Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, April 1999, p. 925-929, Vol. 43, No. 4
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A New Resistance Gene, linB, Conferring
Resistance to Lincosamides by Nucleotidylation in
Enterococcus faecium HM1025
Bülent
Bozdogan,1,2
Latifa
Berrezouga,1
Ming-Shang
Kuo,3
David A.
Yurek,3
Kathleen A.
Farley,3
Brian J.
Stockman,3 and
Roland
Leclercq1,2,*
Service de Bactériologie-Virologie,
Hôpital Henri Mondor
Université Paris XII, 94000 Créteil,1 and Service de
Microbiologie, Hôpital Côte de Nacre, Université de
Caen, 14033 Caen,2 France, and
Pharmacia and Upjohn, Kalamazoo, Michigan
490023
Received 3 August 1998/Returned for modification 15 September
1998/Accepted 6 January 1999
 |
ABSTRACT |
Resistance to lincomycin and clindamycin in the clinical isolate
Enterococcus faecium HM1025 is due to a ribosomal methylase encoded by an ermAM-like gene and the plasmid-mediated
inactivation of these antibiotics. We have cloned and determined the
nucleotide sequence of the gene responsible for the inactivation of
lincosamides, linB. This gene encodes a 267-amino-acid
lincosamide nucleotidyltransferase. The enzyme catalyzes
3-(5'-adenylation) (the adenylation of the hydroxyl group in position 3 of the molecules) of lincomycin and clindamycin. Expression of
linB was observed in both Escherichia coli and
Staphylococcus aureus. The deduced amino acid sequence of
the enzyme did not display any significant homology with staphylococcal nucleotidyltransferases encoded by linA and
linA' genes. Sequences homologous to linB were
found in 14 other clinical isolates of E. faecium,
indicating the spread of the resistance trait in this species.
 |
INTRODUCTION |
Lincosamide antibiotics include
lincomycin, naturally produced by several actinomycetes, and
clindamycin, a semisynthetic derivative obtained by the
chlorination of lincomycin. These antibiotics are active against many
gram-positive cocci and anaerobes; they inhibit protein synthesis by
blocking the peptidyltransferase activity of the 50S subunit of the
bacterial ribosome (11). Resistance to lincosamides is
usually due to alteration of the ribosome following the N6
dimethylation of a specific adenine in the 23S rRNA, which confers cross-resistance to macrolide, lincosamide, and streptogramin B type
antibiotics, i.e., the MLSB phenotype (22, 32). In contrast
to this broad-spectrum resistance, resistance specific to lincosamides,
gained by bacterial modification of those antibiotics, has been
reported. Phosphorylation (1) and nucleotidylation (2,
26) of the hydroxyl group in position 3 of lincosamide molecules
(24, 26) have been detected in several species of Streptomyces. Inactivation of lincosamides was also observed
in strains of staphylococci, streptococci, enterococci, and
lactobacilli of animal origin (10, 12, 13) and in
staphylococci isolated from humans (5, 20, 21). Clinical
isolates of Staphylococcus haemolyticus BM4610 and
Staphylococcus aureus BM4611 are highly resistant to
lincomycin (MIC = 64 µg/ml) and are apparently susceptible to
clindamycin (MIC = 0.12 µg/ml). In these strains, lincosamide O-nucleotidyltransferases encoded by two closely related
genes named linA (lincosamide inactivation nucleotidylation)
and linA', respectively, were characterized (4,
5). These genes encode two 161-amino-acid isoenzymes that differ
by 14 amino acids. These enzymes inactivate lincomycin and
clindamycin by converting them to lincomycin 3-(5'-adenylate) and
clindamycin 4-(5'-adenylate) by using ATP, GTP, CTP, or UTP as a
nucleotidyl donor and MgCl2 as a cofactor (5).
The distribution of linA and linA' genes was
studied by using DNA-DNA hybridization, and related sequences were
found in strains belonging to various species of staphylococci (20).
In this paper, we report the nucleotide sequence of a new
linB gene that confers resistance to lincosamides on a
clinical strain of Enterococcus faecium, HM1025, by
inactivating the compounds, and we further report on our study of the
biochemical mechanism of the resistance.
 |
MATERIALS AND METHODS |
Bacterial strains.
Five hundred eight enterococci of various
species isolated from patients at the Henri Mondor Hospital were
screened for inactivation of clindamycin with Gots' test, as
previously described (17, 21). Fourteen of the 110 strains
of E. faecium tested were found to inactivate clindamycin.
