Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Briggs, C. E. Articles by Fratamico, P. M. Search for Related Content PubMed PubMed Citation Articles by Briggs, C. E. Articles by Fratamico, P. M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, April 1999, p. 846-849, Vol. 43, No. 4
0066-4804/99

Molecular Characterization of an Antibiotic Resistance Gene Cluster of Salmonella typhimurium DT104

Connie E. Briggs^* and Pina M. Fratamico

Agricultural Research Service, Eastern Regional Research Center, U.S. Department of Agriculture, Wyndmoor, Pennsylvania 19038

Received 27 July 1998/Returned for modification 9 November 1998/Accepted 29 January 1999

	ABSTRACT

Top Abstract Introduction Materials and Methods References

Salmonella typhimurium phage type DT104 has become an important emerging pathogen. Isolates of this phage type often possess resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline (ACSSuT resistance). The mechanism by which DT104 has accumulated resistance genes is of interest, since these genes interfere with treatment of DT104 infections and might be horizontally transferred to other bacteria, even to unrelated organisms. Previously, several laboratories have shown that the antibiotic resistance genes of DT104 are chromosomally encoded and involve integrons. The antibiotic resistance genes conferring the ACSSuT-resistant phenotype have been cloned and sequenced. These genes are grouped within two district integrons and intervening plasmid-derived sequences. This sequence is potentially useful for detection of multiresistant DT104.

	INTRODUCTION

Top Abstract Introduction Materials and Methods References

The emergence of pathogens possessing multiple-antibiotic resistance genes has become a major concern in recent years. The routine use of antibiotics in medical and agricultural circles has resulted in widespread antibiotic resistance and in the development of genetic mechanisms efficient for the dissemination of antibiotic gene cassettes, especially within and between species of gram-negative organisms (3, 10). The frequency of isolation of Salmonella strains resistant to one or more antibiotics has risen in the United Kingdom (8) and the United States (4). A recent newcomer to the food safety pathogen list, Salmonella typhimurium phage type DT104 often possesses resistance to multiple antibiotics, including ampicillin, tetracycline, chloramphenicol, sulfamethoxazole, and streptomycin (1, 8, 11, 13). Among the multiresistant salmonellae, DT104 is one of the most prevalent phage types of S. typhimurium in the United Kingdom (13) and is rapidly becoming the most prominent phage type in the United States, since 39 of 43 multiresistant isolates were DT104 or a closely related phage type in a 1994 to 1996 study (4). DT104 is a common infectious agent in cattle and has been contracted by humans exposed to infected cattle (14). DT104 may have become multiresistant as a result of antibiotic use in livestock (15). Organisms have often accumulated antibiotic resistance genes by plasmid transfer or by transposon- or integron-mediated mechanisms and have routinely harbored these resistance genes on plasmids (10). Notably, class 1 integrons have been found in many multiresistant organisms and many gram-negative species. These genetic elements often contain a 5' integrase gene and a 3' sul1 gene (encoding sulfamethoxazole resistance) and resistance gene cassettes separated by 59-bp stretches which are involved in the incorporation of additional cassettes within an integron (10). While these integrons have been plasmid borne in many instances (6), they have become chromosomally integrated in S. typhimurium DT104 (13). Chromosomal integration has been speculated to allow resistance genes to persist even in the absence of antibiotic selection (13). In Danish isolates of DT104, streptomycin, sulfonamide, and ampicillin resistance genes have been found grouped into at least two class 1 integrons which do not include the tetracycline and chloramphenicol resistance genes (11). The relative arrangement of these integrons and the location of the other resistance genes have not been established. In the present study, the arrangement is described for all five genes encoding streptomycin, chloramphenicol, tetracycline, ampicillin, and sulfamethoxazole resistances (aadA2, a cmlA homologue, tetA, bla_CARB-2, and sul1, respectively), and the implications of their arrangement are addressed.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods References

Isolates and preparation of DNA. S. typhimurium non-DT104 isolates and DT104 isolates were obtained from the U.S. Department of Agriculture (USDA), National Veterinary Services Laboratories (Athens, Ga.), National Animal Disease Center (Ames, Iowa), Food Safety and Inspection Service (Athens, Ga.), the Washington State Public Health Laboratories (Seattle, Wash.), the Centers for Disease Control and Prevention (CDC) (Atlanta, Ga.), and the Public Health Laboratory Service (London, United Kingdom) (Table 1). Control isolates were obtained from Michael Haas, Agricultural Research Service, USDA (LT2 isolate), Victor Cook, Food Safety and Inspection Service (isolate F4797), and the CDC (ASSuT-resistant Salmonella hadar; FSIS no. MF60404). Genomic DNA was prepared with the GNOME kit (Bio 101, La Jolla, Calif.). Plasmid DNA was prepared with the Qiagen (Santa Clarita, Calif.) plasmid Mini kit. DNA prepared from agarose gels was purified with the QIAEX II DNA extraction kit (Qiagen). All restriction enzymes were obtained from Promega (Madison, Wis.) or from New England Biolabs (Beverly, Mass.). All transformations were performed with high-efficiency JM109 Escherichia coli (Promega).

View this table: [in this window] [in a new window]   TABLE 1.   Antibiotic resistance profiles of S. typhimurium isolates used in this worka

Antibiotic disc diffusion testing of isolates. All isolates were tested by Kirby-Bauer disc diffusion tests on Mueller-Hinton agar (Difco, Detroit, Mich.) according to the standard procedure outlined in National Committee for Clinical Laboratory Standards guidelines (9). Antibiotic discs (BBL Sensi-Discs [Becton Dickinson, Cockeysville, Md.] and Dispens-O-Discs [Difco]) were used for ampicillin (30 µg), tetracycline (30 µg), chloramphenicol (30 µg), sulfisoxazole (300 µg), trimethoprim (5 µg), streptomycin (10 µg), and sulfamethoxazole × trimethoprim (25 µg) testing, and results were interpreted by using charts supplied with the discs. Eighteen S. typhimurium DT104 and 7 non-DT104 and 2 untyped isolates were tested for their antibiotic resistance profiles. All isolates fell into one of two groups, one including isolates resistant to ampicillin, streptomycin, sulfonamides, tetracycline, and chloramphenicol (ACSSuT resistant) and the other including non-chloramphenicol-resistant organisms (ASSuT resistant) (Table 1).

