Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, May 1999, p. 1129-1136, Vol. 43, No. 5
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Streptococcus pneumoniae DNA Gyrase and
Topoisomerase IV: Overexpression, Purification, and Differential
Inhibition by Fluoroquinolones
Xiao-Su
Pan and
L. Mark
Fisher*
Molecular Genetics Group, Department of
Biochemistry, St. George's Hospital Medical School, University of
London, London SW17 0RE, United Kingdom
Received 4 January 1999/Returned for modification 4 February
1999/Accepted 3 March 1999
 |
ABSTRACT |
Streptococcus pneumoniae gyrA and gyrB
genes specifying the DNA gyrase subunits have been cloned into pET
plasmid vectors under the control of an inducible T7 promoter and have
been separately expressed in Escherichia coli. Soluble
97-kDa GyrA and 72-kDa GyrB proteins bearing polyhistidine tags at
their respective C-terminal and N-terminal ends were purified to
apparent homogeneity by one-step nickel chelate column chromatography
and were free of host E. coli topoisomerase activity.
Equimolar amounts of the gyrase subunits reconstituted ATP-dependent
DNA supercoiling with comparable activity to gyrase of E. coli and Staphylococcus aureus. In parallel, S. pneumoniae topoisomerase IV ParC and ParE subunits were similarly expressed in E. coli, purified to near homogeneity as 93- and 73-kDa proteins, and shown to generate efficient ATP-dependent DNA
relaxation and DNA decatenation activities. Using the purified enzymes,
we examined the inhibitory effects of three paradigm fluoroquinolones
ciprofloxacin, sparfloxacin, and clinafloxacin
which previous genetic studies with S. pneumoniae suggested act
preferentially through topoisomerase IV, through gyrase, and through
both enzymes, respectively. Surprisingly, all three quinolones were
more active in inhibiting purified topoisomerase IV than gyrase, with
clinafloxacin showing the greatest inhibitory potency. Moreover, the
tested agents were at least 25-fold more effective in stabilizing a
cleavable complex (the relevant cytotoxic lesion) with topoisomerase IV than with gyrase, with clinafloxacin some 10- to 32-fold more potent
against either enzyme, in line with its superior activity against
S. pneumoniae. The uniform target preference of the three fluoroquinolones for topoisomerase IV in vitro is in apparent contrast
to the genetic data. We interpret these results in terms of a model for
bacterial killing by quinolones in which cellular factors can modulate
the effects of target affinity to determine the cytotoxic pathway.
 |
INTRODUCTION |
The recent development of new
fluoroquinolones effective against Streptococcus pneumoniae
is a potentially important advance in the management of pneumococcal
disease (3, 20, 34). Several of these agents are more active
than ciprofloxacin and have either been approved or are in the late
stages of clinical trials, including levofloxacin, sparfloxacin,
trovafloxacin, grepafloxacin, and clinafloxacin. Given that
fluoroquinolones act by blocking DNA synthesis, they should be
effective against both penicillin-sensitive and -resistant S. pneumoniae (13, 28, 40). Progress in this area has
focused attention on the nature and cellular consequences of quinolone
interactions with their pneumococcal targets, the essential type II
topoisomerases, DNA gyrase and DNA topoisomerase IV (41).
Previous work in Escherichia coli has established that both
gyrase and topoisomerase IV act by a double-strand DNA break and play
important roles in facilitating DNA transactions, especially DNA
replication (1, 6, 10, 17, 21, 44). Gyrase, a complex of two
GyrA and two GyrB subunits encoded by the gyrA and
gyrB genes, introduces negative supercoils into DNA in a
reaction driven by ATP hydrolysis. The enzyme is essential for
initiation of DNA replication and plays a key role in elongation,
presumably by removing positive supercoils arising from DNA unwinding
at the replication fork. Though gyrase was formerly implicated in the
unlinking of daughter chromosomes, it now appears that this function is
largely performed by the ATP-requiring enzyme topoisomerase IV, a
C2E2 tetramer encoded by the parC
and parE genes (1, 44). Quinolones inhibit both
enzymes by forming a ternary complex of drug, enzyme, and DNA
"the
cleavable complex"
that, on treatment with detergent and proteinase
K, generates double-strand DNA breaks (6, 9). Similarly, it
is thought that cellular processes acting on the ternary complex in
vivo result in the formation of an irreparable double-stranded DNA
break, thereby triggering bacterial cell death (18, 19).
Resistance to quinolones in E. coli usually involves point
mutations in defined regions of the GyrA or GyrB proteins, termed the
quinolone resistance-determining regions, or QRDRs (5, 26, 42,
43). Mutations in the equivalent regions of the ParC or ParE
proteins occur subsequent to those in gyrase and are associated with
very high level resistance to the drugs (12). These findings
originally led to the conclusion that gyrase is invariably the primary
target of the quinolones. However, studies with Staphylococcus
aureus and S. pneumoniae have discounted this idea
(7, 8, 27, 29-32). Unlike E. coli, in which all
quinolones tested thus far target DNA gyrase, it appears that, in
S. pneumoniae, bacterial killing can proceed through either
gyrase, topoisomerase IV, or both, depending on the structure of the
quinolone (31, 32). This important conclusion has come
primarily from the characterization of stepwise-selected
quinolone-resistant S. pneumoniae mutants. Thus, on
challenge of S. pneumoniae with ciprofloxacin,
parC or parE mutations appear before those in
gyrA, suggesting the drug acts preferentially through
topoisomerase IV (11, 16, 25, 29, 30, 33, 39). In contrast,
challenge with sparfloxacin selects for gyrA mutations
before those in parC, indicating a primary role of drug
interactions with gyrase (31). For clinafloxacin, killing
proceeds through gyrase and topoisomerase IV, with a modest preference
for gyrase (32). The molecular basis underlying these different drug specificities is currently unknown, but it presumably reflects differential enzyme-drug interactions and/or more complex factors, such as differential lethalities of enzyme inhibition.
In an effort to understand the different in vivo mechanisms of
ciprofloxacin, sparfloxacin, and clinafloxacin, we have examined the
contribution of enzyme inhibition to drug action. Here, we report the
overexpression and purification of S. pneumoniae GyrA, GyrB,
ParC, and ParE subunits; reconstitution of highly active gyrase and
topoisomerase IV proteins; and their differential responses to quinolones.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and DNA substrates.
S.
pneumoniae 7785 and the conditions for its growth have been
described previously (30). E. coli XL-Blue and
plasmid pBluescript were used to construct libraries and to subclone
DNA inserts. Plasmid pCRII (Invitrogen) was used to clone inverse PCR
(IPCR) products in E. coli XL-Blue. Vectors pET-19b and
pET-29a (Novagen) were used to construct plasmids for overexpression of
S. pneumoniae GyrB and GyrA and ParC and ParE proteins in
E. coli host BL21(
DE3)pLysS. Some intermediate plasmid
constructs were propagated in E. coli DH5
. Supercoiled
pBR322 was prepared as described previously (30), and
relaxed-DNA pBR322 was obtained by incubation with calf thymus
topoisomerase I (Life Technologies). Kinetoplast DNA (kDNA) from
Crithidia fasciculata was purchased from TOPOGEN, Inc.,
Columbus, Ohio.
Chemicals and reagents.
Ciprofloxacin-HCl and
clinafloxacin-HCl were kindly provided by Bayer UK, Newbury, United
Kingdom, and by Parke-Davis Co., Ann Arbor, Mich. Sparfloxacin was a
kind gift from Dainippon Pharmaceutical Co., Suita, Japan.
Oligonucleotide primers were synthesized by Oswel, Ltd., University of
Southampton, Southampton, United Kingdom.
Molecular cloning of the S. pneumoniae 7785 gyrA gene.
In previous work, we have described the
isolation and characterization of the parE, parC,
and gyrB genes from S. pneumoniae 7785 (30). To obtain the gyrA gene from this strain, a
radiolabeled 382-bp gyrA PCR product amplified from S. pneumoniae 7785 (29) was used to probe a Southern blot
of 7785 genomic DNA and was found to hybridize to 4.0-kb
PstI and 2.5-kb HindIII fragments (not
shown). Size-selected S. pneumoniae 7785 HindIII and PstI libraries in pBluescript SK
were constructed in E. coli XL1-Blue and screened with the
gyrA PCR product. Due to plasmid instability, only the
2.5-kb HindIII fragment could be isolated intact in
plasmid pXP11. DNA sequence analysis of the pXP11 insert showed it
contained two incomplete open reading frames (ORFs), one of which
encoded the N-terminal 411 residues of GyrA protein. To obtain the 3' end of the gyrA gene, IPCR was used, employing forward
primer VGA14 (5' TGAAACGGATGCGGAAGCTCAAGC [gyrA
nucleotide positions 1190 to 1213]) and reverse primer VGA13
(5'-ACTCTGACTGTGCAGACGCTGACC [
406 to
429 adjacent to a
PstI site]). S. pneumoniae 7785 genomic DNA was
digested to completion with PstI, and the restriction fragments were circularized by ligation (30). The fragments were then used as a template in IPCR with primers, Taq DNA
polymerase, and 1.5 mM MgCl2 (30). The
conditions were 94°C for 1 min, 45°C for 1 min, and 74°C for 2 min (30 cycles). A 2.4-kb IPCR product was obtained, cloned directly
into plasmid pCRII, and transformed into E. coli XL-Blue.