One of these strains, E. faecium HM1025, was studied
further. Species identification was based on the biochemical scheme of
Facklam and Collins (15). S. haemolyticus BM4610
harboring linA, S. aureus BM4611 harboring
linA', and the recombinant plasmids pAT221 (linA)
and pAT24 (linA') were used as positive controls in
hybridization experiments (5, 6). Strains were grown in
brain heart infusion broth and agar (Sanofi Diagnostics Pasteur, Marnes-la-Coquette, France). All strains were incubated at 37°C.
Antibiotic susceptibility testing.
Susceptibility to
antibiotics was determined by the disk diffusion technique. MICs of
antibiotics were determined by the agar dilution method using
Mueller-Hinton medium (Sanofi Diagnostics Pasteur) (8).
Inactivation of lincosamides.
The kinetics of the
inactivation of clindamycin by resting cells were determined in liquid
medium as previously described (21). E. faecium
cells suspended in 0.01 M phosphate buffer (pH 7) containing 20 µg of
clindamycin or lincomycin per ml were incubated at 37°C for various
periods of time. The pH of this suspension remained constant.
Inactivation of lincosamides was followed by a bioassay with
Micrococcus luteus ATCC 9341 as the indicator organism
(21).
For preparation of modified clindamycin and lincomycin, cells of
E. faecium HM1025 were treated with 500 µg of lysozyme per ml and lysed by sonication. Cell debris was removed by centrifugation at 40,000 × g for 45 min. Clindamycin and lincomycin
(500 µg/ml) were then incubated in the supernatants at 37°C for
18 h in the presence of ATP (2.5 mM) and MgCl2 (50 mM). Inactivation of antibiotics was monitored as indicated above.
Aliquots of inactivated clindamycin and lincomycin were freeze-dried.
High-pressure liquid chromatography-UV-MS experiments.
Samples of freeze-dried inactivated clindamycin and lincomycin, and the
control samples, were each dissolved in 1 ml of 10% methanol in 2 mM
ammonium acetate. A 5-µl aliquot was injected onto a 2.1- by 150-mm
Waters Symmetry C18 column at 35°C in a 0.4-ml/min flow
of 5% methanol in 2 mM ammonium acetate. After 1 min, the
concentration of methanol was gradually increased to reach 95% at 11 min and was then held at this level for 4 min. Column effluent was
monitored by mass spectrometry (MS) (unit resolution, 150 to 800 atomic mass units [amu]) with a Sciex API 300 instrument equipped
with a heated nebulizer source. Under these conditions, clindamycin
(424/426 amu) was eluted at 13.8 min, clindamycin B (410/412 amu) was
eluted at 13.3 min, clindamycin adenylate (753/755 amu) was eluted at
11.7 min, and clindamycin B adenylate (739/741 amu) was eluted at 11.3 min. Lincomycin (406 amu) was eluted at 12.1 min, and lincomycin
adenylate (735 amu) was eluted at 9.9 min. For sample purification, the
inactivated solutions were concentrated to dryness, redissolved in
methanol-water (1:9), evenly divided into 10 batches, and loaded into
10 SepPak (C8) cartridges prewashed with methanol and
reequilibrated with water. The resins were washed with a stepwise
gradient (25% increment/step) from water to methanol. It was found
that the 50% methanol-water fraction contains the majority of mass
for both inactivated lincomycin and inactivated clindamycin solutions.
Analytical high-pressure liquid chromatography-UV-MS confirmed that
the material which was eluted at 50% methanol-water was pure.
NMR experiments.
Samples for nuclear magnetic resonance
(NMR) testing were prepared with approximately 40 mg of either
inactivated clindamycin or inactivated lincomycin isolate dissolved in
600 µl of dimethyl sulfoxide-d6 (Isotec; 99.96% D) and
placed in a standard 5-mm NMR tube (Wilmad). The proton, correlated
spectroscopy, g-HMQC (gradient heteronuclear multiple quantum
correlation), g-HMBC (gradient heteronuclear multiple bond
correlation), and carbon spectra for each sample were recorded with a
Bruker DRX 500 spectrometer operating at 499.90 MHz for 1H
and 125.70 MHz for 13C. The spectrometer was equipped with
a 5-mm Bruker broad-band probe with a z-axis gradient
equilibrated at 27°C. Pulses for 1H and 13C
were calibrated at 9.3 and 8.5 µs, respectively. The proton spectra
were recorded by using 32,000 real data points, a spectral width of
7,507 Hz, and a recycle time of 5 s. The 1H-decoupled
carbon spectra were recorded by using a 33° 13C pulse,
WALTZ-16 decoupling, 32,000 real data points, a spectrum width of
31,446 Hz, and a recycle delay of 1 s. Two-dimensional data were
typically acquired as 2,048- by 128-point matrices which were zero
filled to 2,048 by 1,024 points during data processing. The chemical
shifts were referenced relative to dimethyl sulfoxide-d5:
= 2.49 for 1H and 39.5 for 13C.