PCR amplification and cloning. Primers were synthesized by Gibco/BRL Life Technologies (Gaithersburg, Md.) or by the Nucleic Acid Facility, Thomas Jefferson Medical College (Philadelphia, Pa.). To expedite sequencing, amplifications of the Salmonella genes bla_CARB-2, aadA2, and sul1 (GenBank accession no. Z18955, Y14748, and Y14748, respectively) were performed, resulting in the production of PCR products which were 639, 522, and 839 bp, respectively. PCR was performed by using the PCR reagent system (no. 10198-018; Life Technologies, Gaithersburg, Md.). Eighty nanograms of genomic DNA, 20 mM Tris-Cl (pH 8.4), 50 mM KCl, 1.5 mM MgCl₂, 200 µM (each) deoxynucleoside triphosphate, 0.8 µM (each) primer, and 0.5 U of Taq polymerase in a 50-µl total reaction volume were subjected to PCR in a thermal cycler (model 9600; Perkin-Elmer, Foster City, Calif.) for 1 cycle at 95°C for 5 min, 30 cycles (95°C for 1 min, 60°C for 1 min, 72°C for 1 min), and 1 cycle at 72°C for 10 min and stored at 4°C. Primers had the following sequences: for bla_CARB-2, caatggcaatcagcgcttcccgtt (forward) and cgctctgccattgaagcctgtgtt (reverse); for aadA2, gtacggctccgcagtggatggcgg (forward) and gcccagtcggcagcgaca tccttc (reverse); for sul1, atggtgacggtgttcggcattctg (forward) and gctaggcatgatctaaccctcgg (reverse). Long PCR of genomic DNA was performed as directed by the manufacturer of the rTth DNA polymerase XL kit (Perkin-Elmer). Genomic DNA (80 ng/100-µl reaction mixture) was amplified by using the aadA2 forward primer and the bla_CARB-2 reverse primer and cycled at 1 cycle at 95°C for 5 min, 35 cycles (95°C for 1 min, 68°C for 1 min, and 72°C for 10 min), and 1 cycle at 72°C for 10 min. All PCR products were subjected to electrophoresis on 1% agarose gels in 1× TAE. Lambda HindIII/EcoRI markers (Promega) were used to estimate the sizes of the final products. A result was scored positive if a band of 10,036 bp was observed.

Pulsed-field gel electrophoresis and Southern blotting. Pulsed-field electrophoresis, digestion with XbaI, and Southern blotting were performed by using standard protocols (5, 12) and instructions within the manual supplied with the Bio-Rad CHEF Mapper XA. Probes were synthesized by using either primers and the enhanced chemiluminescence 3' oligolabeling and detection kit (Amersham Life Science, Buckinghamshire, England) or gel-purified bla_CARB-2, aadA2, or sul1 PCR products and the DIG High Prime Labeling and Detection Starter kit (Boehringer Mannheim, Indianapolis, Ind.). After the hybridization of duplicate blots with individual antibiotic resistance gene probes to the bla_CARB-2, aadA2 [also known as ant(3'')-Ia], and sul1 genes, a 10-kb fragment was determined to contain a complete aadA2 gene at its 5' end, an internal partial sul1 gene, and an incomplete 3' bla_CARB-2 gene, which extends beyond the 3' XbaI site.

Cloning and sequencing of genomic DNA. The 10-kb XbaI band which hybridized with antibiotic resistance gene probes was excised from a pulsed-field gel, purified, and cloned into the XbaI site of the SuperCos 1 vector (no. 251301; Stratagene, Cambridge, United Kingdom) to create p10Xba. The 10-kb insert was digested with PstI, and fragments of 4, 2.5, and 1 kb were cloned into PstI-digested pSp72 (Promega) and individually sequenced. A cloned 3-kb genomic fragment containing the entire bla_CARB-2 ampicillin resistance gene was obtained by digesting genomic DNA with PstI and cloning into the PstI site of pGFP-1 (Clontech, Palo Alto, Calif.) and selecting for colony growth on Luria-Bertani plates containing 100 µg of ampicillin/ml. PCR products of the purified bla_CARB-2, aadA2, or sul1 gene were cloned into the pGEM-T vector (Promega). All constructs were cycle sequenced in a Perkin-Elmer Cetus thermal cycler (model 9600) by using Sp6 and T7 primers or primers synthesized with the previous sequence information. Dideoxy sequencing was performed by the Nucleic Acid Facility at Thomas Jefferson Medical College with an Applied Biosystems model 373A or 377 DNA sequencing system (Perkin-Elmer). All sequences were verified by sequencing each region at least twice. All sequence information was obtained with DNA derived from the human clinical S. typhimurium DT104 isolate H3380. Sequences obtained were compared to those in the GenBank database (National Center for Biotechnology Information). The sequence information was employed to deduce the genomic arrangement of the antibiotic resistance genes.

Nucleotide sequence accession number. The sequence described in this work has been deposited in GenBank under accession no. AF071555.