Plasmid pXP12 was recovered from one of the ampicillin-resistant colonies.
The inserts in pXP11 and pXP12 specified a 4.7-kb region of the
S. pneumoniae chromosome whose DNA sequence was determined, and two divergent ORFs were identified. An incomplete ORF, specified by
the 5' end of the pXP11 insert, encoded a 325-residue protein which was
identical to the L-(+)-lactate dehydrogenase of S. pneumoniae, a 328-residue enzyme that catalyzes the
fructose-1,6-diphosphate-dependent interconversion of pyruvate and
lactate (15). The second ORF encoded the 822-residue GyrA
protein, which exhibits a predicted molecular mass of 92 kDa. Except
for seven amino acid differences most likely arising from strain
polymorphisms, the strain 7785 GyrA sequence is identical to that
recently reported by Balas et al. (2): Ile-489, Lys-537,
Lys-642, and Thr-653 and the three consecutive conserved residues
Gly-618-Ile-Val in our sequence are replaced in that of Balas et al.
by Val, Glu, Gln, Ala and Val-Leu-Leu, respectively.
DNA sequence analysis.
Cloned S. pneumoniae DNA
fragments were sequenced on both strands by the chain termination
method (36). The plasmid pXP11 insert was sequenced by using
T7 and internal primers. Sequence at the extreme 3' end of the pXP12
insert was obtained by using T7 and SP6 primers. This information was
then used to design primers for asymmetric PCR (AsPCR) by using the
proofreading Vent DNA polymerase and strain 7785 genomic DNA as a
template. AsPCR products were then sequenced directly (31).
Construction of GyrA- and GyrB-expressing plasmids.
PCR was
used to amplify the S. pneumoniae gyrA and gyrB
genes for insertion into expression vectors pET-29a and pET-19b.
NdeI sites (CA'TATG) were engineered into each of
the forward primers overlapping the ATG initiation codon of
gyrA and gyrB. The gyrB gene was
amplified by using forward primer (P7164)
5'-AGAAAAAGGAATCATATGACAGA AG (NdeI
site underlined) and reverse primer (P7165)
5'-AGGGAACTACTTCTCGAGATTTTTTA (XhoI
site underlined). The gyrA gene was assembled from two PCR products obtained as follows. The 5' end of gyrA was
amplified with forward primer VGA35
(5'-ATGAGGCATTTACATATGCAGGATAAAAATTTAGTG) and
reverse primer VGA22 (5'-AGCCCTTTGGCAGTCCGACC [nucleotide positions 1722 to 1741; i.e., 3' to an XhoI site in
gyrA at nucleotide 1473]). The 3' end of gyrA
was obtained by using forward primer VGA17 (5'-ACAGAGTTGATGGTTGGAC
[nucleotide positions 1442 to 1460]) and reverse primer VGA36
(5'-GAGACACTCGAGTTCACCTTCTGTTTCGTTTTC [XhoI site underlined]). PCR was carried out with
genomic DNA from strain 7785 by using Vent DNA polymerase in the
presence of primers and 1.5 mM MgCl2. The PCR conditions
were denaturation at 94°C for 1 min, annealing for 1 min at 45°C
(for gyrA primers) or 52°C (for gyrB primers),
and polymerization at 72°C for 3 min. Reactions were performed over
30 cycles. The gyrB and 5' gyrA PCR products were
digested with NdeI and XhoI, purified by
electrophoresis in low-gelling temperature agarose, and recovered. The
resulting gyrB and 1,473-bp gyrA products were
ligated into NdeI-XhoI-cut pET-19b and pET-29a
and transformed into E. coli DH5
, and resistant colonies
were selected on plates containing ampicillin or kanamycin, respectively. This procedure allowed recovery of gyrB
expression plasmid pXP9 and pXP55 bearing a partial gyrA
gene. The 3' gyrA PCR product was digested with
XhoI, and the resulting 990-bp fragment was ligated into
XhoI-linearized pXP55, whose 5' ends had been dephosphorylated by using calf intestinal alkaline phosphatase. After
transformation of E. coli DH5
, recovery of plasmids from kanamycin-resistant colonies followed by restriction analysis identified expression plasmid pXP10, in which the gyrA gene
had been correctly assembled. The translation initiation and
termination regions of the recombinant plasmids pXP9 and pXP10 were
sequenced to confirm that fragments had been inserted in frame.
Plasmids expressing ParC and ParE.
Vent DNA polymerase was
used to amplify the parC and parE genes from 7785 DNA in the presence of 1.5 mM MgCl2. For amplification of
parC, the forward primer (N6894) was
5'-TGGGCTTTGTATCATATGTCTAAC (artificial
NdeI site underlined) and the reverse primer (VPC3) was
5'-CATTTCTCGAGTTTATCTTCAGTAACTAC
[XhoI site underlined; converts TAA termination codon
to CTC(Leu)]. For parE, the forward primer (N7043) was
5'-AGGAGGTTCCATATGTCAAAAAAGG (artificial
NdeI site converts GTG initiation codon to ATG), and the
reverse primer (N7044) was 5'-TATTTGGATCCATTAAACACTGTC
(BamHI site underlined), which corresponds to sequence
downstream of the natural stop codon. The PCR conditions were
denaturation at 94°C for 1 min, annealing at 45°C (for
parC) or 50°C (parE) for 1 min, and
polymerization at 72°C for 3 min. Reactions were performed over 30 cycles. The resulting 2.5-kb parC and 1.9-kb parE
products were digested with NdeI and XhoI and
NdeI and BamHI, respectively. DNA fragments were
purified from low-gelling temperature agarose, recovered, and ligated
into appropriately cut kanamycin-resistance plasmid pET-29a (for
parC) and ampicillin-resistance plasmid pET-19b (for parE), yielding pXP13 and pXP14, respectively.
Protein overexpression and purification.
Plasmids pXP9,
pXP10, pXP13, and pXP14 were transformed separately into E. coli BL21(
DE3)pLysS. GyrA and GyrB proteins were purified by
the same procedure. Single colonies of BL21 containing pXP9 or pXP10
were picked from plates and grown overnight at 37°C in 50 ml of
Luria-Bertani (LB) medium containing the selective antibiotic. A
culture (15 ml) of the overnight growth was used to inoculate 750 ml of
LB medium containing ampicillin (100 µg/ml) or kanamycin (50 µg/ml). Cells were grown at 37°C for about 3 h, until the
optical density at 600 nm reached 0.4 to 0.6. IPTG was added to a final
concentration of 1 mM, and growth was continued for a further 3 h.
Bacteria were harvested by centrifugation at 5,000 × g
for 12 min at 4°C. The supernatant was discarded, and the bacterial
pellet was resuspended in 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM
NaCl, and 5 mM imidazole prior to flash freezing in liquid nitrogen and
storage at
70°C overnight. The suspension was thawed on ice, and
lysozyme and Brij were added to final concentrations of 0.02 and
0.12%, respectively. Incubation was continued on ice for another 30 min, and then the mixture was centrifuged at 35,000 × g for 60 min. The supernatant was carefully removed to a sterile precooled 50-ml tube (Falcon) and mixed with 3 ml of 50%
Ni-nitrilotriacetic acid (NTA) resin slurry (Qiagen). The tube was
gently agitated at 4°C overnight. The mixture was poured into a
column and washed initially with 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 5 mM imidazole, followed by 10 ml of a solution containing 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 60 mM imidazole. The column
was then washed with 10 ml of a mixture of 20 mM Tris-HCl (pH 7.9), 1.5 M NaCl, and 60 mM imidazole. The histidine-tagged GyrA and GyrB
proteins were eluted with 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM
NaCl, and 250 mM imidazole. The protein fractions were examined by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE),
and those containing GyrA or GyrB proteins were pooled (total volume of
2 to 3 ml) and dialyzed overnight at 4°C against 2 liters of 50 mM
Tris-HCl (pH 7.9), 200 mM NaCl, and 30% glycerol. The protein solution
was spun at 35,000 × g for 30 min at 4°C to remove
precipitate. The supernatant was transferred to a fresh precooled tube,
and dithiothreitol (DTT) and EDTA were added to final concentrations of
5 and 1 mM, respectively. The GyrA and GyrB proteins were then flash
frozen in aliquots in liquid nitrogen and stored at
70°C.