Genetic techniques.
Enterococcus faecalis JH2-2 was
used in mating experiments as a recipient strain. Matings were
performed on filters as previously described (19). The
antibiotics used for selection of transconjugants were rifampin (100 µg/ml), fusidic acid (50 µg/ml), and either erythromycin,
tetracycline, chloramphenicol (each at 10 µg/ml), gentamicin (100 µg/ml), or lincomycin (50 µg/ml). In curing experiments, novobiocin
or ciprofloxacin was used as described previously (3).
Total cellular DNA and plasmids were isolated from enterococcal and
staphylococcal strains, as described previously (14, 23). In
hybridization experiments, total-DNA extracts from E. faecium and staphylococci were immobilized on nylon membranes (Hybond-N; Amersham France, Les Ullis, France) in 50% formamide at
42°C under stringent conditions (23). The linA,
linA', and ermAM probes, previously described
(20, 24), were labeled with digoxigenin (Boehringer Mannheim
France, Meylan, France), and hybrids were detected by using an
antidigoxigenin-alkaline phosphatase conjugate with a chromogenic
enzyme substrate.
DNA fragments were cloned by using plasmids pUC18, pCR 2.1 (Invitrogen,
Carlsbad, Calif.), and the shuttle vector pJIM2246 (30).
S. aureus RN4220 and Escherichia coli DB10 were
transformed by electroporation. DNA was sequenced in an automated ABI
PRISM 310 system (Perkin-Elmer Corp., Norwalk, Conn.).
The proteins specified by the linear templates amplified by PCR were
synthesized with an E. coli in vitro
transcription-translation system (Promega, Madison, Wis.).
Electrophoresis of proteins labeled with
L-[
-35S]methionine was performed in a
sodium dodecyl sulfate-15% polyacrylamide gel. For study of the
distribution of the linB gene in E. faecium, DNA
sequences specific for the gene were amplified by PCR by using the
primers LINB1 ([nucleotides 3 to 22] 5' CCTACCTATTGTTTGTGGAA 3')
and LINB2 ([nucleotides 947 to 928] 5'
ATAACGTTACTCTCCTATTC 3') through a precycle of 5 min at 94°C
followed by 35 cycles of 45 s at 94°C, 45 s at 54°C, and
1 min at 72°C and a final cycle of 5 min at 72°C.
Pulsed-field gel electrophoresis of the enterococcal total-DNA extract
digested with SmaI or SfiI was performed as
previously described (29). Restricted DNA was transferred to
nylon membranes under a vacuum and hybridized to digoxigenin-labeled
DNA fragments (Boehringer Mannheim SA, Meylan, France) obtained after
amplification of the linB gene with the specific primers
LINB1 and LINB2.
Nucleotide sequence accession number.
The nucleotide
sequence of the linB gene from E. faecium HM1025
has been deposited in the GenBank data library under accession no.
AF110130.
 |
RESULTS AND DISCUSSION |
Properties of E. faecium strains.
Resistance to
lincosamides gained by the inactivation of the antibiotics was detected
by Gots' test in 14 E. faecium strains and was associated
with cross-resistance to macrolide, lincosamide, and streptogramin B
type antibiotics (MLSB phenotype). Hybridization experiments failed to
detect the genes related to linA or linA' which
are responsible for the nucleotidylation of lincosamides in
staphylococci. E. faecium HM1025 was resistant to
chloramphenicol, penicillin G (MIC = 32 µg/ml), tetracycline,
and high levels of aminoglycosides (streptomycin, kanamycin, and
gentamicin). In this strain, resistance to macrolide, lincosamide, and
streptogramin B type antibiotics was due to ribosomal methylation
mediated by an ermAM-like gene, as revealed by hybridization
experiments (data not shown).
Localization of the determinant responsible for lincosamide
inactivation.
Resistance to high levels of streptomycin and
gentamicin, tetracycline, macrolide, lincosamide, and streptogramin B
type antibiotics, and lincosamides by inactivation was cured in the
presence of novobiocin or ciprofloxacin in approximately 10% of
colonies. The resistances were transferred (en bloc or without the
resistance to gentamicin) by conjugation to E. faecalis
JH2-2 at a frequency of 10
5 per donor CFU after the
mating period. The susceptibilities to lincosamides of the E. faecium strains, the transconjugant E. faecalis
JH2-2/1025 (resistant to erythromycin, lincomycin, and high levels of
gentamicin and streptomycin), and the cured derivative E. faecium HM1025-1 are listed in Table
1. The total-DNA extracts of E. faecium HM1025 and E. faecium HM1025-1 were digested
with SmaI and analyzed by pulsed-field gel electrophoresis
(Fig. 1). Comparison of fragment patterns
revealed the presence of two faint SmaI bands of nearly 180 and 60 kb in E. faecium HM1025 which were absent in
HM1025-1. Hybridization with a probe specific for linB
showed that this gene was borne by the 180-kb SmaI fragment (Fig. 1). Analysis of the SfiI-generated fragment patterns
of the total-DNA extracts of E. faecalis JH2-2 and
JH2-2/1025 showed the insertion of an approximately 240-kb DNA segment
bearing the linB gene into a 280-kb SmaI fragment
from E. faecalis JH2-2 (Fig. 1). These results suggested
that the linB gene was borne by a ca. 240-kb plasmid
containing two SmaI restriction sites which could be
integrated into the chromosome of E. faecalis JH2-2 after conjugative transfer.