	RESULTS AND DISCUSSION

Arrangement of antibiotic resistance genes and mechanism of gene acquisition. The aadA2, sul1, and bla_CARB-2 probes each hybridized to the same 10-kb XbaI fragment of genomic DNA (Southern blot not shown). The arrangement of the antibiotic resistance genes found within the multiresistant S. typhimurium isolate H3380 is shown in Fig. 1. The 13,078-bp sequence contains four resistance genes which are highly similar to GenBank sequence no. Y14748 (aadA2, sul1), S52437 (tetA), and Z18955 (bla_CARB-2) and which encode resistance to streptomycin, sulfonamides, tetracycline, and ampicillin, respectively (Table 2). The cmlA-like gene shows 97% identity (Fig. 2 and Table 2) with cmlA, which encodes an exporter nucleotide sequence found in Pseudomonas aeruginosa (GenBank accession no. M64556 [2]) and confers chloramphenicol resistance. The 13,078-bp fragment is composed of two class 1 integrons separated by an R plasmid sequence most closely related to plasmids of Pasteurella piscicida and Vibrio anguillarum (accession no. D37826 and S52437, respectively). The 5' integron is contained within a larger sequence which differs from that of the IncG plasmid pCG4 of Corynebacterium glutamicum (accession no. Y14748) by only 1 nucleotide. Both class 1 integrons possess the classical structure, as evidenced by the presence of a 5' integrase gene and a 3' sul1 gene, separated by an antibiotic resistance gene and a disinfectant resistance gene, qacE (accession no. Y14748). The aadA2 gene, the cmlA-like gene, tetA, and the bla_CARB-2 gene are all present within the same reading frame. Interestingly, an approximately 350-bp fragment with 83 to 92% identity to the groEL gene of Chromatium vinosum (accession no. M99443) is found adjacent to the 5' end of an integron described previously (InD) (11), is in the same reading frame as the integrase gene, which is only a partial gene, and is possibly expressed as a fusion protein with it. A region with 100% identity to an incomplete invertase gene (or a transposon resolvase) is found near the 5' end of the multiple-resistance gene arrangement. Thus, both integrons and the intervening resistance plasmid could be part of a larger transposon. Confirmation of this hypothesis must await cloning and sequencing of the flanking regions to determine if characteristic repeated sequences, such as those found at the junctions of transposon insertions, are present. In order to investigate whether this multiple gene configuration is characteristic of multiresistant DT104 isolates, 10 additional ACSSuT-resistant DT104 isolates, two phage type U302 isolates (possibly closely related to DT104) with the ACSSuT profile, one non-DT104 ACSSuT-resistant isolate, two DT104 ASSuT-resistant isolates, and an ACSSuT-resistant S. hadar isolate were tested by using a long PCR technique. Primers were chosen so that all sequences between the aadA2 and bla_CARB-2 genes would be included in the PCR product. All ACSSuT-resistant DT104 isolates possessed the expected 10-kb band, while those which lacked resistance to chloramphenicol or were multiresistant and non-DT104 (type 771 isolate) lacked this band (Table 1 and Fig. 3). This result was surprising for the ASSuT-resistant DT104 isolates, since these isolates possess the aadA2 gene, and long PCR with an aadA2 forward primer did not result in an amplification product. Cloning of flanking sequences is currently in progress. Sequencing of these regions may verify whether other integrons or gene arrangements exist and whether a larger transposon or phage-derived sequence or pathogenicity island (7) is the source of the resistance genes. It is not firmly established whether or not DT104 isolates typically possess increased virulence, a property which is independent of their multiple-antibiotic resistance. If genes for virulence were associated with those for antibiotic resistance, virulence would be selected for by antibiotic use. Additionally, the phage type U302 isolates tested in this study possessed additional resistance to kanamycin, gentamicin, and neomycin. One phage type U302 isolate possessed resistance to trimethoprim (data not shown). If the DT104 isolates possess an enhanced ability to incorporate plasmid-borne resistance genes into the antibiotic resistance gene cluster characterized in this work, a larger chromosomal multiresistance gene cluster may be generated. The transfer of such a multiresistance gene fragment to other pathogenic bacteria could result in a serious health concern. Furthermore, work needs to be done to determine if these multiresistant gene clusters are stable within bacterial genomes after antibiotics are withdrawn from the environment. An understanding of the antibiotic resistance gene arrangements in DT104 will probably have an appreciable impact on antibiotic use in agriculture and medicine.

View larger version (13K): [in this window] [in a new window]   FIG. 1.   Arrangement of antibiotic resistance genes of S. typhimurium DT104 isolate H3380 as deduced from the nucleic acid sequence described in this work. Black boxes represent 59-base elements.

View this table: [in this window] [in a new window]   TABLE 2.   Percent identity between S. typhimurium DT104 genes of isolate H3380 and entries within the GenBank database

View larger version (62K): [in this window] [in a new window]   FIG. 2.   Comparison of the chloramphenicol resistance gene product of an S. typhimurium DT104 isolate, H3380, to the most similar GenBank entry R10CMLA (PID: g151756); amino acids are indicated by their standard one-letter designations. The top row of sequence refers to the DT104 protein sequence. The bottom row is from a CmlA protein sequence of P. aeruginosa. The center line indicates amino acid identity when an amino acid is written, similarity when a plus symbol is present, and lack of similarity when nothing is written.

View larger version (68K): [in this window] [in a new window]   FIG. 3.   A representative result for the long PCR of S. typhimurium DT104 and non-DT104 isolates. Lane 1, MW markers; lanes 3, 5 to 7, and 12, (ACSSuT-resistant) DT104 (S3455, S2486, 13HP, H3380, and S2490, respectively); lanes 2, 4, 9, and 11, non-DT104 (F4797, S3426, S. hadar MF60404, and S3444, respectively); lanes 8 and 10, (ASSuT-resistant) DT104 (H3402 and S3461, respectively). A positive result is evidenced by the presence of a band of 10,036 bp.

	ACKNOWLEDGMENTS

We thank Hannes Alder (Nucleic Acid Facility at Thomas Jefferson Medical College, Philadelphia, Pa.) for providing technical advice, James Smith and Lance Bolton for helpful discussions, and Mike Haas and Ching-Hsing Liao for reviewing the manuscript.

	FOOTNOTES

^* Corresponding author. Mailing address: Agricultural Research Service, Eastern Regional Research Center, U.S. Department of Agriculture, Wyndmoor, PA 19038. Phone: (215) 233-6627. Fax: (215) 233-6559. E-mail: cbriggs{at}arserrc.gov.