Approximately 2 mg of highly purified GyrA or 8 mg of purified GyrB was
obtained from 5-liter cultures of induced cells.
Methods for protein induction and purification were the same for both
ParC and ParE. Growth of BL21(

DE3) pLysS transformed
with pXP13 or
pXP14, IPTG induction of cultures, and harvesting
of cells and their
lysis with lysozyme and Brij were performed
as described for GyrA and
GyrB. The crude cell extracts were centrifuged
at 35,000 ×
g for 60 min, the supernatant was removed, and to
the pellet
(containing ParC or ParE as inclusion bodies) was added
10 ml of buffer
A (20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 5 mM
imidazole) containing 6 M urea. The pellet was resuspended and
left on ice for 30 min before
centrifugation at 35,000 ×
g for
60 min. The
supernatant was carefully removed to a 50-ml sterile
tube and mixed
with 1.5 ml of 50% Ni-NTA resin slurry (Qiagen).
The tube was shaken
gently overnight at 4°C. The mixture was then
loaded into a column
and washed initially with 10 ml of buffer
A containing 6 M urea. The
ParC (or ParE) protein was then renatured
on the column by gradually
reducing the urea concentration to
zero. This was achieved at 4°C
over a 10-h period by running a
300-ml linear gradient starting at 6 M
urea in the wash buffer
(20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 20 mM
imidazole). The His-tagged
ParC or ParE protein was eluted with buffer
containing 20 mM Tris-HCl
(pH 7.9), 500 mM NaCl, and 250 mM imidazole.
Column fractions
were examined by SDS-PAGE, and those containing
purified protein
were pooled and dialyzed overnight against 2 liters of
50 mM Tris-HCl
(pH 7.5), 200 mM NaCl, and 30% glycerol. The dialyzed
solution
was spun at 35,000 ×
g for 30 min at 4°C
and transferred to a
precooled tube, and DTT and Na
3EDTA
were added to final concentrations
of 5 and 1 mM, respectively.
Purified ParC and ParE proteins were
flash frozen as aliquots in liquid
nitrogen and stored at

70°C.
From 5-liter cultures of transformed
BL21 cells, 6 mg of ParC
and 5 mg of ParE were
recovered.
Topoisomerase catalytic and DNA cleavage assays.
DNA
supercoiling activity, reconstituted with purified S. pneumoniae GyrA and GyrB proteins, was assayed as previously
described (22, 23) with relaxed pBR322 DNA (0.4 µg) as a
substrate (total volume, 35 µl). For decatenation assays, the
standard reaction mixture (20 µl) contained 40 mM Tris-HCl (pH 7.5),
6 mM MgCl2, 10 mM NaCl, 10 mM DTT, 200 mM potassium
glutamate, 1 mM ATP, 50 µg of bovine serum albumin per ml, 450 ng of
kDNA, and various amounts of ParC and ParE proteins. Reaction mixtures
were incubated at 37°C for 1 h, the reactions were terminated by
addition of dye mix, and then the products were analyzed by
electrophoresis in 1% agarose.
Relaxation assay mixtures (20 µl) containing 40 mM Tris-HCl (pH 7.5),
6 mM MgCl
2, 10 mM NaCl, 1 mM spermidine, 1 mM ATP, 50
µg
of bovine serum albumin per ml, 450 ng of supercoiled pBR322,
and
topoisomerase IV subunits were incubated at 37°C for 1 h.
Reactions were terminated, and DNA products were examined by
electrophoresis
on 1.2% agarose
gels.
DNA cleavage assays were carried out as for DNA supercoiling, except
ATP was omitted, and relaxed-DNA substrate was substituted
for with
supercoiled pBR322 DNA. In each reaction, GyrA (0.45
µg) and GyrB
(1.7 µg), or purified ParC (0.45 µg) and ParE (1.7
µg) proteins,
were incubated with DNA in the absence or presence
of fluoroquinolone
drug for 1 h at 25°C. Three microliters of
2% SDS and 3 µl of
a 1-mg/ml concentration of proteinase K were
added, and incubation
continued for 30 min at 37°C. Reactions
were stopped by adding 7 µl
of dye mix, and samples were analyzed
by electrophoresis in a 1%
agarose gel run at 3.5 V/cm. DNA was
visualized by staining with
ethidium bromide, and the gel was
photographed under UV
transillumination with a Land camera and
Polaroid 665 film. The extent
of DNA cleavage was quantitated
from photographic negatives with a
Molecular Dynamics personal
densitometer SI and ImageQuant
software.
Nucleotide sequence accession number.
The S. pneumoniae 7785 genomic DNA sequence contained in plasmids pXP11
and pXP12 has been submitted to the EMBL Data Library under accession
no. AJ005815.
 |
RESULTS |
Overexpression of S. pneumoniae GyrA and GyrB proteins
and reconstitution of gyrase activity.
Our initial attempts to
purify the native S. pneumoniae GyrA and GyrB proteins by
using inducible plasmid constructs in E. coli were
frustrated by the low levels of expression, particularly for GyrA
(32a). To circumvent this difficulty and to facilitate purification, we engineered recombinant genes that express GyrA and
GyrB proteins carrying histidine tags at their C-terminal and
N-terminal ends, respectively. The S. pneumoniae gyrA and gyrB genes were each amplified by PCR with S. pneumoniae 7785 genomic DNA as a template and Vent DNA polymerase,
which has proofreading activity, thereby minimizing the introduction of
PCR errors. The full-length gyrB gene contained between
NdeI and XhoI sites was inserted in frame into
expression vector pET-19b downstream of a T7 promoter, resulting in
plasmid pXP9, which was transformed into E. coli
BL21(
DE3)pLysS. Induction by IPTG of the T7 polymerase gene on the
DE3 prophage was expected to produce a recombinant 72-kDa GyrB protein carrying a decahistidine tag at its N-terminal end.
The gyrA expression construct pXP10 was obtained by
inserting the gyrA gene as two PCR fragments into plasmid
pET-29a by creating an XhoI site 3' of the gene that altered
the Ala-Stop gyrA codons to Leu-Glu. Expression of the gene
was expected to produce the full-length 97-kDa GyrA protein carrying a
hexahistidine tag at its C-terminal end. Milligram amounts of soluble
His-tagged GyrA and GyrB proteins that were each >90% homogeneous
were isolated from cleared lysates of induced BL21 transformants by
one-step nickel chelate chromatography (Fig.
1A).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
SDS-PAGE analysis of purified S. pneumoniae
gyrase (A) and topoisomerase IV (B) subunits. Lanes: A and B, GyrA and
GyrB proteins, respectively; C and E, ParC and ParE proteins,
respectively. Approximately 2 µg of each protein sample was loaded on
an SDS-7.5% polyacrylamide gel, and, following electrophoresis,
proteins were revealed by staining with Coomassie blue. Sizes of
protein markers (M) are indicated to the left.
|
|
The recombinant gyrase proteins were tested for DNA supercoiling
activity with relaxed pBR322 DNA as a substrate (Fig.
2A).
Neither subunit alone induced DNA
supercoiling in the absence
or presence of 1.4 mM ATP (Fig.
2A, lane A
or B). The combination
of GyrA and GyrB subunits led to plasmid
supercoiling in the presence
of ATP that was not observed when ATP was
omitted (Fig.
2A, lanes
AB). The specific activities of the GyrA and
GyrB proteins in
the supercoiling assay were each 2 × 10
5 U/mg.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
Enzymatic activities of S. pneumoniae gyrase
and topoisomerase IV subunits. (A) S. pneumoniae GyrA and
GyrB proteins reconstitute an ATP-dependent DNA supercoiling activity.
Relaxed plasmid pBR322 substrate (0.4 µg) was incubated with gyrase
proteins in the absence or presence of 1.4 mM ATP. Reactions were
stopped, and the DNA was examined by electrophoresis in 1% agarose.
Lanes: a, supercoiled pBR322 control; b, relaxed DNA control; A,
relaxed DNA and GyrA protein (20 ng); B, relaxed DNA and GyrB (20 ng);
AB, relaxed DNA and both GyrA (20 ng) and GyrB (20 ng). N, R, and S
denote nicked, relaxed, and supercoiled DNA, respectively. (B)
Decatenation of kDNA by S. pneumoniae topoisomerase IV. kDNA
(0.4 µg) was incubated with purified ParC (2 ng) and/or ParE (20 ng)
in the presence or absence of 1 mM ATP prior to agarose gel
electrophoresis. Lanes a, kinetoplast DNA control; C, kDNA and ParC; E,
kDNA and ParE; CE, kDNA with ParC and ParE. kDNA remains in the wells
of the agarose gel; the position of monomer circles is indicated.
|
|
Several considerations indicate the observed gyrase activity arises
from the recombinant proteins and is not due to copurifying
enzyme from
the
E. coli host. First, we would not expect the
E. coli gyrase subunits to be retained on the nickel column, because
they lack histidine tags. Second, protein binding and elution
during
chromatography were carried out in the presence of 1.5
M NaCl, which
should disrupt any heterologous subunit interactions.
