INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The recent development of new fluoroquinolones effective against Streptococcus pneumoniae is a potentially important advance in the management of pneumococcal disease (3, 20, 34). Several of these agents are more active than ciprofloxacin and have either been approved or are in the late stages of clinical trials, including levofloxacin, sparfloxacin, trovafloxacin, grepafloxacin, and clinafloxacin. Given that fluoroquinolones act by blocking DNA synthesis, they should be effective against both penicillin-sensitive and -resistant S. pneumoniae (13, 28, 40). Progress in this area has focused attention on the nature and cellular consequences of quinolone interactions with their pneumococcal targets, the essential type II topoisomerases, DNA gyrase and DNA topoisomerase IV (41).

Previous work in Escherichia coli has established that both gyrase and topoisomerase IV act by a double-strand DNA break and play important roles in facilitating DNA transactions, especially DNA replication (1, 6, 10, 17, 21, 44). Gyrase, a complex of two GyrA and two GyrB subunits encoded by the gyrA and gyrB genes, introduces negative supercoils into DNA in a reaction driven by ATP hydrolysis. The enzyme is essential for initiation of DNA replication and plays a key role in elongation, presumably by removing positive supercoils arising from DNA unwinding at the replication fork. Though gyrase was formerly implicated in the unlinking of daughter chromosomes, it now appears that this function is largely performed by the ATP-requiring enzyme topoisomerase IV, a C₂E₂ tetramer encoded by the parC and parE genes (1, 44). Quinolones inhibit both enzymes by forming a ternary complex of drug, enzyme, and DNA"the cleavable complex" that, on treatment with detergent and proteinase K, generates double-strand DNA breaks (6, 9). Similarly, it is thought that cellular processes acting on the ternary complex in vivo result in the formation of an irreparable double-stranded DNA break, thereby triggering bacterial cell death (18, 19).

Resistance to quinolones in E. coli usually involves point mutations in defined regions of the GyrA or GyrB proteins, termed the quinolone resistance-determining regions, or QRDRs (5, 26, 42, 43). Mutations in the equivalent regions of the ParC or ParE proteins occur subsequent to those in gyrase and are associated with very high level resistance to the drugs (12). These findings originally led to the conclusion that gyrase is invariably the primary target of the quinolones. However, studies with Staphylococcus aureus and S. pneumoniae have discounted this idea (7, 8, 27, 29-32). Unlike E. coli, in which all quinolones tested thus far target DNA gyrase, it appears that, in S. pneumoniae, bacterial killing can proceed through either gyrase, topoisomerase IV, or both, depending on the structure of the quinolone (31, 32). This important conclusion has come primarily from the characterization of stepwise-selected quinolone-resistant S. pneumoniae mutants. Thus, on challenge of S. pneumoniae with ciprofloxacin, parC or parE mutations appear before those in gyrA, suggesting the drug acts preferentially through topoisomerase IV (11, 16, 25, 29, 30, 33, 39). In contrast, challenge with sparfloxacin selects for gyrA mutations before those in parC, indicating a primary role of drug interactions with gyrase (31). For clinafloxacin, killing proceeds through gyrase and topoisomerase IV, with a modest preference for gyrase (32). The molecular basis underlying these different drug specificities is currently unknown, but it presumably reflects differential enzyme-drug interactions and/or more complex factors, such as differential lethalities of enzyme inhibition.

In an effort to understand the different in vivo mechanisms of ciprofloxacin, sparfloxacin, and clinafloxacin, we have examined the contribution of enzyme inhibition to drug action. Here, we report the overexpression and purification of S. pneumoniae GyrA, GyrB, ParC, and ParE subunits; reconstitution of highly active gyrase and topoisomerase IV proteins; and their differential responses to quinolones.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, plasmids, and DNA substrates. S. pneumoniae 7785 and the conditions for its growth have been described previously (30). E. coli XL-Blue and plasmid pBluescript were used to construct libraries and to subclone DNA inserts. Plasmid pCRII (Invitrogen) was used to clone inverse PCR (IPCR) products in E. coli XL-Blue. Vectors pET-19b and pET-29a (Novagen) were used to construct plasmids for overexpression of S. pneumoniae GyrB and GyrA and ParC and ParE proteins in E. coli host BL21(DE3)pLysS. Some intermediate plasmid constructs were propagated in E. coli DH5. Supercoiled pBR322 was prepared as described previously (30), and relaxed-DNA pBR322 was obtained by incubation with calf thymus topoisomerase I (Life Technologies). Kinetoplast DNA (kDNA) from Crithidia fasciculata was purchased from TOPOGEN, Inc., Columbus, Ohio.