	REFERENCES

Top Abstract Introduction Materials and Methods References

1.	Angulo, F. 1997. Multidrug-resistant Salmonella typhimurium definitive type 104. Emerg. Infect. Dis. 3:414.
2.	Bissonnette, L., S. Champetier, J. P. Buisson, and P. H. Roy. 1991. Characterization of the nonenzymatic chloramphenicol resistance (cmlA) gene of the In4 integron of Tn1696: similarity of the product to transmembrane transport proteins. J. Bacteriol. 173:4493-4502[Abstract/Free Full Text].
3.	Ferber, D. 1998. New hunt for the roots of resistance. Science 280:27[Free Full Text].
4.	Glynn, M. K., C. Bopp, W. Dewitt, P. Dabney, M. Molktar, and F. J. Angulo. 1998. Emergence of multidrug-resistant Salmonella enterica serotype typhimurium DT104 infections in the United States. N. Engl. J. Med. 338:1333-1338[Abstract/Free Full Text].
5.	Gunderson, K., and G. Chu. 1991. Pulsed-field electrophoresis of megabase-sized DNA. Mol. Cell. Biol. 11:3348-3354[Abstract/Free Full Text].
6.	Kazama, H., K. Kizu, M. Iwasaki, H. Hamashima, M. Sasatsu, and T. Arai. 1995. Isolation and structure of a new integron that includes a streptomycin resistance gene from the R plasmid of Pseudomonas aeruginosa. FEMS Microbiol. Lett. 134:137-141[Medline].
7.	Lee, C. 1996. Pathogenicity islands and the evolution of bacterial pathogens. Infect. Agents Dis. 5:1-7[Medline].
8.	Low, J. C., M. Angus, G. Hopkins, D. Munro, and S. C. Rankin. 1997. Antimicrobial resistance of Salmonella enterica typhimurium DT104 isolates and investigation of strains with transferable apramycin resistance. Epidemiol. Infect. 118:97-103[Medline].
9.	National Committee for Clinical Laboratory Standards. 1997. Performance standards for Antimicrobial Disk Susceptibility Tests, 6th ed. Approved Standard NCCLS document M2-A6. National Committee for Clinical Laboratory Standards, Villanova, Pa.
10.	Recchia, G. D., and R. M. Hall. 1995. Gene cassettes: a new class of mobile element. Microbiology 141:3015-3027[Free Full Text].
11.	Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterization of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica typhimurium DT104. FEMS Microbiol. Lett. 160:37-41[Medline].
12.	Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[Medline].
13.	Threlfall, E. J., J. A. Frost, L. R. Ward, and B. Rowe. 1994. Epidemic in cattle and humans of Salmonella typhimurium DT104 with chromosomally integrated multiple drug resistance. Vet. Rec. 134:577[Medline].
14.	Wall, P. G., D. Morgan, K. Lamden, M. Griffin, E. J. Threlfall, L. R. Ward, and B. Rowe. 1995. Transmission of multi-resistant Salmonella typhimurium from cattle to man. Vet. Rec. 136:591-592[Medline].
15.	Williams, R. J., and D. L. Heymann. 1998. Containment of antibiotic resistance. Science 279:1153-1154[Free Full Text].

---

Antimicrobial Agents and Chemotherapy, April 1999, p. 846-849, Vol. 43, No. 4
0066-4804/99

This article has been cited by other articles:

• Uchida, I., Ishihara, R., Tanaka, K., Hata, E., Makino, S.-i., Kanno, T., Hatama, S., Kishima, M., Akiba, M., Watanabe, A., Kubota, T. (2009). Salmonella enterica serotype Typhimurium DT104 ArtA-dependent modification of pertussis toxin-sensitive G proteins in the presence of [32P]NAD. Microbiology 155: 3710-3718 [Abstract] [Full Text]  
• Rayamajhi, N., Cha, S. B., Kang, M. L., Lee, S. I., Lee, H. S., Yoo, H. S. (2009). Inter- and Intraspecies Plasmid-Mediated Transfer of Florfenicol Resistance in Enterobacteriaceae Isolates from Swine. Appl. Environ. Microbiol. 75: 5700-5703 [Abstract] [Full Text]  
• Djordjevic, S. P., Cain, A. K., Evershed, N. J., Falconer, L., Levings, R. S., Lightfoot, D., Hall, R. M. (2009). Emergence and Evolution of Multiply Antibiotic-Resistant Salmonella enterica Serovar Paratyphi B D-Tartrate-Utilizing Strains Containing SGI1. Antimicrob. Agents Chemother. 53: 2319-2326 [Abstract] [Full Text]  
• Lindsey, R. L., Fedorka-Cray, P. J., Frye, J. G., Meinersmann, R. J. (2009). Inc A/C Plasmids Are Prevalent in Multidrug-Resistant Salmonella enterica Isolates. Appl. Environ. Microbiol. 75: 1908-1915 [Abstract] [Full Text]  
• Dorr, P. M., Tadesse, D. A., Zewde, B. M., Fry, P., Thakur, S., Gebreyes, W. A. (2009). Longitudinal Study of Salmonella Dispersion and the Role of Environmental Contamination in Commercial Swine Production Systems. Appl. Environ. Microbiol. 75: 1478-1486 [Abstract] [Full Text]  
• Levings, R. S., Djordjevic, S. P., Hall, R. M. (2008). SGI2, a Relative of Salmonella Genomic Island SGI1 with an Independent Origin. Antimicrob. Agents Chemother. 52: 2529-2537 [Abstract] [Full Text]  
• Foley, S. L., Lynne, A. M. (2008). Food animal-associated Salmonella challenges: Pathogenicity and antimicrobial resistance. J ANIM SCI 86: E173-E187 [Abstract] [Full Text]  
• Tuckman, M., Petersen, P. J., Howe, A. Y. M., Orlowski, M., Mullen, S., Chan, K., Bradford, P. A., Jones, C. H. (2007). Occurrence of Tetracycline Resistance Genes among Escherichia coli Isolates from the Phase 3 Clinical Trials for Tigecycline. Antimicrob. Agents Chemother. 51: 3205-3211 [Abstract] [Full Text]  
• Carlson, S. A., Sharma, V. K., McCuddin, Z. P., Rasmussen, M. A., Franklin, S. K. (2007). Involvement of a Salmonella Genomic Island 1 Gene in the Rumen Protozoan-Mediated Enhancement of Invasion for Multiple-Antibiotic-Resistant Salmonella enterica Serovar Typhimurium. Infect. Immun. 75: 792-800 [Abstract] [Full Text]  
• Levings, R. S., Partridge, S. R., Djordjevic, S. P., Hall, R. M. (2007). SGI1-K, a Variant of the SGI1 Genomic Island Carrying a Mercury Resistance Region, in Salmonella enterica Serovar Kentucky. Antimicrob. Agents Chemother. 51: 317-323 [Abstract] [Full Text]  
• Hermans, A. P. H. M., Beuling, A. M., van Hoek, A. H. A. M., Aarts, H. J. M., Abee, T., Zwietering, M. H. (2006). Distribution of prophages and SGI-1 antibiotic-resistance genes among different Salmonella enterica serovar Typhimurium isolates. Microbiology 152: 2137-2147 [Abstract] [Full Text]  
• Kehrenberg, C., Schwarz, S. (2006). Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates.. Antimicrob. Agents Chemother. 50: 1156-1163 [Abstract] [Full Text]  
• Wu, B., Xia, C., Du, X., Cao, X., Shen, J. (2006). Influence of Anti-FloR Antibody on Florfenicol Accumulation in Florfenicol-Resistant Escherichia coli and Enzyme-Linked Immunosorbent Assay for Detection of Florfenicol-Resistant E. coli Isolates. J. Clin. Microbiol. 44: 378-382 [Abstract] [Full Text]  
• Hermans, A. P. H. M., Abee, T., Zwietering, M. H., Aarts, H. J. M. (2005). Identification of Novel Salmonella enterica Serovar Typhimurium DT104-Specific Prophage and Nonprophage Chromosomal Sequences among Serovar Typhimurium Isolates by Genomic Subtractive Hybridization. Appl. Environ. Microbiol. 71: 4979-4985 [Abstract] [Full Text]  
• Saitoh, M., Tanaka, K., Nishimori, K., Makino, S.-i., Kanno, T., Ishihara, R., Hatama, S., Kitano, R., Kishima, M., Sameshima, T., Akiba, M., Nakazawa, M., Yokomizo, Y., Uchida, I. (2005). The artAB genes encode a putative ADP-ribosyltransferase toxin homologue associated with Salmonella enterica serovar Typhimurium DT104. Microbiology 151: 3089-3096 [Abstract] [Full Text]  
• Rasmussen, M. A., Carlson, S. A., Franklin, S. K., McCuddin, Z. P., Wu, M. T., Sharma, V. K. (2005). Exposure to Rumen Protozoa Leads to Enhancement of Pathogenicity of and Invasion by Multiple-Antibiotic-Resistant Salmonella enterica Bearing SGI1. Infect. Immun. 73: 4668-4675 [Abstract] [Full Text]  
• Braibant, M., Chevalier, J., Chaslus-Dancla, E., Pages, J.-M., Cloeckaert, A. (2005). Structural and Functional Study of the Phenicol-Specific Efflux Pump FloR Belonging to the Major Facilitator Superfamily. Antimicrob. Agents Chemother. 49: 2965-2971 [Abstract] [Full Text]  
• Levings, R. S., Lightfoot, D., Partridge, S. R., Hall, R. M., Djordjevic, S. P. (2005). The Genomic Island SGI1, Containing the Multiple Antibiotic Resistance Region of Salmonella enterica Serovar Typhimurium DT104 or Variants of It, Is Widely Distributed in Other S. enterica Serovars. J. Bacteriol. 187: 4401-4409 [Abstract] [Full Text]  
• Amavisit, P., Boonyawiwat, W., Bangtrakulnont, A. (2005). Characterization of Salmonella enterica Serovar Typhimurium and Monophasic Salmonella Serovar 1,4,[5],12:i:- Isolates in Thailand. J. Clin. Microbiol. 43: 2736-2740 [Abstract] [Full Text]  
• Gaze, W. H., Abdouslam, N., Hawkey, P. M., Wellington, E. M. H. (2005). Incidence of Class 1 Integrons in a Quaternary Ammonium Compound-Polluted Environment. Antimicrob. Agents Chemother. 49: 1802-1807 [Abstract] [Full Text]  