Studies of
E. coli gyrase bound via GyrB to novobiocin-Sepharose
have
shown that 1.0 M NaCl allows selective elution of GyrA (
37).
Third, SDS-PAGE analysis did not reveal the presence of bands
that
would correspond to the 100-kDa GyrA and 90-kDa GyrB subunits
from
E. coli (Fig.
1A). Fourth, neither subunit alone was able
to
supercoil DNA in the presence of ATP (Fig.
2). Finally, although
DNA
supercoiling by
E. coli gyrase is inhibited by ciprofloxacin
with a 50% inhibitory concentration (IC
50) of 0.7 µM
(
27a), the
ciprofloxacin IC
50 for the
recombinant enzyme was 60-fold higher
(described below), a value
similar to that measured for gyrase
from other gram-positive species
(e.g.,
S. aureus) (
4,
38).
Expression, purification, and characterization of S. pneumoniae topoisomerase IV.
Full-length parC and
parE genes were amplified by PCR with Vent DNA polymerase
and the S. pneumoniae 7785 DNA template and inserted into
pET vectors in a similar manner to that described for the gyrase genes,
yielding expression constructs pXP13 and pXP14, respectively. Induction
of exponentially growing cultures of BL21(
DE3) transformants
resulted in low-level expression of ParC and ParE, both predominantly
in an insoluble form (not shown). However, solubilization in 6 M urea
and on-column renaturation yielded milligram amounts of soluble 93-kDa
ParC and 72-kDa ParE proteins that were both >95% homogeneous by
SDS-PAGE (Fig. 1B).
Enzyme activity was examined with a decatenation assay that monitors
the ATP-dependent unlinking of DNA minicircles from kDNA
(Fig.
2B).
Neither the ParC nor ParE subunit alone, assayed in
the absence or
presence of 1 mM ATP, had decatenation activity:
the kDNA remained
intact and failed to migrate from the wells.
However, when combined,
ParC and ParE promoted decatenation and
minicircle release in a
reaction dependent on ATP. By using an
excess of the complementing
subunit, the specific activities of
the
S. pneumoniae ParC
and ParE proteins in the decatenation assay
were determined as
10
6 and 10
5 U/mg,
respectively.
ATP-dependent relaxation of supercoiled plasmid pBR322 by topoisomerase
IV was also examined (data not shown). Both subunits
and ATP were
needed to reconstitute DNA relaxation. The specific
activities of the
ParC and ParE proteins in the relaxation assay
were 2.7 × 10
4 and 1 × 10
4 U/mg, respectively. Thus,
the purified
S. pneumoniae ParC and
ParE proteins
reconstituted highly efficient DNA decatenation
and relaxation
commensurate with a DNA topoisomerase IV
activity.
Inhibition of gyrase and topoisomerase IV enzyme activities by
antipneumococcal fluoroquinolones.
Access to S. pneumoniae topoisomerases allowed us to examine and compare the
effects of various fluoroquinolones on their principal enzymatic
activities: DNA supercoiling for gyrase and decatenation by
topoisomerase IV (Fig. 3 and 4). For
gyrase assays, 1 U of enzyme was employed, which in the absence of drug
is sufficient to convert 50% of 0.4 µg of relaxed plasmid pBR322 DNA
to the supercoiled form under standard conditions (Fig. 3, lane 3). DNA supercoiling was inhibited in a dose-dependent manner by ciprofloxacin, sparfloxacin, and clinafloxacin, with IC50s (the
concentration of drug required to inhibit DNA supercoiling by 50%) of
40, 40, and 2.5 µM, respectively. Thus, ciprofloxacin and
sparfloxacin were equally good inhibitors, but were 16-fold less potent
than clinafloxacin.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Fluoroquinolone inhibition of DNA supercoiling by
S. pneumoniae gyrase. Relaxed pBR322 DNA (0.4 µg) was
incubated with GyrA (1 U) and GyrB (1 U) proteins plus 1.4 mM ATP in
the absence or presence of drugs. DNA was analyzed as described in the
legend to Fig. 2. The concentration of ciprofloxacin (CIP),
sparfloxacin (SPAR), or clinafloxacin (CLN) included in each reaction
is shown on the figure. Lanes a and b, supercoiled- and relaxed-DNA
controls, respectively.
|
|
In the case of DNA decatenation by
S. pneumoniae
topoisomerase IV, reactions were set up with 1 U of topoisomerase IV
activity
in the absence or presence of increasing drug concentrations
(Fig.
4). In the absence of drug, the
enzyme converted approximately
50% of the input kDNA to free
minicircles. Inclusion of any of
the three quinolones resulted in a
dose-dependent inhibition of
decatenation. Ciprofloxacin and
sparfloxacin were comparably effective,
with IC
50s (the
drug concentration that inhibits decatenation
by 50%) of 10 to 20 µM
(Fig.
4). Clinafloxacin was the best inhibitor,
displaying an
IC
50 of 1 to 2.5 µM.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of DNA decatenation by S. pneumoniae topoisomerase IV. kDNA (0.4 µg) was incubated with
ParC (1 U), ParE (1 U), and 1.4 mM ATP in the presence or absence of
quinolones (ciprofloxacin [CIP], sparfloxacin [SPAR], or
clinafloxacin [CLN]) at the indicated concentrations. DNA was
analyzed by agarose gel electrophoresis.
|
|
Fluoroquinolone stabilization of cleavable complexes: preferential
DNA breakage by S. pneumoniae topoisomerase IV.
Figure
5 compares the abilities of different
fluoroquinolones to induce DNA linearization of supercoiled pBR322 DNA
by S. pneumoniae gyrase and topoisomerase IV. Supercoiled
pBR322 DNA was incubated with enzyme in the absence or presence of
quinolone. DNA breakage was induced by addition of SDS, and following
proteinase K digestion, the DNA was examined by agarose gel
electrophoresis. Ciprofloxacin and sparfloxacin were comparably
efficient at promoting gyrase-mediated DNA breakage, with the
proportion of linear DNA increasing in a dose-dependent fashion (Fig.
5A). For these quinolones, the (CC25) concentration of drug
necessary to promote 25% linearization of the DNA by gyrase was 80 µM. However, clinafloxacin was much more effective in promoting DNA
breakage, with a CC25 of 2.5 µM (Fig. 5A). At >5 µM,
linear DNA was the predominant DNA species (Fig. 5A). Thus,
clinafloxacin was some 20- to 40-fold more effective than either
ciprofloxacin or sparfloxacin in mediating cleavable complex formation
with gyrase.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Fluoroquinolone-mediated DNA cleavage is more efficient
for S. pneumoniae topoisomerase IV than gyrase. (A)
Drug-dependent DNA breakage by gyrase. Supercoiled pBR322 (0.4 µg)
was incubated with pneumococcal GyrA (25 U) and GyrB (100 U) proteins
at the concentrations of ciprofloxacin, (CIP), sparfloxacin (SPAR), and
clinafloxacin (CLN) indicated on the figure. After treatment with SDS
and proteinase K, DNA samples were examined by electrophoresis in 1%
agarose. Lanes a and b, supercoiled and linear pBR322 DNA,
respectively. (B) DNA cleavage by topoisomerase IV. Amounts of ParC and
ParE equivalent to those of the gyrase subunits in panel A were
incubated with various quinolones and pBR322 DNA. After induction of
DNA breakage, DNA samples were processed for agarose gel
electrophoresis as described for gyrase.
|
|
The results of DNA cleavage experiments involving topoisomerase IV are
shown in Fig.
5B. The same molar amounts of topoisomerase
IV proteins
were employed as were used for gyrase in Fig.
5A.
It can be seen
immediately that much lower concentrations of each
of the three
quinolones were needed to induce DNA breakage by
topoisomerase IV: the
CC
25s for ciprofloxacin, sparfloxacin, and
clinafloxacin
were 1.0, 1.0, and 0.1 µM, respectively. Table
1 collects together the various
IC
50 and CC
25 data for comparison
with the
quinolone MICs previously determined for
S. pneumoniae 7785. These data are representative and have been obtained reproducibly
in
several independent experiments. Clinafloxacin was the most
potent
enzyme inhibitor against gyrase and topoisomerase IV.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Inhibitory effects of fluoroquinolones on S. pneumoniae gyrase, topoisomerase IV, and growth of S. pneumoniae 7785
|
|
 |
DISCUSSION |
We have expressed S. pneumoniae gyrase and
topoisomerase IV in E. coli, purified the enzymes to
homogeneity, and compared their interactions with new antipneumococcal
quinolones. The key to expressing the S. pneumoniae gyrase
and topoisomerase IV proteins was the use of His-tagged vectors.