Chemicals and reagents. Ciprofloxacin-HCl and clinafloxacin-HCl were kindly provided by Bayer UK, Newbury, United Kingdom, and by Parke-Davis Co., Ann Arbor, Mich. Sparfloxacin was a kind gift from Dainippon Pharmaceutical Co., Suita, Japan. Oligonucleotide primers were synthesized by Oswel, Ltd., University of Southampton, Southampton, United Kingdom.

Molecular cloning of the S. pneumoniae 7785 gyrA gene. In previous work, we have described the isolation and characterization of the parE, parC, and gyrB genes from S. pneumoniae 7785 (30). To obtain the gyrA gene from this strain, a radiolabeled 382-bp gyrA PCR product amplified from S. pneumoniae 7785 (29) was used to probe a Southern blot of 7785 genomic DNA and was found to hybridize to 4.0-kb PstI and 2.5-kb HindIII fragments (not shown). Size-selected S. pneumoniae 7785 HindIII and PstI libraries in pBluescript SK were constructed in E. coli XL1-Blue and screened with the gyrA PCR product. Due to plasmid instability, only the 2.5-kb HindIII fragment could be isolated intact in plasmid pXP11. DNA sequence analysis of the pXP11 insert showed it contained two incomplete open reading frames (ORFs), one of which encoded the N-terminal 411 residues of GyrA protein. To obtain the 3' end of the gyrA gene, IPCR was used, employing forward primer VGA14 (5' TGAAACGGATGCGGAAGCTCAAGC [gyrA nucleotide positions 1190 to 1213]) and reverse primer VGA13 (5'-ACTCTGACTGTGCAGACGCTGACC [406 to 429 adjacent to a PstI site]). S. pneumoniae 7785 genomic DNA was digested to completion with PstI, and the restriction fragments were circularized by ligation (30). The fragments were then used as a template in IPCR with primers, Taq DNA polymerase, and 1.5 mM MgCl₂ (30). The conditions were 94°C for 1 min, 45°C for 1 min, and 74°C for 2 min (30 cycles). A 2.4-kb IPCR product was obtained, cloned directly into plasmid pCRII, and transformed into E. coli XL-Blue. Plasmid pXP12 was recovered from one of the ampicillin-resistant colonies.

DNA sequence analysis. Cloned S. pneumoniae DNA fragments were sequenced on both strands by the chain termination method (36). The plasmid pXP11 insert was sequenced by using T7 and internal primers. Sequence at the extreme 3' end of the pXP12 insert was obtained by using T7 and SP6 primers. This information was then used to design primers for asymmetric PCR (AsPCR) by using the proofreading Vent DNA polymerase and strain 7785 genomic DNA as a template. AsPCR products were then sequenced directly (31).