• Doublet, B., Schwarz, S., Kehrenberg, C., Cloeckaert, A. (2005). Florfenicol Resistance Gene floR Is Part of a Novel Transposon. Antimicrob. Agents Chemother. 49: 2106-2108 [Abstract] [Full Text]  
• Gebreyes, W. A., Thakur, S. (2005). Multidrug-Resistant Salmonella enterica Serovar Muenchen from Pigs and Humans and Potential Interserovar Transfer of Antimicrobial Resistance. Antimicrob. Agents Chemother. 49: 503-511 [Abstract] [Full Text]  
• Toleman, M. A., Biedenbach, D., Bennett, D. M. C., Jones, R. N., Walsh, T. R. (2005). Italian metallo-{beta}-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme. J Antimicrob Chemother 55: 61-70 [Abstract] [Full Text]  
• Baucheron, S., Tyler, S., Boyd, D., Mulvey, M. R., Chaslus-Dancla, E., Cloeckaert, A. (2004). AcrAB-TolC Directs Efflux-Mediated Multidrug Resistance in Salmonella enterica Serovar Typhimurium DT104. Antimicrob. Agents Chemother. 48: 3729-3735 [Abstract] [Full Text]  
• Doublet, B., Weill, F.-X., Fabre, L., Chaslus-Dancla, E., Cloeckaert, A. (2004). Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster Containing a Novel 3'-N-Aminoglycoside Acetyltransferase Gene Cassette, aac(3)-Id, in Salmonella enterica Serovar Newport. Antimicrob. Agents Chemother. 48: 3806-3812 [Abstract] [Full Text]  
• Petroni, A., Melano, R. G., Saka, H. A., Garutti, A., Mange, L., Pasteran, F., Rapoport, M., Miranda, M., Faccone, D., Rossi, A., Hoffman, P. S., Galas, M. F. (2004). CARB-9, a Carbenicillinase Encoded in the VCR Region of Vibrio cholerae Non-O1, Non-O139 Belongs to a Family of Cassette-Encoded {beta}-Lactamases. Antimicrob. Agents Chemother. 48: 4042-4046 [Abstract] [Full Text]  
• Yang, H., Chen, S., White, D. G., Zhao, S., McDermott, P., Walker, R., Meng, J. (2004). Characterization of Multiple-Antimicrobial-Resistant Escherichia coli Isolates from Diseased Chickens and Swine in China. J. Clin. Microbiol. 42: 3483-3489 [Abstract] [Full Text]  
• Mulvey, M. R., Boyd, D. A., Baker, L., Mykytczuk, O., Reis, E. M. F., Asensi, M. D., Rodrigues, D. P., Ng, L.-K. (2004). Characterization of a Salmonella enterica serovar Agona strain harbouring a class 1 integron containing novel OXA-type {beta}-lactamase (blaOXA-53) and 6'-N-aminoglycoside acetyltransferase genes [aac(6')-I30]. J Antimicrob Chemother 54: 354-359 [Abstract] [Full Text]  
• Doublet, B., Butaye, P., Imberechts, H., Boyd, D., Mulvey, M. R., Chaslus-Dancla, E., Cloeckaert, A. (2004). Salmonella Genomic Island 1 Multidrug Resistance Gene Clusters in Salmonella enterica Serovar Agona Isolated in Belgium in 1992 to 2002. Antimicrob. Agents Chemother. 48: 2510-2517 [Abstract] [Full Text]  
• O'Halloran, F., Lucey, B., Cryan, B., Buckley, T., Fanning, S. (2004). Molecular characterization of class 1 integrons from Irish thermophilic Campylobacter spp.. J Antimicrob Chemother 53: 952-957 [Abstract] [Full Text]  
• Gebreyes, W. A., Thakur, S., Davies, P. R., Funk, J. A., Altier, C. (2004). Trends in antimicrobial resistance, phage types and integrons among Salmonella serotypes from pigs, 1997-2000. J Antimicrob Chemother 53: 997-1003 [Abstract] [Full Text]  
• Daly, M., Buckley, J., Power, E., Fanning, S. (2004). Evidence for a Chromosomally Located Third Integron in Salmonella enterica Serovar Typhimurium DT104b. Antimicrob. Agents Chemother. 48: 1350-1352 [Abstract] [Full Text]  
• Randall, L. P., Cooles, S. W., Osborn, M. K., Piddock, L. J. V., Woodward, M. J. (2004). Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother 53: 208-216 [Abstract] [Full Text]  
• Chen, S., Zhao, S., White, D. G., Schroeder, C. M., Lu, R., Yang, H., McDermott, P. F., Ayers, S., Meng, J. (2004). Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats. Appl. Environ. Microbiol. 70: 1-7 [Abstract] [Full Text]  
• Blickwede, M., Schwarz, S. (2004). Molecular analysis of florfenicol-resistant Escherichia coli isolates from pigs. J Antimicrob Chemother 53: 58-64 [Abstract] [Full Text]  
• Kristiansen, M. A. M., Sandvang, D., Rasmussen, T. B. (2003). In Vivo Development of Quinolone Resistance in Salmonella enterica Serotype Typhimurium DT104. J. Clin. Microbiol. 41: 4462-4464 [Abstract] [Full Text]  
• Faldynova, M., Pravcova, M., Sisak, F., Havlickova, H., Kolackova, I., Cizek, A., Karpiskova, R., Rychlik, I. (2003). Evolution of Antibiotic Resistance in Salmonella enterica Serovar Typhimurium Strains Isolated in the Czech Republic between 1984 and 2002. Antimicrob. Agents Chemother. 47: 2002-2005 [Abstract] [Full Text]  
• Sabtcheva, S., Galimand, M., Gerbaud, G., Courvalin, P., Lambert, T. (2003). Aminoglycoside Resistance Gene ant(4')-IIb of Pseudomonas aeruginosa BM4492, a Clinical Isolate from Bulgaria. Antimicrob. Agents Chemother. 47: 1584-1588 [Abstract] [Full Text]  
• Lu, J., Sanchez, S., Hofacre, C., Maurer, J. J., Harmon, B. G., Lee, M. D. (2003). Evaluation of Broiler Litter with Reference to the Microbial Composition as Assessed by Using 16S rRNA and Functional Gene Markers. Appl. Environ. Microbiol. 69: 901-908 [Abstract] [Full Text]  
• Lindstedt, B.-A., Heir, E., Nygard, I., Kapperud, G. (2003). Characterization of class I integrons in clinical strains of Salmonella enterica subsp. enterica serovars Typhimurium and Enteritidis from Norwegian hospitals. J Med Microbiol 52: 141-149 [Abstract] [Full Text]  
• Partridge, S. R., Hall, R. M. (2003). In34, a Complex In5 Family Class 1 Integron Containing orf513 and dfrA10. Antimicrob. Agents Chemother. 47: 342-349 [Abstract] [Full Text]  