Previously, we had not been successful in purifying either enzyme in
native form from S. pneumoniae or in isolating native
recombinant S. pneumoniae proteins expressed in E. coli, due to their low level of expression, particularly for GyrA
(32a). The use of His-tagged subunits facilitated rapid protein purification by metal affinity chromatography, yielding products free of host gyrase and topoisomerase IV proteins.
Purification of native type II topoisomerases from S. pneumoniae has not been reported. However, the pneumococcal gyrase
and topoisomerase IV subunits described here were comparably active to
their counterparts from other sources. Thus, the S. pneumoniae GyrA and GyrB proteins had specific activities in the
DNA supercoiling assay of ~2 × 105 U/mg, which
compare favorably with specific activities of 106 and
105 U/mg observed for native E. coli GyrA and
GyrB (22) and 102 to 103 U/mg
measured for the native and recombinant S. aureus gyrase proteins, respectively (4, 38). The activity of S. aureus gyrase could be increased 500-fold by the inclusion of 700 mM potassium glutamate, perhaps mimicking the high intracellular aspartate and glutamate levels found in S. aureus
(4). (We found that addition of 700 mM potassium glutamate
increased the activity of S. pneumoniae gyrase approximately
15-fold [32a]). Although we do not have wild-type
S. pneumoniae proteins for analysis, from these results, it
appears that the histidine-tagged S. pneumoniae gyrase
proteins display comparable activity to the native E. coli and S. aureus counterparts. Moreover, it has been reported
recently that S. aureus gyrase and topoisomerase IV
holoenzymes reconstituted from His-tagged subunits have specific
activities identical to published values, and these proteins behaved
similarly to the native enzymes in their responses to quinolones
(35).
For S. pneumoniae, there are a number of interesting
features of the in vitro and in vivo responses to quinolones that
deserve comment (Table 1). First, sparfloxacin and ciprofloxacin had very similar inhibitory activities in vitro, whether measured in the
DNA supercoiling, DNA decatenation, or DNA breakage assays. Despite
these similarities, comparison of MICs shows that sparfloxacin was
fourfold more potent than ciprofloxacin against S. pneumoniae 7785 (Table 1). One factor that could plausibly explain
the greater in vivo activity of sparfloxacin is less-efficient efflux
compared to that of ciprofloxacin. Second, a striking feature of Table 1 is that clinafloxacin, when examined in any of the enzyme assays, was
a markedly more potent inhibitor than sparfloxacin or ciprofloxacin. Thus, the IC50s of clinafloxacin for DNA supercoiling by
gyrase and for DNA decatenation by topoisomerase IV were some 10- to 20-fold lower. Moreover, the CC25s obtained in the DNA
cleavage experiments were 32-fold lower for gyrase and 10-fold lower
for topoisomerase IV. The CC25s are useful, because
trapping of type II topoisomerases by quinolones as cleavable complexes
on DNA is thought to be the cytotoxic lesion initiating the
antibacterial action of these drugs (18, 19). The much lower
values for clinafloxacin support our recent suggestion that the greater
antibacterial activity of the drug is due to intrinsic tight binding to
its enzyme targets in vivo (32). However, the 10- to 32-fold
differences in CC25s over those of sparfloxacin and
ciprofloxacin are not reflected proportionally in the MICs (Table 1),
suggesting that other factors contribute to drug action in vivo. Third,
it is interesting that all three quinolones showed an in vitro
preference for topoisomerase IV, with CC25s that were 25- to 80-fold lower than those against gyrase (Table 1), the inverse of
that seen with E. coli gyrase and topoisomerase IV. This was
particularly surprising, because genetic experiments have shown that
the three quinolones have different targets in S. pneumoniae: ciprofloxacin and sparfloxacin act preferentially
through topoisomerase IV and gyrase, respectively, whereas
clinafloxacin acts through both, with a weak preference for gyrase
(32). (A recent abstract has also reported the preferential
targeting of topoisomerase IV by sparfloxacin in vitro and the
equipotency of sitafloxacin [24].) Overall, there was
no rigid correlation between enzyme inhibition, MICs, and target
preferences in vivo.
Recently, the preference of quinolones for topoisomerase IV has also
been observed in comparisons of S. aureus topoisomerase IV
and gyrase in vitro, using either native or His-tagged holoenzymes (4, 35). Thus, ciprofloxacin, sparfloxacin, and norfloxacin were some 10- to 250-fold more effective in stabilizing covalent complexes with native S. aureus topoisomerase IV than with
DNA gyrase (4). Similarly clinafloxacin, trovafloxacin,
ciprofloxacin, norfloxacin, and oxolinic acid showed a 2- to 50-fold
preference for His-tagged topoisomerase IV (35). Although
for a number of quinolones, these results concur with the known in vivo
target preference for topoisomerase IV, in the case of sparfloxacin, there are differences between the in vivo and in vitro data.
Sparfloxacin is >50-fold more effective in stimulating DNA cleavage by
topoisomerase IV over gyrase in vitro (4), and yet it
appears to kill S. aureus cells by acting through both
gyrase and topoisomerase IV (8). Clearly, for both S. aureus and S. pneumoniae, there are differences between
targeting preferences seen in vitro with purified proteins and those
suggested by genetic approaches.
How can these differences be reconciled? One hypothesis would be to
assume that all quinolones preferentially target DNA topoisomerase IV
in S. pneumoniae. For those quinolones such as sparfloxacin and clinafloxacin that select gyrA (but not parC
or parE) QRDR mutants in the first step, it would then have
to be assumed that these are not genuine single-step mutants, but carry
a second mutation (thus far undetected) in topoisomerase IV lying
outside of the QRDRs. However, to explain the lack of cross-resistance with other quinolones, this putative second mutation would have to
affect specifically sparfloxacin and clinafloxacin and not, e.g.,
ciprofloxacin. Second, the observed frequencies of first-step gyrA mutants obtained by challenge with sparfloxacin (at
4 × MIC) and clinafloxacin (at the MIC) are each in the range
5 × 10
10 to 8 × 10
10, values
that appear very high for single-step selection of putative double
mutants (31, 32). Third, from studies with E. coli and other gram-negative bacteria, it is known that gyrase is
the in vivo and in vitro target of a variety of quinolones, including ciprofloxacin. Thus, either gyrase or topoisomerase IV can be a primary
quinolone target. Although full sequence analysis of topoisomerase IV
genes in quinolone-resistant mutants would be desirable, these
constraints would seem to argue against the hypothesis favoring
topoisomerase IV as the invariant quinolone target in S. pneumoniae.
The converse explanation is that measurements of cleavable complex
formation using purified enzymes in vitro may not faithfully reflect
the situation inside bacteria. First, it is possible that recombinant
enzymes prepared by expression in E. coli may not reproduce
the characteristics of the native proteins. For example, in our case,
the renaturation of topoisomerase IV subunits from inclusion bodies,
which was not required for gyrase subunits, may have affected the
sensitivity of the reconstituted topoisomerase IV to quinolones.
Although unlikely, such explanations remain to be formally excluded.
Second, the in vivo targeting of gyrase by clinafloxacin and
sparfloxacin in S. pneumoniae could result from preferential
cleavable complex formation with gyrase (instead of topoisomerase IV)
under intracellular conditions. Obviously, the particular DNA template,
salt, Mg2+, polyamine, ATP, DNA supercoiling, enzyme, and
other conditions that prevail in the bacterium may be difficult to
reproduce in vitro. It is also conceivable that individual quinolones
are uniquely and unevenly distributed in the bacterial cell in a way
that could affect complex formation with the two enzymes. This could be
important if the target enzymes are themselves distributed in a
nonuniform fashion. In fact, it is already known from studies with
Bacillus subtilis that topoisomerase IV has a bipolar
localization, whereas gyrase is associated with the nucleoid
(14). More data will be needed about cleavable complex
formation in S. pneumoniae.
Finally, and our preferred model, the discrepancy between in vitro and
in vivo results could arise through differential lethality of cleavable
complexes in vivo. Obviously, unlike the assay of DNA breakage in
vitro, which largely reflects drug-target affinity, in vivo targeting
revealed through genetic experiments identifies the most important
killing pathway, in which killing is a complex process involving
drug-enzyme binding and formation of a cleavable complex, followed by
downstream events, such as collisions with replication forks that
convert the cleavable complex into a lethal lesion thought to be a
chromosomal double-stranded DNA break. It has been suggested from
studies of E. coli that gyrase acts ahead of the replication
fork, whereas topoisomerase IV acts predominantly behind the fork,
allowing time for repair of quinolone-induced DNA damage
(44). This scenario predicts that cleavable complex formation through gyrase would give rapid killing, whereas that involving topoisomerase IV would be a slow process, a pattern of
behavior that has recently been observed in comparisons of norfloxacin's actions against E. coli and its
gyrA mutants (18). However, unlike E. coli, in which gyrase is usually the primary quinolone target, the
situation in S. pneumoniae is more complex, in that
different quinolones appear to have different targets in vivo.
