/Influx in Mycobacterial Drug Resistance. Antimicrob. Agents Chemother.
53: 3181-3189
[Full Text]
-
Gu, P., Constantino, L., Zhang, Y.
(2008). Enhancement of the antituberculosis activity of weak acids by inhibitors of energy metabolism but not by anaerobiosis suggests that weak acids act differently from the front-line tuberculosis drug pyrazinamide. J Med Microbiol
57: 1129-1134
[Abstract]
[Full Text]
-
Ngo, S. C., Zimhony, O., Chung, W. J., Sayahi, H., Jacobs, W. R. Jr., Welch, J. T.
(2007). Inhibition of Isolated Mycobacterium tuberculosis Fatty Acid Synthase I by Pyrazinamide Analogs. Antimicrob. Agents Chemother.
51: 2430-2435
[Abstract]
[Full Text]
-
Field, S. K., Cowie, R. L.
(2006). Lung Disease Due to the More Common Nontuberculous Mycobacteria. Chest
129: 1653-1672
[Abstract]
[Full Text]
-
Zhang, Y., Zhang, H., Sun, Z.
(2003). Susceptibility of Mycobacterium tuberculosis to weak acids. J Antimicrob Chemother
52: 56-60
[Abstract]
[Full Text]
-
Boshoff, H. I., Mizrahi, V., Barry, C. E. III
(2002). Effects of Pyrazinamide on Fatty Acid Synthesis by Whole Mycobacterial Cells and Purified Fatty Acid Synthase I. J. Bacteriol.
184: 2167-2172
[Abstract]
[Full Text]
-
Boshoff, H. I. M., Mizrahi, V.
(2000). Expression of Mycobacterium smegmatis Pyrazinamidase in Mycobacterium tuberculosis Confers Hypersensitivity to Pyrazinamide and Related Amides. J. Bacteriol.
182: 5479-5485
[Abstract]
[Full Text]
-
Guo, M., Sun, Z., Zhang, Y.
(2000). Mycobacterium smegmatis Has Two Pyrazinamidase Enzymes, PncA and PzaA. J. Bacteriol.
182: 3881-3884
[Abstract]
[Full Text]
-
Cheng, S.-J., Thibert, L., Sanchez, T., Heifets, L., Zhang, Y.
(2000). pncA Mutations as a Major Mechanism of Pyrazinamide Resistance in Mycobacterium tuberculosis: Spread of a Monoresistant Strain in Quebec, Canada. Antimicrob. Agents Chemother.
44: 528-532
[Abstract]
[Full Text]