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of genomic DNA from E. faecium
HM1025 and HM1025-1, digested with SmaI (A and B, left) and
from E. faecalis JH2-2 and a transconjugant digested with
SfiI (A and B, right) by pulsed-field gel electrophoresis
and hybridization. (A) Lanes 1, E. faecium HM1025; lanes 2, E. faecium HM1025-1. (B) Lanes 1, E. faecalis
JH2-2; lanes 2, E. faecalis JH2-2/L1 (transconjugant
resistant to erythromycin, lincomycin, gentamicin, streptomycin, and
tetracycline). The digested fragments were transferred to a nylon sheet
and hybridized to an in vitro digoxigenin-labeled linB
probe. Numbers on the left of the gels are molecular sizes in
kilobases.
|
|
E. faecium HM1025 produces a 3-lincosamide
O-nucleotidyltransferase.
Inactivation of 20 µg of
lincomycin and clindamycin per ml by resting E. faecium
HM1025 cells was achieved within 6 h. Inactivation of 500 µg of
lincomycin and clindamycin per ml was also observed when crude extracts
of the strains were incubated with ATP and MgCl2 but not
when cells were incubated in the absence of ATP. After purification,
the inactivated materials were shown to have masses of 735 and 753/755
amu for lincomycin and clindamycin, respectively. Although these
results suggested that the inactivation products are adenylated
lincomycin and clindamycin, it was not possible, to assign the site of
adenylation with certainty by MS results. The purified material was
therefore subjected to two-dimensional correlated spectroscopy, g-HMQC,
and g-HMBC NMR experiments. With the exception of a few hydroxyl
protons, all of the remaining proton and carbon NMR resonances were
rigorously assigned. It is important to note that C-3 of the hexose
ring was found to have a significant shift from the control
(2). The chemical shift of the clindamycin C-3 appears at
71.2 ppm, while the chemical shifts of adenylated clindamycin and
lincomycin were 74.5 and 74.6 ppm, respectively. Further, several
confirming vicinal C-O-P couplings were also observed for both
inactivated materials (31). These data clearly show that the
3 position is the site of adenylation for both the lincomycin and
clindamycin inactivated materials (Fig.
2). The biochemical mechanism of
resistance differs from that reported for staphylococcal enzymes which
catalyze the conversion of lincomycin to its 3-(5'-ribonucleotide) and
clindamycin to its 4-(5'-ribonucleotide) (5). By contrast,
the mechanism is similar to that reported for Streptomyces
coelicolor Müller NRRL 3532 (25). It has been
proposed that genes for antibiotic resistance originated in antibiotic
producers. However, the producer of lincomycin, Streptomyces
lincolnensis, resists lincomycin by the monomethylation of an
adenine residue of the 23S rRNA but not by nucleotidylation, and
S. coelicolor does not produce this antibiotic
(16). To test the hypothesis that the enzyme found in
enterococci derives from a Streptomyces enzyme,
determination of the sequence of the gene encoding the
nucleotidyltransferase from Streptomyces and comparing it
with that of E. faecium HM1025 would be of interest.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Mechanism whereby clindamycin and lincomycin are
converted to lincomycin and clindamycin 3-(5'-adenylate) by LinB in the
presence of ATP and MgCl2+.
|
|
Characterization of the linB gene and its product.