Conceivably, cleavable complex formation through topoisomerase IV or
gyrase may be more or less lethal for some quinolones than for others.
Resolution of these questions must await the development of an in vitro
S. pneumoniae replication model in which quinolone effects
can be examined in detail. However, the efficient expression system for
S. pneumoniae type II topoisomerases described in this paper
should facilitate further studies of the selectivity of antipneumococcal fluoroquinolones and open the way to crystallographic approaches aimed at elucidating the molecular basis of
quinolone-topoisomerase interactions.
 |
ACKNOWLEDGMENTS |
We thank Howard Nash for useful discussions; Ming-shi Li for help
with laser densitometry; and Stephen J. Gracheck, Michael A. Cohen, and
Jing Li for helpful comments on the manuscript.
This work was supported by a grant from Parke-Davis, Co.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Genetics Group, Department of Biochemistry, St. George's Hospital
Medical School, University of London, Cranmer Terrace, London SW17 0RE, United Kingdom. Fax: 44 181 725 2992. E-mail:
lfisher{at}sghms.ac.uk.
 |
REFERENCES |
| 1.
|
Adams, D. E.,
E. M. Shekhtman,
E. L. Zechiedrich,
M. B. Schmid, and N. R. Cozzarelli.
1992.
The role of topoisomerase IV in partitioning DNA replicons and the structure of catenated intermediates in DNA replication.
Cell
71:277-288[Medline].
|
| 2.
|
Balas, D.,
E. Fernández-Moreira, and A. G. De la Campa.
1998.
Molecular characterization of the gene encoding the DNA gyrase A subunit of Streptococcus pneumoniae.
J. Bacteriol.
180:2854-2861[Abstract/Free Full Text].
|
| 3.
|
Bartlett, J. G., and L. M. Grundy.
1995.
Community-acquired pneumonia.
N. Engl. J. Med.
333:1618-1624[Free Full Text].
|
| 4.
|
Blanche, F.,
B. Cameron,
F.-X. Bernard,
L. Maton,
B. Manse,
L. Ferrero,
N. Ratet,
C. Lecoq,
A. Goniot,
D. Bisch, and J. Crouzet.
1996.
Differential behaviors of Staphylococcus aureus and Escherichia coli type II topoisomerases.
Antimicrob. Agents Chemother.
40:2714-2720[Abstract].
|
| 5.
|
Cullen, M. E.,
A. W. Wyke,
R. Kuroda, and L. M. Fisher.
1989.
Cloning and characterization of a DNA gyrase A gene from Escherichia coli that confers clinical resistance to 4-quinolones.
Antimicrob. Agents Chemother.
33:886-894[Abstract/Free Full Text].
|
| 6.
|
Drlica, K., and X. Zhao.
1997.
DNA gyrase, topoisomerase IV, and the 4-quinolones.
Microbiol. Mol. Biol. Rev.
61:377-392[Abstract].
|
| 7.
|
Ferrero, L.,
B. Cameron,
B. Manse,
D. Lagneux,
J. Crouzet,
A. Famechon, and F. Blanche.
1994.
Cloning and primary structure of Staphylococcus aureus DNA topoisomerase IV: a primary target for quinolones.
Mol. Microbiol.
13:641-653[Medline].
|
| 8.
|
Fournier, B., and D. C. Hooper.
1998.
Mutations in topoisomerase IV and DNA gyrase of Staphylococcus aureus: novel pleiotropic effects on quinolone and coumarin activity.
Antimicrob. Agents Chemother.
42:121-128[Abstract/Free Full Text].
|
| 9.
|
Gellert, M.,
K. Mizuuchi,
M. H. O'Dea,
T. Itoh, and J.-I. Tomizawa.
1977.
Nalidixic acid resistance: a second genetic character involved in DNA gyrase activity.
Proc. Natl. Acad. Sci. USA
74:4772-4776[Abstract/Free Full Text].
|
| 10.
|
Gellert, M.,
K. Mizuuchi,
M. H. O'Dea, and H. A. Nash.
1976.
DNA gyrase: an enzyme that introduces superhelical turns into DNA.
Proc. Natl. Acad. Sci. USA
73:3872-3876[Abstract/Free Full Text].
|
| 11.
|
Gootz, T. D.,
R. Zaniewski,
S. Haskell,
B. Schmieder,
J. Tankovic,
D. Girard,
P. Courvalin, and R. J. Polzer.
1996.
Activity of the new fluoroquinolone trovafloxacin (CP-99,219) against DNA gyrase and topoisomerase IV mutants of Streptococcus pneumoniae selected in vitro.
Antimicrob. Agents Chemother.
40:2691-2697[Abstract].
|
| 12.
|
Heisig, P.
1996.
Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli.
Antimicrob. Agents Chemother.
40:879-885[Abstract].
|
| 13.
|
Hofmann, J.,
M. S. Cetron,
M. M. Farley,
W. S. Baughman,
R. R. Facklam,
J. A. Elliott,
K. A. Deaver, and R. A. Breiman.
1995.
The prevalence of drug-resistant Streptococcus pneumoniae in Atlanta.
N. Engl. J. Med.
333:481-486[Abstract/Free Full Text].
|
| 14.
|
Huang, W.-H.,
J. L. Libbey,
P. van der Hoeven, and S. X. Hu.
1998.
Bipolar localization of Bacillus subtilis topoisomerase IV, an enzyme required for chromosome segregation.
Proc. Natl. Acad. Sci. USA
95:4652-4657[Abstract/Free Full Text].
|
| 15.
|
Jado, I.,
A. Fenoll,
J. Casal, and A. Perez.
1998.
Nucleotide sequence and chromosomal location of L-lactate dehydrogenase gene of Streptococcus pneumoniae.
Curr. Microbiol.
37:77-19[Medline].
|
| 16.
|
Janoir, C.,
V. Zeller,
M.-D. Kitzis,
N. J. Moreau, and L. Gutmann.
1996.
High-level fluoroquinolone resistance in Streptococcus pneumoniae requires mutations in parC and gyrA.
Antimicrob. Agents Chemother.
40:2760-2764[Abstract].
|
| 17.
|
Kato, J.,
Y. Nishimura,
R. Imamura,
H. Niki,
S. Higara, and H. Suzuki.
1990.
New topoisomerase essential for chromosomal segregation in E. coli.
Cell
63:393-404[Medline].
|
| 18.
|
Khodursky, A. B., and N. R. Cozzarelli.
1998.
The mechanism of inhibition of topoisomerase IV by quinolone antibacterials.
J. Biol. Chem.
273:27668-27677[Abstract/Free Full Text].
|
| 19.
|
Kreuzer, K. N., and N. R. Cozzarelli.
1979.
Escherichia coli mutants thermosensitive for deoxyribonucleic acid gyrase subunit A: effects on deoxyribonucleic acid replication, transcription, and bacteriophage growth.
J. Bacteriol.
140:424-435[Abstract/Free Full Text].
|
| 20.
|
Mandell, L. A.
1998.
New treatment options for pneumonia.
Infect. Med.
15:E34-E43.
|
| 21.
|
Mizuuchi, K.,
L. M. Fisher,
M. H. O'Dea, and M. Gellert.
1990.
DNA gyrase action involves the introduction of transient double strand breaks into DNA.
Proc. Natl. Acad. Sci. USA
77:1847-1851.
|
| 22.
|
Mizuuchi, K.,
M. Mizuuchi,
M. H. O'Dea, and M. Gellert.
1984.
Cloning and simplified purification of Escherichia coli DNA gyrase A and B proteins.
J. Biol. Chem.
259:9199-9201[Abstract/Free Full Text].
|
| 23.
|
Mizuuchi, K.,
M. H. O'Dea, and M. Gellert.
1978.
DNA gyrase: subunit structure and ATPase activity of the purified enzyme.
Proc. Natl. Acad. Sci. USA
75:5960-5963[Abstract/Free Full Text].
|
| 24.
|
Morrissey, I.
1998.
The unique equipotency of sitafloxacin against topoisomerase IV and DNA gyrase from Streptococcus pneumoniae, p. 55.
In
Abstracts of the Sixth International Symposium on New Quinolones, Denver, Colo..
|
| 25.
|
Muñoz, R., and A. G. De la Campa.
1996.
ParC subunit of DNA topoisomerase IV of Streptococcus pneumoniae is a primary target of quinolones and cooperates with DNA gyrase A subunit in forming resistance phenotype.