• Frech, G., Kehrenberg, C., Schwarz, S. (2003). Resistance phenotypes and genotypes of multiresistant Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen isolates from animal sources. J Antimicrob Chemother 51: 180-182 [Full Text]  
• Lee, M. D., Sanchez, S., Zimmer, M., Idris, U., Berrang, M. E., McDermott, P. F. (2002). Class 1 Integron-Associated Tobramycin-Gentamicin Resistance in Campylobacter jejuni Isolated from the Broiler Chicken House Environment. Antimicrob. Agents Chemother. 46: 3660-3664 [Abstract] [Full Text]  
• Carattoli, A., Filetici, E., Villa, L., Dionisi, A. M., Ricci, A., Luzzi, I. (2002). Antibiotic Resistance Genes and Salmonella Genomic Island 1 in Salmonella enterica Serovar Typhimurium Isolated in Italy. Antimicrob. Agents Chemother. 46: 2821-2828 [Abstract] [Full Text]  
• Guerra, B., Soto, S., Helmuth, R., Mendoza, M. C. (2002). Characterization of a Self-Transferable Plasmid from Salmonella enterica Serotype Typhimurium Clinical Isolates Carrying Two Integron-Borne Gene Cassettes Together with Virulence and Drug Resistance Genes. Antimicrob. Agents Chemother. 46: 2977-2981 [Abstract] [Full Text]  
• Gebreyes, W. A., Altier, C. (2002). Molecular Characterization of Multidrug-Resistant Salmonella enterica subsp. enterica Serovar Typhimurium Isolates from Swine. J. Clin. Microbiol. 40: 2813-2822 [Abstract] [Full Text]  
• Boyd, D., Cloeckaert, A., Chaslus-Dancla, E., Mulvey, M. R. (2002). Characterization of Variant Salmonella Genomic Island 1 Multidrug Resistance Regions from Serovars Typhimurium DT104 and Agona. Antimicrob. Agents Chemother. 46: 1714-1722 [Abstract] [Full Text]  
• Partridge, S. R., Brown, H. J., Hall, R. M. (2002). Characterization and Movement of the Class 1 Integron Known as Tn2521 and Tn1405. Antimicrob. Agents Chemother. 46: 1288-1294 [Abstract] [Full Text]  
• Doublet, B., Schwarz, S., Nu{beta}beck, E., Baucheron, S., Martel, J.-L., Chaslus-Dancla, E., Cloeckaert, A. (2002). Molecular analysis of chromosomally florfenicol-resistant Escherichia coli isolates from France and Germany. J Antimicrob Chemother 49: 49-54 [Abstract] [Full Text]  
• Dalsgaard, A., Forslund, A., Sandvang, D., Arntzen, L., Keddy, K. (2001). Vibrio cholerae O1 outbreak isolates in Mozambique and South Africa in 1998 are multiple-drug resistant, contain the SXT element and the aadA2 gene located on class 1 integrons. J Antimicrob Chemother 48: 827-838 [Abstract] [Full Text]  
• Hochhut, B., Lotfi, Y., Mazel, D., Faruque, S. M., Woodgate, R., Waldor, M. K. (2001). Molecular Analysis of Antibiotic Resistance Gene Clusters in Vibrio cholerae O139 and O1 SXT Constins. Antimicrob. Agents Chemother. 45: 2991-3000 [Abstract] [Full Text]  
• Partridge, S. R., Recchia, G. D., Stokes, H. W., Hall, R. M. (2001). Family of Class 1 Integrons Related to In4 from Tn1696. Antimicrob. Agents Chemother. 45: 3014-3020 [Abstract] [Full Text]  
• Winokur, P. L., Vonstein, D. L., Hoffman, L. J., Uhlenhopp, E. K., Doern, G. V. (2001). Evidence for Transfer of CMY-2 AmpC {beta}-Lactamase Plasmids between Escherichia coli and Salmonella Isolates from Food Animals and Humans. Antimicrob. Agents Chemother. 45: 2716-2722 [Abstract] [Full Text]  
• Boyd, D., Peters, G. A., Cloeckaert, A., Boumedine, K. S., Chaslus-Dancla, E., Imberechts, H., Mulvey, M. R. (2001). Complete Nucleotide Sequence of a 43-Kilobase Genomic Island Associated with the Multidrug Resistance Region of Salmonella enterica Serovar Typhimurium DT104 and Its Identification in Phage Type DT120 and Serovar Agona. J. Bacteriol. 183: 5725-5732 [Abstract] [Full Text]  
• Cloeckaert, A., Baucheron, S., Chaslus-Dancla, E. (2001). Nonenzymatic Chloramphenicol Resistance Mediated by IncC Plasmid R55 Is Encoded by a floR Gene Variant. Antimicrob. Agents Chemother. 45: 2381-2382 [Abstract] [Full Text]  
• Carlson, S. A., Frana, T. S., Griffith, R. W. (2001). Antibiotic Resistance in Salmonella enterica Serovar Typhimurium Exposed to Microcin-Producing Escherichia coli. Appl. Environ. Microbiol. 67: 3763-3766 [Abstract] [Full Text]  
• Izumiya, H., Terajima, J., Matsushita, S., Tamura, K., Watanabe, H. (2001). Characterization of Multidrug-Resistant Salmonella enterica Serovar Typhimurium Isolated in Japan. J. Clin. Microbiol. 39: 2700-2703 [Abstract] [Full Text]  
• Chopra, I., Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev. 65: 232-260 [Abstract] [Full Text]  
• Guerra, B., Soto, S. M., Argüelles, J. M., Mendoza, M. C. (2001). Multidrug Resistance Is Mediated by Large Plasmids Carrying a Class 1 Integron in the Emergent Salmonella enterica Serotype [4,5,12:i:{-}]. Antimicrob. Agents Chemother. 45: 1305-1308 [Abstract] [Full Text]  
• Walker, R. A., Saunders, N., Lawson, A. J., Lindsay, E. A., Dassama, M., Ward, L. R., Woodward, M. J., Davies, R. H., Liebana, E., Threlfall, E. J. (2001). Use of a LightCycler gyrA Mutation Assay for Rapid Identification of Mutations Conferring Decreased Susceptibility to Ciprofloxacin in Multiresistant Salmonella enterica Serotype Typhimurium DT104 Isolates. J. Clin. Microbiol. 39: 1443-1448 [Abstract] [Full Text]  
• Namwat, W., Lee, C.-K., Kinoshita, H., Yamada, Y., Nihira, T. (2001). Identification of the varR Gene as a Transcriptional Regulator of Virginiamycin S Resistance in Streptomyces virginiae. J. Bacteriol. 183: 2025-2031 [Abstract] [Full Text]  
• Cruchaga, S., Echeita, A., Aladuena, A., Garcia-Pena, J., Frias, N., Usera, M. A. (2001). Antimicrobial resistance in salmonellae from humans, food and animals in Spain in 1998. J Antimicrob Chemother 47: 315-321 [Abstract] [Full Text]  