The total-DNA extracts from E. faecium HM1025 and plasmid
pUC18 were digested with HindIII and mixed, ligated, and
introduced by electrotransformation into E. coli DB10, a
mutant susceptible to lincosamides. Transformants selected on
lincomycin (20 µg/ml) were screened for their plasmid content by
agarose gel electrophoresis. The smallest hybrid plasmid, pVMM25, was
found to contain a 2.6-kb HindIII fragment, and this
plasmid conferred resistance to lincomycin by inactivating the
antibiotic in E. coli DB10 but did not confer resistance to
erythromycin (Table 1). The nucleotide sequence of the 2,684-bp insert
of plasmid pVMM25 was determined. Analysis of the sequence revealed two
open reading frames (ORFs), ORF1 and ORF2. To identify the gene
responsible for resistance to lincosamide, ORF1 (774 bp), ORF2 (804 bp), and the corresponding putative ribosome-binding sites were
separately amplified by PCR and subcloned into the vector plasmid
pCR2.1. Only the recombinant plasmid containing ORF2, pVMM27, conferred
resistance to lincosamides when introduced into E. coli
DB10. The cloned gene, named linB, was amplified by PCR, and
the product of the amplification was used as a template in a cell-free
coupled transcription-translation system. One band of ca. 31 kDa, a
mass that closely approximates the 31,195-Da predicted mass of LinB,
was encoded by this fragment (Fig. 3). The deduced amino acid sequence of linB did not display any
significant homology with the sequences of lincosamide
nucleotidyltransferases encoded by linA and linA'
or those of the aminoglycoside nucleotidyltransferases ANT(2"),
ANT(3")(9), ANT(4')(4"), ANT(6), and ANT(9), (6, 7, 18, 27,
28).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Autoradiogram of
L-[35S]methionine-labeled polypeptide
specified in vitro by the amplification product of linB. (A)
Protein electrophoresis in a 15% polyacrylamide gel containing sodium
dodecyl sulfate. After separation, proteins were stained with Coomassie
blue. (B) Visualization of labeled protein bands in the gel by
autoradiography. Lanes 1, control without template; lanes 2, protein
products synthesized from PCR-generated linB DNA; lanes 3, molecular mass markers (masses on the left are expressed in
kilodaltons). The position of LinB (31,195 Da) is indicated.
|
|
Heterospecific expression of lincosamide resistance.
The
2,684-bp HindIII fragment of pVMM25 was excised after
further digestion with the restriction enzymes BamHI and
PstI and was subcloned into the shuttle plasmid pJIM2246.
The resulting recombinant plasmid, pVMM26, was introduced into E. coli DB10 and S. aureus RN4220. In both backgrounds,
the transformants inactivated clindamycin and lincomycin. As shown in
Table 1, resistance to lincomycin and clindamycin was expressed
differently in the gram-negative and gram-positive hosts. MICs of
lincomycin were increased by factors of 8 and 128 and the MICs of
clindamycin were increased by factors of 32 and 8 in the E. coli and S. aureus backgrounds, respectively. Similar
differences in resistances were found for nucleotidyltransferases
encoded by linA and linA' genes in staphylococci (5). These discrepancies could be hypothetically explained by differences in the affinity of lincosamide for either the
nucleotidyltransferase or the E. coli and S. aureus ribosomes.
Distribution of linB in clinical isolates of E. faecium.
Inactivation of lincosamides following the
acquisition of linB appears to have already spread in
E. faecium, since DNA could be amplified by using specific
primers in all 14 of the clinical isolates of E. faecium
which inactivated lincosamides. By contrast, the inactivation of
lincosamides was not detected in E. faecalis. The apparent
specificity of the gene for E. faecium is surprising. This
specificity does not appear to be due to a narrow spectrum of
transferability of the resistance, since we could readily transfer inactivation of lincosamides together with resistance to erythromycin and aminoglycosides from E. faecium HM1025 to E. faecalis JH2-2. Possibly, because of the intrinsic resistance to
lincomycin of E. faecalis, the acquisition of an additional
resistance to lincosamides did not provide any selective advantage for
this species (22).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CHU de Caen,
Service de Microbiologie, Avenue Côte de Nacre, 14033 Caen cedex,
France. Phone: (33) 2 31 06 45 72. Fax: (33) 2 31 06 45 73. E-mail:
leclercq-r{at}chu-caen.fr.
 |
REFERENCES |
| 1.
|
Argoudelis, A. D., and J. H. Coats.
1969.
Microbial transformation of antibiotics. II. Phosphorylation of lincomycin by streptomyces species.
J. Antibiot.
22:341-343[Medline].
|
| 2.
|
Argoudelis, A. D.,
J. H. Coats, and S. A. Mizsak.
1977.
Microbial transformation of antibiotics. Clindamycin ribonucleotides.
J. Antibiot.
30:474-487[Medline].
|
| 3.
|
Bouanchaud, H. C.,
M. R. Scavizzi, and Y. A. Chabbert.
1969.
Elimination by ethidium bromide of antibiotic resistance in enterobacteria and staphylococci.
J. Gen. Microbiol.
54:417-425.
|
| 4.
|
Brisson-Noël, A., and P. Courvalin.
1986.
Nucleotide sequence of gene linA encoding resistance to lincosamides in Staphylococcus haemolyticus.
Gene
43:247-253[Medline].
|
| 5.
|
Brisson-Noël, A.,
P. Delrieu,
D. Samain, and P. Courvalin.
1988.