Antimicrob. Agents Chemother.
40:2252-2257[Abstract].
|
| 26.
|
Nakamura, S.
1997.
Mechanisms of quinolone resistance.
J. Infect. Chemother.
3:128-138.
|
| 27.
|
Ng, E. Y.,
M. Trucksis, and D. C. Hooper.
1996.
Quinolone resistance mutations in topoisomerase IV: relationship to the flqA locus and genetic evidence that topoisomerase IV is the primary target and DNA gyrase is the secondary target of fluoroquinolones in Staphylococcus aureus.
Antimicrob. Agents Chemother.
40:1881-1888[Abstract].
|
| 27a.
| Oram, M., and L. M. Fisher. Unpublished data.
|
| 28.
|
Pallares, R.,
J. Linares,
M. Vadillo,
C. Carbellos,
F. Manresa,
P. F. Viladrich,
R. Martin, and F. Gudiol.
1995.
Resistance to penicillin and cephalosporin and mortality from severe pneumococcal pneumonia in Barcelona, Spain.
N. Engl. J. Med.
333:474-480[Abstract/Free Full Text].
|
| 29.
|
Pan, X.-S.,
J. Ambler,
S. Mehtar, and L. M. Fisher.
1996.
Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
40:2321-2326[Abstract].
|
| 30.
|
Pan, X.-S., and L. M. Fisher.
1996.
Cloning and characterization of the parC and parE genes of Streptococcus pneumoniae encoding DNA topoisomerase IV: role in fluoroquinolone resistance.
J. Bacteriol.
178:4060-4069[Abstract/Free Full Text].
|
| 31.
|
Pan, X.-S., and L. M. Fisher.
1997.
Targeting of DNA gyrase in Streptococcus pneumoniae by sparfloxacin: selective targeting of gyrase or topoisomerase IV by quinolones.
Antimicrob. Agents Chemother.
41:471-474[Abstract].
|
| 32.
|
Pan, X.-S., and L. M. Fisher.
1998.
DNA gyrase and topoisomerase IV are dual targets of clinafloxacin action in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:2810-2816[Abstract/Free Full Text].
|
| 32a.
| Pan, X.-S., and L. M. Fisher.
Unpublished observations.
|
| 33.
|
Perichon, B.,
J. Tankovic, and P. Courvalin.
1997.
Characterization of a mutation in the parE gene that confers fluoroquinolone resistance in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
41:1166-1167[Abstract].
|
| 34.
|
Piddock, L. J. V.
1994.
New quinolones and gram-positive bacteria.
Antimicrob. Agents Chemother.
38:163-169[Free Full Text].
|
| 35.
|
Saiki, A. Y. C.,
L. L. Shen,
C.-M. Chen,
J. Baranowski, and C. Lerner.
1998.
Cleavage of DNA by quinolone and 2-pyridone antibacterial agents mediated by Staphylococcus aureus DNA gyrase and DNA topoisomerase IV, abstr. P31, p. 42.
In
Ninth Conference on DNA Topoisomerases in Therapy, New York, N.Y..
|
| 36.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 37.
|
Staudenbauer, W. L., and E. Orr.
1981.
DNA gyrase: affinity chromatography on novobiocin-Sepharose and catalytic properties.
Nucleic Acids Res.
9:3589-3603[Abstract/Free Full Text].
|
| 38.
|
Tanaka, M.,
Y. Onodera,
Y. Uchida,
K. Sato, and I. Hayakawa.
1997.
Inhibitory activities of quinolones against DNA gyrase and topoisomerase IV purified from Staphylococcus aureus.
Antimicrob. Agents Chemother.
41:2362-2366[Abstract].
|
| 39.
|
Tankovic, J.,
B. Perichon,
J. Duval, and P. Courvalin.
1996.
Contribution of mutations in the gyrA and parC genes to fluoroquinolone resistance of mutants of Streptococcus pneumoniae obtained in vivo and in vitro.
Antimicrob. Agents Chemother.
40:2505-2510[Abstract].
|
| 40.
|
Tomasz, A.
1995.
The pneumococcus at the gates.
N. Engl. J. Med.
333:314-315.
|
| 41.
|
Wang, J. C.
1996.
DNA topoisomerases.
Annu. Rev. Biochem.
65:635-692[Medline].
|
| 42.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272[Abstract/Free Full Text].
|
| 43.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura,
L. M. Yamanaka, and S. Nakamura.
1991.
Quinolone resistance-determining region in the DNA gyrase gyrB gene of Escherichia coli.
Antimicrob. Agents Chemother.
35:1647-1650[Abstract/Free Full Text].
|
| 44.
|
Zechiedrich, E. L., and N. R. Cozzarelli.
1995.
Roles of topoisomerase IV and DNA gyrase in DNA unlinking during replication in Escherichia coli.
Genes Dev.
9:2859-2869[Abstract/Free Full Text].
|
Antimicrobial Agents and Chemotherapy, May 1999, p. 1129-1136, Vol. 43, No. 5
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pan, X.-S., Gould, K. A., Fisher, L. M.
(2009). Probing the Differential Interactions of Quinazolinedione PD 0305970 and Quinolones with Gyrase and Topoisomerase IV. Antimicrob. Agents Chemother.
53: 3822-3831
[Abstract]
[Full Text]
-
Oppegard, L. M., Hamann, B. L., Streck, K. R., Ellis, K. C., Fiedler, H.-P., Khodursky, A. B., Hiasa, H.
(2009). In Vivo and In Vitro Patterns of the Activity of Simocyclinone D8, an Angucyclinone Antibiotic from Streptomyces antibioticus. Antimicrob. Agents Chemother.
53: 2110-2119
[Abstract]
[Full Text]
-
Cambau, E., Matrat, S., Pan, X.-S., Roth Dit Bettoni, R., Corbel, C., Aubry, A., Lascols, C., Driot, J.-Y., Fisher, L. M.
(2009). Target specificity of the new fluoroquinolone besifloxacin in Streptococcus pneumoniae, Staphylococcus aureus and Escherichia coli. J Antimicrob Chemother
63: 443-450
[Abstract]
[Full Text]
-
Pan, X. S., Dias, M., Palumbo, M., Fisher, L. M.
(2008). Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage. Nucleic Acids Res
36: 5516-5529
[Abstract]
[Full Text]
-
Richter, S. N., Giaretta, G., Comuzzi, V., Leo, E., Mitchenall, L. A., Fisher, L. M., Maxwell, A., Palumbo, M.
(2007). Hot-spot consensus of fluoroquinolone-mediated DNA cleavage by Gram-negative and Gram-positive type II DNA topoisomerases. Nucleic Acids Res
35: 6075-6085
[Abstract]
[Full Text]
-
Arsene, S., Leclercq, R.
(2007). Role of a qnr-Like Gene in the Intrinsic Resistance of Enterococcus faecalis to Fluoroquinolones. Antimicrob. Agents Chemother.
51: 3254-3258
[Abstract]
[Full Text]
-
Matrat, S., Petrella, S., Cambau, E., Sougakoff, W., Jarlier, V., Aubry, A.
(2007). Expression and Purification of an Active Form of the Mycobacterium leprae DNA Gyrase and Its Inhibition by Quinolones. Antimicrob. Agents Chemother.
51: 1643-1648
[Abstract]
[Full Text]
-
Richter, S. N., Leo, E., Giaretta, G., Gatto, B., Fisher, L. M., Palumbo, M.
(2006). Clerocidin interacts with the cleavage complex of Streptococcus pneumoniae topoisomerase IV to induce selective irreversible DNA damage. Nucleic Acids Res
34: 1982-1991
[Abstract]
[Full Text]
-
Ip, M., Chau, S. S. L., Chi, F., Qi, A., Lai, R. W. M.
(2006). Rapid Screening of Fluoroquinolone Resistance Determinants in Streptococcus pneumoniae by PCR-Restriction Fragment Length Polymorphism and Single-Strand Conformational Polymorphism.. J. Clin. Microbiol.
44: 970-975
[Abstract]
[Full Text]
-
Strahilevitz, J., Hooper, D. C.
(2005). Dual Targeting of Topoisomerase IV and Gyrase To Reduce Mutant Selection: Direct Testing of the Paradigm by Using WCK-1734, a New Fluoroquinolone, and Ciprofloxacin. Antimicrob. Agents Chemother.
49: 1949-1956
[Abstract]
[Full Text]
-
Leo, E., Gould, K. A., Pan, X.-S., Capranico, G., Sanderson, M. R., Palumbo, M., Fisher, L. M.
(2005). Novel Symmetric and Asymmetric DNA Scission Determinants for Streptococcus pneumoniae Topoisomerase IV and Gyrase Are Clustered at the DNA Breakage Site. J. Biol. Chem.