Construction of GyrA- and GyrB-expressing plasmids. PCR was used to amplify the S. pneumoniae gyrA and gyrB genes for insertion into expression vectors pET-29a and pET-19b. NdeI sites (CA'TATG) were engineered into each of the forward primers overlapping the ATG initiation codon of gyrA and gyrB. The gyrB gene was amplified by using forward primer (P7164) 5'-AGAAAAAGGAATCATATGACAGA AG (NdeI site underlined) and reverse primer (P7165) 5'-AGGGAACTACTTCTCGAGATTTTTTA (XhoI site underlined). The gyrA gene was assembled from two PCR products obtained as follows. The 5' end of gyrA was amplified with forward primer VGA35 (5'-ATGAGGCATTTACATATGCAGGATAAAAATTTAGTG) and reverse primer VGA22 (5'-AGCCCTTTGGCAGTCCGACC [nucleotide positions 1722 to 1741; i.e., 3' to an XhoI site in gyrA at nucleotide 1473]). The 3' end of gyrA was obtained by using forward primer VGA17 (5'-ACAGAGTTGATGGTTGGAC [nucleotide positions 1442 to 1460]) and reverse primer VGA36 (5'-GAGACACTCGAGTTCACCTTCTGTTTCGTTTTC [XhoI site underlined]). PCR was carried out with genomic DNA from strain 7785 by using Vent DNA polymerase in the presence of primers and 1.5 mM MgCl₂. The PCR conditions were denaturation at 94°C for 1 min, annealing for 1 min at 45°C (for gyrA primers) or 52°C (for gyrB primers), and polymerization at 72°C for 3 min. Reactions were performed over 30 cycles. The gyrB and 5' gyrA PCR products were digested with NdeI and XhoI, purified by electrophoresis in low-gelling temperature agarose, and recovered. The resulting gyrB and 1,473-bp gyrA products were ligated into NdeI-XhoI-cut pET-19b and pET-29a and transformed into E. coli DH5, and resistant colonies were selected on plates containing ampicillin or kanamycin, respectively. This procedure allowed recovery of gyrB expression plasmid pXP9 and pXP55 bearing a partial gyrA gene. The 3' gyrA PCR product was digested with XhoI, and the resulting 990-bp fragment was ligated into XhoI-linearized pXP55, whose 5' ends had been dephosphorylated by using calf intestinal alkaline phosphatase. After transformation of E. coli DH5, recovery of plasmids from kanamycin-resistant colonies followed by restriction analysis identified expression plasmid pXP10, in which the gyrA gene had been correctly assembled. The translation initiation and termination regions of the recombinant plasmids pXP9 and pXP10 were sequenced to confirm that fragments had been inserted in frame.

Plasmids expressing ParC and ParE. Vent DNA polymerase was used to amplify the parC and parE genes from 7785 DNA in the presence of 1.5 mM MgCl₂. For amplification of parC, the forward primer (N6894) was 5'-TGGGCTTTGTATCATATGTCTAAC (artificial NdeI site underlined) and the reverse primer (VPC3) was 5'-CATTTCTCGAGTTTATCTTCAGTAACTAC [XhoI site underlined; converts TAA termination codon to CTC(Leu)]. For parE, the forward primer (N7043) was 5'-AGGAGGTTCCATATGTCAAAAAAGG (artificial NdeI site converts GTG initiation codon to ATG), and the reverse primer (N7044) was 5'-TATTTGGATCCATTAAACACTGTC (BamHI site underlined), which corresponds to sequence downstream of the natural stop codon. The PCR conditions were denaturation at 94°C for 1 min, annealing at 45°C (for parC) or 50°C (parE) for 1 min, and polymerization at 72°C for 3 min. Reactions were performed over 30 cycles. The resulting 2.5-kb parC and 1.9-kb parE products were digested with NdeI and XhoI and NdeI and BamHI, respectively. DNA fragments were purified from low-gelling temperature agarose, recovered, and ligated into appropriately cut kanamycin-resistance plasmid pET-29a (for parC) and ampicillin-resistance plasmid pET-19b (for parE), yielding pXP13 and pXP14, respectively.