Inactivation of lincosaminide antibiotics in Staphylococcus. Identification of lincosaminide O-nucleotidyltransferases and comparison of the corresponding resistance genes.
J. Biol. Chem.
263:15880-15887[Abstract/Free Full Text].
|
| 6.
|
Cameron, F.,
D. J. Groot Obbink,
V. P. Ackerman, and R. M. Hall.
1986.
Nucleotide sequence of the AAD(2") aminoglycoside adenyltransferase determinant aadB. Evolutionary relationship of this region with those surrounding aadA in R538-1 and dhfrII in R388.
Nucleic Acids Res.
14:8625-8635[Abstract/Free Full Text].
|
| 7.
|
Carlier, C., and P. Courvalin.
1990.
Emergence of 4',4"-aminoglycoside nucleotidyltransferase in enterococci.
Antimicrob. Agents Chemother.
34:1565-1569[Abstract/Free Full Text].
|
| 8.
|
Comité de l'Antibiogramme de la Société Française de Microbiologie.
1996.
1996 report of the Comité de l'Antibiogramme de la Société Française de Microbiologie. Technical recommendations for in vitro susceptibility testing.
Clin. Microbiol. Infect.
2S1:11-25.
|
| 9.
|
Datta, N.,
R. W. Hedges,
D. Becker, and J. Davies.
1974.
Plasmid-determined fusidic acid resistance in Enterobacteriaceae.
J. Gen. Microbiol.
83:191-196[Medline].
|
| 10.
|
Devriese, L. A.
1980.
Two new types of resistance to lincomycin in pathogenic staphylococci from animals.
Ann. Inst. Pasteur (Paris)
131B:261-266.
|
| 11.
|
Dhawan, V. K., and H. Thadepalli.
1982.
Clindamycin: a review of fifteen years of experience.
Rev. Infect. Dis.
4:1133-1153[Medline].
|
| 12.
|
Dutta, G. N., and L. A. Devriese.
1981.
Degradation of macrolide-lincosamide-streptogramin antibiotics by Lactobacillus strains from animals.
Ann. Inst. Pasteur (Paris)
132A:51-57.
|
| 13.
|
Dutta, G. N., and L. A. Devriese.
1982.
Resistance to macrolide, lincosamide and streptogramin antibiotics and degradation of lincosamide antibiotics in streptococci from bovine mastitis.
J. Antimicrob. Chemother.
10:403-408[Abstract/Free Full Text].
|
| 14.
|
Ehrenfeld, E. E., and D. B. Clewell.
1987.
Transfer functions of the Streptococcus faecalis plasmid pAD1: organization of plasmid DNA encoding response to sex pheromone.
J. Bacteriol.
169:3473-3481[Abstract/Free Full Text].
|
| 15.
|
Facklam, R. R., and M. D. Collins.
1989.
Identification of Enterococcus species isolated from human infections by a conventional test scheme.
J. Clin. Microbiol.
27:731-734[Abstract/Free Full Text].
|
| 16.
|
Fujisawa, Y., and B. Weisblum.
1981.
A family of r-determinants in Streptomyces spp. that specifies inducible resistance to macrolide, lincosamide, and streptogramin type B antibiotics.
J. Bacteriol.
146:621-631[Abstract/Free Full Text].
|
| 17.
|
Gots, J. S.
1945.
The detection of penicillinase production properties of microorganisms.
Science
102:309[Free Full Text].
|
| 18.
|
Hollingshead, S., and D. Vapnek.
1985.
Nucleotide sequence analysis of a gene encoding a streptomycin/spectinomycin adenylyltransferase.
Plasmid
13:17-30[Medline].
|
| 19.
|
Jacob, A. E., and S. J. Hobbs.
1974.
Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes.
J. Bacteriol.
117:360-372[Abstract/Free Full Text].
|
| 20.
|
Leclercq, R.,
A. Brisson-Noël,
J. Duval, and P. Courvalin.
1987.
Phenotypic expression and genetic heterogeneity of lincosamide inactivation in Staphylococcus spp.
Antimicrob. Agents Chemother.
31:1887-1891[Abstract/Free Full Text].
|
| 21.
|
Leclercq, R.,
C. Carlier,
J. Duval, and P. Courvalin.
1985.
Plasmid-mediated resistance to lincomycin by inactivation in Staphylococcus haemolyticus.
Antimicrob. Agents Chemother.
28:421-424[Abstract/Free Full Text].
|
| 22.
|
Leclercq, R., and P. Courvalin.
1991.
Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification.
Antimicrob. Agents Chemother.
35:1267-1272[Free Full Text].
|
| 23.
|
Leclercq, R.,
E. Derlot,
M. Weber,
J. Duval, and P. Courvalin.
1989.