• Frana, T. S., Carlson, S. A., Griffith, R. W. (2001). Relative Distribution and Conservation of Genes Encoding Aminoglycoside-Modifying Enzymes in Salmonella enterica Serotype Typhimurium Phage Type DT104. Appl. Environ. Microbiol. 67: 445-448 [Abstract] [Full Text]  
• Naas, T., Mikami, Y., Imai, T., Poirel, L., Nordmann, P. (2001). Characterization of In53, a Class 1 Plasmid- and Composite Transposon-Located Integron of Escherichia coli Which Carries an Unusual Array of Gene Cassettes. J. Bacteriol. 183: 235-249 [Abstract] [Full Text]  
• Breuil, J., Brisabois, A., Casin, I., Armand-Lefevre, L., Fremy, S., Collatz, E. (2000). Antibiotic resistance in salmonellae isolated from humans and animals in France: comparative data from 1994 and 1997. J Antimicrob Chemother 46: 965-971 [Abstract] [Full Text]  
• White, D. G., Hudson, C., Maurer, J. J., Ayers, S., Zhao, S., Lee, M. D., Bolton, L., Foley, T., Sherwood, J. (2000). Characterization of Chloramphenicol and Florfenicol Resistance in Escherichia coli Associated with Bovine Diarrhea. J. Clin. Microbiol. 38: 4593-4598 [Abstract] [Full Text]  
• Gebreyes, W. A., Davies, P. R., Morrow, W. E. M., Funk, J. A., Altier, C. (2000). Antimicrobial Resistance of Salmonella Isolates from Swine. J. Clin. Microbiol. 38: 4633-4636 [Abstract] [Full Text]  
• Daly, M., Fanning, S. (2000). Characterization and Chromosomal Mapping of Antimicrobial Resistance Genes in Salmonella enterica Serotype Typhimurium. Appl. Environ. Microbiol. 66: 4842-4848 [Abstract] [Full Text]  
• Winokur, P. L., Brueggemann, A., DeSalvo, D. L., Hoffmann, L., Apley, M. D., Uhlenhopp, E. K., Pfaller, M. A., Doern, G. V. (2000). Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC beta -Lactamase. Antimicrob. Agents Chemother. 44: 2777-2783 [Abstract] [Full Text]  
• Cloeckaert, A., Baucheron, S., Flaujac, G., Schwarz, S., Kehrenberg, C., Martel, J.-L., Chaslus-Dancla, E. (2000). Plasmid-Mediated Florfenicol Resistance Encoded by the floR Gene in Escherichia coli Isolated from Cattle. Antimicrob. Agents Chemother. 44: 2858-2860 [Abstract] [Full Text]  
• Guerra, B., Soto, S., Cal, S., Mendoza, M. C. (2000). Antimicrobial Resistance and Spread of Class 1 Integrons among Salmonella Serotypes. Antimicrob. Agents Chemother. 44: 2166-2169 [Abstract] [Full Text]  
• Threlfall, E. J. (2000). Epidemic Salmonella typhimurium DT 104--a truly international multiresistant clone. J Antimicrob Chemother 46: 7-10 [Full Text]  
• Dalsgaard, A., Forslund, A., Serichantalergs, O., Sandvang, D. (2000). Distribution and Content of Class 1 Integrons in Different Vibrio cholerae O-Serotype Strains Isolated in Thailand. Antimicrob. Agents Chemother. 44: 1315-1321 [Abstract] [Full Text]  
• Cloeckaert, A., Sidi Boumedine, K., Flaujac, G., Imberechts, H., D'Hooghe, I., Chaslus-Dancla, E. (2000). Occurrence of a Salmonella enterica Serovar Typhimurium DT104-Like Antibiotic Resistance Gene Cluster Including the floR Gene in S. enterica Serovar Agona. Antimicrob. Agents Chemother. 44: 1359-1361 [Abstract] [Full Text]  
• Hudson, C. R., Quist, C., Lee, M. D., Keyes, K., Dodson, S. V., Morales, C., Sanchez, S., White, D. G., Maurer, J. J. (2000). Genetic Relatedness of Salmonella Isolates from Nondomestic Birds in Southeastern United States. J. Clin. Microbiol. 38: 1860-1865 [Abstract] [Full Text]  
• Fey, P. D., Safranek, T. J., Rupp, M. E., Dunne, E. F., Ribot, E., Iwen, P. C., Bradford, P. A., Angulo, F. J., Hinrichs, S. H. (2000). Ceftriaxone-Resistant Salmonella Infection Acquired by a Child from Cattle. NEJM 342: 1242-1249 [Abstract] [Full Text]  
• Poirel, L., Le Thomas, I., Naas, T., Karim, A., Nordmann, P. (2000). Biochemical Sequence Analyses of GES-1, a Novel Class A Extended-Spectrum beta -Lactamase, and the Class 1 Integron In52 from Klebsiella pneumoniae. Antimicrob. Agents Chemother. 44: 622-632 [Abstract] [Full Text]  
• Keyes, K., Hudson, C., Maurer, J. J., Thayer, S., White, D. G., Lee, M. D. (2000). Detection of Florfenicol Resistance Genes in Escherichia coli Isolated from Sick Chickens. Antimicrob. Agents Chemother. 44: 421-424 [Abstract] [Full Text]  
• Daly, M., Buckley, J., Power, E., O'Hare, C., Cormican, M., Cryan, B., Wall, P. G., Fanning, S. (2000). Molecular Characterization of Irish Salmonella enterica Serotype Typhimurium: Detection of Class I Integrons and Assessment of Genetic Relationships by DNA Amplification Fingerprinting. Appl. Environ. Microbiol. 66: 614-619 [Abstract] [Full Text]  
• Bass, L., Liebert, C. A., Lee, M. D., Summers, A. O., White, D. G., Thayer, S. G., Maurer, J. J. (1999). Incidence and Characterization of Integrons, Genetic Elements Mediating Multiple-Drug Resistance, in Avian Escherichia coli. Antimicrob. Agents Chemother. 43: 2925-2929 [Abstract] [Full Text]  
• Ng, L.-K., Mulvey, M. R., Martin, I., Peters, G. A., Johnson, W. (1999). Genetic Characterization of Antimicrobial Resistance in Canadian Isolates of Salmonella Serovar Typhimurium DT104. Antimicrob. Agents Chemother. 43: 3018-3021 [Abstract] [Full Text]  
• Schnabel, E. L., Jones, A. L. (1999). Distribution of Tetracycline Resistance Genes and Transposons among Phylloplane Bacteria in Michigan Apple Orchards. Appl. Environ. Microbiol. 65: 4898-4907 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Briggs, C. E. Articles by Fratamico, P. M. Search for Related Content PubMed PubMed Citation Articles by Briggs, C. E. Articles by Fratamico, P. M.