280: 14252-14263
[Abstract]
[Full Text]
-
Dupont, P., Aubry, A., Cambau, E., Gutmann, L.
(2005). Contribution of the ATP Binding Site of ParE to Susceptibility to Novobiocin and Quinolones in Streptococcus pneumoniae. J. Bacteriol.
187: 1536-1540
[Abstract]
[Full Text]
-
Gould, K. A., Pan, X.-S., Kerns, R. J., Fisher, L. M.
(2004). Ciprofloxacin Dimers Target Gyrase in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
48: 2108-2115
[Abstract]
[Full Text]
-
Aubry, A., Pan, X.-S., Fisher, L. M., Jarlier, V., Cambau, E.
(2004). Mycobacterium tuberculosis DNA Gyrase: Interaction with Quinolones and Correlation with Antimycobacterial Drug Activity. Antimicrob. Agents Chemother.
48: 1281-1288
[Abstract]
[Full Text]
-
de la Campa, A. G., Ferrandiz, M.-J., Tubau, F., Pallares, R., Manresa, F., Linares, J.
(2003). Genetic Characterization of Fluoroquinolone-Resistant Streptococcus pneumoniae Strains Isolated during Ciprofloxacin Therapy from a Patient with Bronchiectasis. Antimicrob. Agents Chemother.
47: 1419-1422
[Abstract]
[Full Text]
-
Hiasa, H., Shea, M. E., Richardson, C. M., Gwynn, M. N.
(2003). Staphylococcus aureus Gyrase-Quinolone-DNA Ternary Complexes Fail to Arrest Replication Fork Progression in Vitro. EFFECTS OF SALT ON THE DNA BINDING MODE AND THE CATALYTIC ACTIVITY OF S. AUREUS GYRASE. J. Biol. Chem.
278: 8861-8868
[Abstract]
[Full Text]
-
Fisher, L. M., Heaton, V. J.
(2003). Dual activity of fluoroquinolones against Streptococcus pneumoniae. J Antimicrob Chemother
51: 463-464
[Full Text]
-
Smith, H. J., Nichol, K. A., Hoban, D. J., Zhanel, G. G.
(2003). Reply. J Antimicrob Chemother
51: 464-465
[Full Text]
-
Kishii, R., Takei, M., Fukuda, H., Hayashi, K., Hosaka, M.
(2003). Contribution of the 8-Methoxy Group to the Activity of Gatifloxacin against Type II Topoisomerases of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
47: 77-81
[Abstract]
[Full Text]
-
Ince, D., Zhang, X., Silver, L. C., Hooper, D. C.
(2002). Dual Targeting of DNA Gyrase and Topoisomerase IV: Target Interactions of Garenoxacin (BMS-284756, T-3811ME), a New Desfluoroquinolone. Antimicrob. Agents Chemother.
46: 3370-3380
[Abstract]
[Full Text]
-
Croisier, D., Chavanet, P., Lequeu, C., Ahanou, A., Nierlich, A., Neuwirth, C., Piroth, L., Duong, M., Buisson, M., Portier, H.
(2002). Efficacy and pharmacodynamics of simulated human-like treatment with levofloxacin on experimental pneumonia induced with penicillin-resistant pneumococci with various susceptibilities to fluoroquinolones. J Antimicrob Chemother
50: 349-360
[Abstract]
[Full Text]
-
Smith, H. J., Nichol, K. A., Hoban, D. J., Zhanel, G. G.
(2002). Dual activity of fluoroquinolones against Streptococcus pneumoniae: the facts behind the claims. J Antimicrob Chemother
49: 893-895
[Full Text]
-
Onodera, Y., Okuda, J., Tanaka, M., Sato, K.
(2002). Inhibitory Activities of Quinolones against DNA Gyrase and Topoisomerase IV of Enterococcus faecalis. Antimicrob. Agents Chemother.
46: 1800-1804
[Abstract]
[Full Text]
-
Yague, G., Morris, J. E., Pan, X.-S., Gould, K. A., Fisher, L. M.
(2002). Cleavable-Complex Formation by Wild-Type and Quinolone-Resistant Streptococcus pneumoniae Type II Topoisomerases Mediated by Gemifloxacin and Other Fluoroquinolones. Antimicrob. Agents Chemother.
46: 413-419
[Abstract]
[Full Text]
-
Morris, J. E., Pan, X.-S., Fisher, L. M.
(2002). Grepafloxacin, a Dimethyl Derivative of Ciprofloxacin, Acts Preferentially through Gyrase in Streptococcus pneumoniae: Role of the C-5 Group in Target Specificity. Antimicrob. Agents Chemother.
46: 582-585
[Abstract]
[Full Text]
-
Pan, X.-S., Yague, G., Fisher, L. M.
(2001). Quinolone Resistance Mutations in Streptococcus pneumoniae GyrA and ParC Proteins: Mechanistic Insights into Quinolone Action from Enzymatic Analysis, Intracellular Levels, and Phenotypes of Wild-Type and Mutant Proteins. Antimicrob. Agents Chemother.
45: 3140-3147
[Abstract]
[Full Text]
-
Ince, D., Hooper, D. C.
(2001). Mechanisms and Frequency of Resistance to Gatifloxacin in Comparison to AM-1121 and Ciprofloxacin in Staphylococcus aureus. Antimicrob. Agents Chemother.
45: 2755-2764
[Abstract]
[Full Text]
-
Hartman-Neumann, S., DenBleyker, K., Pelosi, L. A., Lawrence, L. E., Barrett, J. F., Dougherty, T. J.
(2001). Selection and Genetic Characterization of Streptococcus pneumoniae Mutants Resistant to the Des-F(6) Quinolone BMS-284756. Antimicrob. Agents Chemother.
45: 2865-2870
[Abstract]
[Full Text]
-
Thorburn, C. E., Edwards, D. I.
(2001). The effect of pharmacokinetics on the bactericidal activity of ciprofloxacin and sparfloxacin against Streptococcus pneumoniae and the emergence of resistance. J Antimicrob Chemother
48: 15-22
[Abstract]
[Full Text]
-
Fukuda, H., Kishii, R., Takei, M., Hosaka, M.
(2001). Contributions of the 8-Methoxy Group of Gatifloxacin to Resistance Selectivity, Target Preference, and Antibacterial Activity against Streptococcus pneumoniae. Antimicrob. Agents Chemother.
45: 1649-1653
[Abstract]
[Full Text]
-
Boos, M., Mayer, S., Fischer, A., Köhrer, K., Scheuring, S., Heisig, P., Verhoef, J., Fluit, A. C., Schmitz, F.-J.
(2001). In Vitro Development of Resistance to Six Quinolones in Streptococcus pneumoniae, Streptococcus pyogenes, and Staphylococcus aureus. Antimicrob. Agents Chemother.
45: 938-942
[Abstract]
[Full Text]
-
Heaton, V. J., Ambler, J. E., Fisher, L. M.
(2000). Potent Antipneumococcal Activity of Gemifloxacin Is Associated with Dual Targeting of Gyrase and Topoisomerase IV, an In Vivo Target Preference for Gyrase, and Enhanced Stabilization of Cleavable Complexes In Vitro. Antimicrob. Agents Chemother.
44: 3112-3117
[Abstract]
[Full Text]
-
Bébéar, C. M., Grau, O., Charron, A., Renaudin, H., Gruson, D., Bébéar, C.
(2000). Cloning and Nucleotide Sequence of the DNA Gyrase (gyrA) Gene from Mycoplasma hominis and Characterization of Quinolone-Resistant Mutants Selected In Vitro with Trovafloxacin. Antimicrob. Agents Chemother.
44: 2719-2727
[Abstract]
[Full Text]
-
Marchese, A., Debbia, E. A., Schito, G. C.
(2000). Comparative in vitro potency of gemifloxacin against European respiratory tract pathogens isolated in the Alexander Project. J Antimicrob Chemother
46: 11-15
[Abstract]
[Full Text]
-
Alovero, F. L., Pan, X.-S., Morris, J. E., Manzo, R. H., Fisher, L. M.
(2000). Engineering the Specificity of Antibacterial Fluoroquinolones: Benzenesulfonamide Modifications at C-7 of Ciprofloxacin Change Its Primary Target in Streptococcus pneumoniae from Topoisomerase IV to Gyrase. Antimicrob. Agents Chemother.
44: 320-325
[Abstract]
[Full Text]
-
Heaton, V. J., Goldsmith, C. E., Ambler, J. E., Fisher, L. M.
(1999). Activity of Gemifloxacin against Penicillin- and Ciprofloxacin-Resistant Streptococcus pneumoniae Displaying Topoisomerase- and Efflux-Mediated Resistance Mechanisms. Antimicrob. Agents Chemother.
43: 2998-3000
[Abstract]
[Full Text]