Protein overexpression and purification. Plasmids pXP9, pXP10, pXP13, and pXP14 were transformed separately into E. coli BL21(DE3)pLysS. GyrA and GyrB proteins were purified by the same procedure. Single colonies of BL21 containing pXP9 or pXP10 were picked from plates and grown overnight at 37°C in 50 ml of Luria-Bertani (LB) medium containing the selective antibiotic. A culture (15 ml) of the overnight growth was used to inoculate 750 ml of LB medium containing ampicillin (100 µg/ml) or kanamycin (50 µg/ml). Cells were grown at 37°C for about 3 h, until the optical density at 600 nm reached 0.4 to 0.6. IPTG was added to a final concentration of 1 mM, and growth was continued for a further 3 h. Bacteria were harvested by centrifugation at 5,000 × g for 12 min at 4°C. The supernatant was discarded, and the bacterial pellet was resuspended in 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 5 mM imidazole prior to flash freezing in liquid nitrogen and storage at 70°C overnight. The suspension was thawed on ice, and lysozyme and Brij were added to final concentrations of 0.02 and 0.12%, respectively. Incubation was continued on ice for another 30 min, and then the mixture was centrifuged at 35,000 × g for 60 min. The supernatant was carefully removed to a sterile precooled 50-ml tube (Falcon) and mixed with 3 ml of 50% Ni-nitrilotriacetic acid (NTA) resin slurry (Qiagen). The tube was gently agitated at 4°C overnight. The mixture was poured into a column and washed initially with 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 5 mM imidazole, followed by 10 ml of a solution containing 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 60 mM imidazole. The column was then washed with 10 ml of a mixture of 20 mM Tris-HCl (pH 7.9), 1.5 M NaCl, and 60 mM imidazole. The histidine-tagged GyrA and GyrB proteins were eluted with 10 ml of 20 mM Tris-HCl (pH 7.9), 500 mM NaCl, and 250 mM imidazole. The protein fractions were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and those containing GyrA or GyrB proteins were pooled (total volume of 2 to 3 ml) and dialyzed overnight at 4°C against 2 liters of 50 mM Tris-HCl (pH 7.9), 200 mM NaCl, and 30% glycerol. The protein solution was spun at 35,000 × g for 30 min at 4°C to remove precipitate. The supernatant was transferred to a fresh precooled tube, and dithiothreitol (DTT) and EDTA were added to final concentrations of 5 and 1 mM, respectively. The GyrA and GyrB proteins were then flash frozen in aliquots in liquid nitrogen and stored at 70°C. Approximately 2 mg of highly purified GyrA or 8 mg of purified GyrB was obtained from 5-liter cultures of induced cells.

Topoisomerase catalytic and DNA cleavage assays. DNA supercoiling activity, reconstituted with purified S. pneumoniae GyrA and GyrB proteins, was assayed as previously described (22, 23) with relaxed pBR322 DNA (0.4 µg) as a substrate (total volume, 35 µl). For decatenation assays, the standard reaction mixture (20 µl) contained 40 mM Tris-HCl (pH 7.5), 6 mM MgCl₂, 10 mM NaCl, 10 mM DTT, 200 mM potassium glutamate, 1 mM ATP, 50 µg of bovine serum albumin per ml, 450 ng of kDNA, and various amounts of ParC and ParE proteins. Reaction mixtures were incubated at 37°C for 1 h, the reactions were terminated by addition of dye mix, and then the products were analyzed by electrophoresis in 1% agarose.

Nucleotide sequence accession number. The S. pneumoniae 7785 genomic DNA sequence contained in plasmids pXP11 and pXP12 has been submitted to the EMBL Data Library under accession no. AJ005815.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Overexpression of S. pneumoniae GyrA and GyrB proteins and reconstitution of gyrase activity. Our initial attempts to purify the native S. pneumoniae GyrA and GyrB proteins by using inducible plasmid constructs in E. coli were frustrated by the low levels of expression, particularly for GyrA (32a). To circumvent this difficulty and to facilitate purification, we engineered recombinant genes that express GyrA and GyrB proteins carrying histidine tags at their C-terminal and N-terminal ends, respectively. The S. pneumoniae gyrA and gyrB genes were each amplified by PCR with S. pneumoniae 7785 genomic DNA as a template and Vent DNA polymerase, which has proofreading activity, thereby minimizing the introduction of PCR errors. The full-length gyrB gene contained between NdeI and XhoI sites was inserted in frame into expression vector pET-19b downstream of a T7 promoter, resulting in plasmid pXP9, which was transformed into E. coli BL21(DE3)pLysS. Induction by IPTG of the T7 polymerase gene on the DE3 prophage was expected to produce a recombinant 72-kDa GyrB protein carrying a decahistidine tag at its N-terminal end. The gyrA expression construct pXP10 was obtained by inserting the gyrA gene as two PCR fragments into plasmid pET-29a by creating an XhoI site 3' of the gene that altered the Ala-Stop gyrA codons to Leu-Glu. Expression of the gene was expected to produce the full-length 97-kDa GyrA protein carrying a hexahistidine tag at its C-terminal end. Milligram amounts of soluble His-tagged GyrA and GyrB proteins that were each >90% homogeneous were isolated from cleared lysates of induced BL21 transformants by one-step nickel chelate chromatography (Fig. 1A).