Transferable vancomycin and teicoplanin resistance in Enterococcus faecium.
Antimicrob. Agents Chemother.
33:10-15[Abstract/Free Full Text].
|
| 24.
|
Mabilat, C., and P. Courvalin.
1988.
Gene heterogeneity for resistance to macrolides, lincosamides, and streptogramins in Enterobacteriaceae.
Ann. Inst. Pasteur Microbiol.
139:677-681[Medline].
|
| 25.
|
Marshall, V. P.,
J. E. McGee,
J. I. Cialdella,
L. Baczynskyj,
D. G. Chirby,
D. A. Yurek,
W. F. Liggett, and M. S. Kuo.
1991.
Purification of lincosaminide O-nucleotidyltransferase from Streptomyces coelicolor Müller.
J. Antibiot.
44:895-900[Medline].
|
| 26.
|
Marshall, V. P.,
W. F. Liggett, and J. I. Cialdella.
1989.
Enzymic inactivation of lincosaminide and macrolide antibiotics: divalent metal cation and coenzyme specificities.
J. Antibiot.
42:826-830[Medline].
|
| 27.
|
Matsumura, M.,
Y. Katakura,
T. Imanaka, and S. Aiba.
1984.
Enzymatic and nucleotide sequence studies of a kanamycin-inactivating enzyme encoded by a plasmid from thermophilic bacilli in comparison with that encoded by plasmid pUB110.
J. Bacteriol.
160:413-420[Abstract/Free Full Text].
|
| 28.
|
Murphy, E.
1985.
Nucleotide sequence of a spectinomycin adenyltransferase AAD(9) determinant from Staphylococcus aureus and its relationship to AAD(3")(9).
Mol. Gen. Genet.
200:33-39[Medline].
|
| 29.
|
Murray, B. E.,
K. V. Singh,
J. D. Heath,
B. R. Sharma, and G. M. Weinstock.
1990.
Comparison of genomic DNAs of different enterococcal isolates using restriction endonucleases with infrequent recognition sites.
J. Clin. Microbiol.
28:2059-2063[Abstract/Free Full Text].
|
| 30.
|
Renault, P.,
G. Corthier,
N. Goupil,
C. Delorme, and S. D. Ehrlich.
1996.
Plasmid vectors for Gram-positive bacteria switching from high to low copy number.
Gene
183:175-182[Medline].
|
| 31.
|
Stothers, J. B.
1972.
Carbon-13 spectroscopy, p. 378.
Academic Press, New York, N.Y.
|
| 32.
|
Weisblum, B.
1995.
Erythromycin resistance by ribosome modification.
Antimicrob. Agents Chemother.
39:577-585[Medline].
|
Antimicrobial Agents and Chemotherapy, April 1999, p. 925-929, Vol. 43, No. 4
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rosander, A., Connolly, E., Roos, S.
(2008). Removal of Antibiotic Resistance Gene-Carrying Plasmids from Lactobacillus reuteri ATCC 55730 and Characterization of the Resulting Daughter Strain, L. reuteri DSM 17938. Appl. Environ. Microbiol.
74: 6032-6040
[Abstract]
[Full Text]
-
Petinaki, E., Guerin-Faublee, V., Pichereau, V., Villers, C., Achard, A., Malbruny, B., Leclercq, R.
(2008). Lincomycin Resistance Gene lnu(D) in Streptococcus uberis. Antimicrob. Agents Chemother.
52: 626-630
[Abstract]
[Full Text]
-
Schmitt-Van de Leemput, E., Zadoks, R. N.
(2007). Genotypic and Phenotypic Detection of Macrolide and Lincosamide Resistance in Streptococcus uberis. J DAIRY SCI
90: 5089-5096
[Abstract]
[Full Text]
-
Luthje, P., von Kockritz-Blickwede, M., Schwarz, S.
(2007). Identification and characterization of nine novel types of small staphylococcal plasmids carrying the lincosamide nucleotidyltransferase gene lnu(A). J Antimicrob Chemother
59: 600-606
[Abstract]
[Full Text]
-
Novotna, G., Janata, J.
(2006). A New Evolutionary Variant of the Streptogramin A Resistance Protein, Vga(A)LC, from Staphylococcus haemolyticus with Shifted Substrate Specificity towards Lincosamides. Antimicrob. Agents Chemother.
50: 4070-4076
[Abstract]
[Full Text]
-
Levings, R. S., Hall, R. M., Lightfoot, D., Djordjevic, S. P.
(2006). linG, a New Integron-Associated Gene Cassette Encoding a Lincosamide Nucleotidyltransferase.. Antimicrob. Agents Chemother.
50: 3514-3515
[Full Text]
-
Gygax, S. E., Schuyler, J. A., Kimmel, L. E., Trama, J. P., Mordechai, E., Adelson, M. E.