View larger version (29K): [in this window] [in a new window]   FIG. 1.   SDS-PAGE analysis of purified S. pneumoniae gyrase (A) and topoisomerase IV (B) subunits. Lanes: A and B, GyrA and GyrB proteins, respectively; C and E, ParC and ParE proteins, respectively. Approximately 2 µg of each protein sample was loaded on an SDS-7.5% polyacrylamide gel, and, following electrophoresis, proteins were revealed by staining with Coomassie blue. Sizes of protein markers (M) are indicated to the left.

View larger version (38K): [in this window] [in a new window]   FIG. 2.   Enzymatic activities of S. pneumoniae gyrase and topoisomerase IV subunits. (A) S. pneumoniae GyrA and GyrB proteins reconstitute an ATP-dependent DNA supercoiling activity. Relaxed plasmid pBR322 substrate (0.4 µg) was incubated with gyrase proteins in the absence or presence of 1.4 mM ATP. Reactions were stopped, and the DNA was examined by electrophoresis in 1% agarose. Lanes: a, supercoiled pBR322 control; b, relaxed DNA control; A, relaxed DNA and GyrA protein (20 ng); B, relaxed DNA and GyrB (20 ng); AB, relaxed DNA and both GyrA (20 ng) and GyrB (20 ng). N, R, and S denote nicked, relaxed, and supercoiled DNA, respectively. (B) Decatenation of kDNA by S. pneumoniae topoisomerase IV. kDNA (0.4 µg) was incubated with purified ParC (2 ng) and/or ParE (20 ng) in the presence or absence of 1 mM ATP prior to agarose gel electrophoresis. Lanes a, kinetoplast DNA control; C, kDNA and ParC; E, kDNA and ParE; CE, kDNA with ParC and ParE. kDNA remains in the wells of the agarose gel; the position of monomer circles is indicated.

Expression, purification, and characterization of S. pneumoniae topoisomerase IV. Full-length parC and parE genes were amplified by PCR with Vent DNA polymerase and the S. pneumoniae 7785 DNA template and inserted into pET vectors in a similar manner to that described for the gyrase genes, yielding expression constructs pXP13 and pXP14, respectively. Induction of exponentially growing cultures of BL21(DE3) transformants resulted in low-level expression of ParC and ParE, both predominantly in an insoluble form (not shown). However, solubilization in 6 M urea and on-column renaturation yielded milligram amounts of soluble 93-kDa ParC and 72-kDa ParE proteins that were both >95% homogeneous by SDS-PAGE (Fig. 1B).

Inhibition of gyrase and topoisomerase IV enzyme activities by antipneumococcal fluoroquinolones. Access to S. pneumoniae topoisomerases allowed us to examine and compare the effects of various fluoroquinolones on their principal enzymatic activities: DNA supercoiling for gyrase and decatenation by topoisomerase IV (Fig. 3 and 4). For gyrase assays, 1 U of enzyme was employed, which in the absence of drug is sufficient to convert 50% of 0.4 µg of relaxed plasmid pBR322 DNA to the supercoiled form under standard conditions (Fig. 3, lane 3). DNA supercoiling was inhibited in a dose-dependent manner by ciprofloxacin, sparfloxacin, and clinafloxacin, with IC₅₀s (the concentration of drug required to inhibit DNA supercoiling by 50%) of 40, 40, and 2.5 µM, respectively. Thus, ciprofloxacin and sparfloxacin were equally good inhibitors, but were 16-fold less potent than clinafloxacin.

View larger version (39K): [in this window] [in a new window]   FIG. 3.   Fluoroquinolone inhibition of DNA supercoiling by S. pneumoniae gyrase. Relaxed pBR322 DNA (0.4 µg) was incubated with GyrA (1 U) and GyrB (1 U) proteins plus 1.4 mM ATP in the absence or presence of drugs. DNA was analyzed as described in the legend to Fig. 2. The concentration of ciprofloxacin (CIP), sparfloxacin (SPAR), or clinafloxacin (CLN) included in each reaction is shown on the figure. Lanes a and b, supercoiled- and relaxed-DNA controls, respectively.