(2006). Erythromycin and clindamycin resistance in group B streptococcal clinical isolates.. Antimicrob. Agents Chemother.
50: 1875-1877
[Abstract]
[Full Text]
-
Zeng, X., Kong, F., Wang, H., Darbar, A., Gilbert, G. L.
(2006). Simultaneous Detection of Nine Antibiotic Resistance-Related Genes in Streptococcus agalactiae Using Multiplex PCR and Reverse Line Blot Hybridization Assay. Antimicrob. Agents Chemother.
50: 204-209
[Abstract]
[Full Text]
-
Achard, A., Villers, C., Pichereau, V., Leclercq, R.
(2005). New lnu(C) Gene Conferring Resistance to Lincomycin by Nucleotidylation in Streptococcus agalactiae UCN36. Antimicrob. Agents Chemother.
49: 2716-2719
[Abstract]
[Full Text]
-
von Both, U., Buerckstuemmer, A., Fluegge, K., Berner, R.
(2005). Heterogeneity of Genotype-Phenotype Correlation among Macrolide-Resistant Streptococcus agalactiae Isolates. Antimicrob. Agents Chemother.
49: 3080-3082
[Abstract]
[Full Text]
-
Gonzalez, J. J., Andreu, A., the Spanish Group for the Study of Perinatal Infec,
(2005). Multicenter Study of the Mechanisms of Resistance and Clonal Relationships of Streptococcus agalactiae Isolates Resistant to Macrolides, Lincosamides, and Ketolides in Spain. Antimicrob. Agents Chemother.
49: 2525-2527
[Abstract]
[Full Text]
-
Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J.
(2005). Microarray-Based Detection of 90 Antibiotic Resistance Genes of Gram-Positive Bacteria. J. Clin. Microbiol.
43: 2291-2302
[Abstract]
[Full Text]
-
Duarte, R. S., Bellei, B. C., Miranda, O. P., Brito, M. A. V. P., Teixeira, L. M.
(2005). Distribution of Antimicrobial Resistance and Virulence-Related Genes among Brazilian Group B Streptococci Recovered from Bovine and Human Sources. Antimicrob. Agents Chemother.
49: 97-103
[Abstract]
[Full Text]
-
Desjardins, M., Delgaty, K. L., Ramotar, K., Seetaram, C., Toye, B.
(2004). Prevalence and Mechanisms of Erythromycin Resistance in Group A and Group B Streptococcus: Implications for Reporting Susceptibility Results. J. Clin. Microbiol.
42: 5620-5623
[Abstract]
[Full Text]
-
Malbruny, B., Werno, A. M., Anderson, T. P., Murdoch, D. R., Leclercq, R.
(2004). A new phenotype of resistance to lincosamide and streptogramin A-type antibiotics in Streptococcus agalactiae in New Zealand. J Antimicrob Chemother
54: 1040-1044
[Abstract]
[Full Text]
-
Bozdogan, B., Galopin, S., Leclercq, R.
(2004). Characterization of a New erm-Related Macrolide Resistance Gene Present in Probiotic Strains of Bacillus clausii. Appl. Environ. Microbiol.
70: 280-284
[Abstract]
[Full Text]
-
Bozdogan, B., Galopin, S., Gerbaud, G., Courvalin, P., Leclercq, R.
(2003). Chromosomal aadD2 Encodes an Aminoglycoside Nucleotidyltransferase in Bacillus clausii. Antimicrob. Agents Chemother.
47: 1343-1346
[Abstract]
[Full Text]
-
de Azavedo, J. C. S., McGavin, M., Duncan, C., Low, D. E., McGeer, A.
(2001). Prevalence and Mechanisms of Macrolide Resistance in Invasive and Noninvasive Group B Streptococcus Isolates from Ontario, Canada. Antimicrob. Agents Chemother.
45: 3504-3508
[Abstract]
[Full Text]
-
Fluit, A. C., Visser, M. R., Schmitz, F.-J.
(2001). Molecular Detection of Antimicrobial Resistance. Clin. Microbiol. Rev.
14: 836-871
[Abstract]
[Full Text]
-
Fines, M., Leclercq, R.
(2000). Activity of linezolid against Gram-positive cocci possessing genes conferring resistance to protein synthesis inhibitors. J Antimicrob Chemother
45: 797-802
[Abstract]
[Full Text]
-
Roberts, M. C., Sutcliffe, J., Courvalin, P., Jensen, L. B., Rood, J., Seppala, H.
(1999). Nomenclature for Macrolide and Macrolide-Lincosamide-Streptogramin B Resistance Determinants. Antimicrob. Agents Chemother.
43: 2823-2830
[Full Text]