View larger version (36K): [in this window] [in a new window]   FIG. 4.   Inhibition of DNA decatenation by S. pneumoniae topoisomerase IV. kDNA (0.4 µg) was incubated with ParC (1 U), ParE (1 U), and 1.4 mM ATP in the presence or absence of quinolones (ciprofloxacin [CIP], sparfloxacin [SPAR], or clinafloxacin [CLN]) at the indicated concentrations. DNA was analyzed by agarose gel electrophoresis.

Fluoroquinolone stabilization of cleavable complexes: preferential DNA breakage by S. pneumoniae topoisomerase IV. Figure 5 compares the abilities of different fluoroquinolones to induce DNA linearization of supercoiled pBR322 DNA by S. pneumoniae gyrase and topoisomerase IV. Supercoiled pBR322 DNA was incubated with enzyme in the absence or presence of quinolone. DNA breakage was induced by addition of SDS, and following proteinase K digestion, the DNA was examined by agarose gel electrophoresis. Ciprofloxacin and sparfloxacin were comparably efficient at promoting gyrase-mediated DNA breakage, with the proportion of linear DNA increasing in a dose-dependent fashion (Fig. 5A). For these quinolones, the (CC₂₅) concentration of drug necessary to promote 25% linearization of the DNA by gyrase was 80 µM. However, clinafloxacin was much more effective in promoting DNA breakage, with a CC₂₅ of 2.5 µM (Fig. 5A). At >5 µM, linear DNA was the predominant DNA species (Fig. 5A). Thus, clinafloxacin was some 20- to 40-fold more effective than either ciprofloxacin or sparfloxacin in mediating cleavable complex formation with gyrase.

View larger version (63K): [in this window] [in a new window]   FIG. 5.   Fluoroquinolone-mediated DNA cleavage is more efficient for S. pneumoniae topoisomerase IV than gyrase. (A) Drug-dependent DNA breakage by gyrase. Supercoiled pBR322 (0.4 µg) was incubated with pneumococcal GyrA (25 U) and GyrB (100 U) proteins at the concentrations of ciprofloxacin, (CIP), sparfloxacin (SPAR), and clinafloxacin (CLN) indicated on the figure. After treatment with SDS and proteinase K, DNA samples were examined by electrophoresis in 1% agarose. Lanes a and b, supercoiled and linear pBR322 DNA, respectively. (B) DNA cleavage by topoisomerase IV. Amounts of ParC and ParE equivalent to those of the gyrase subunits in panel A were incubated with various quinolones and pBR322 DNA. After induction of DNA breakage, DNA samples were processed for agarose gel electrophoresis as described for gyrase.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We have expressed S. pneumoniae gyrase and topoisomerase IV in E. coli, purified the enzymes to homogeneity, and compared their interactions with new antipneumococcal quinolones. The key to expressing the S. pneumoniae gyrase and topoisomerase IV proteins was the use of His-tagged vectors. Previously, we had not been successful in purifying either enzyme in native form from S. pneumoniae or in isolating native recombinant S. pneumoniae proteins expressed in E. coli, due to their low level of expression, particularly for GyrA (32a). The use of His-tagged subunits facilitated rapid protein purification by metal affinity chromatography, yielding products free of host gyrase and topoisomerase IV proteins. Purification of native type II topoisomerases from S. pneumoniae has not been reported. However, the pneumococcal gyrase and topoisomerase IV subunits described here were comparably active to their counterparts from other sources. Thus, the S. pneumoniae GyrA and GyrB proteins had specific activities in the DNA supercoiling assay of ~2 × 10⁵ U/mg, which compare favorably with specific activities of 10⁶ and 10⁵ U/mg observed for native E. coli GyrA and GyrB (22) and 10² to 10³ U/mg measured for the native and recombinant S. aureus gyrase proteins, respectively (4, 38). The activity of S. aureus gyrase could be increased 500-fold by the inclusion of 700 mM potassium glutamate, perhaps mimicking the high intracellular aspartate and glutamate levels found in S. aureus (4). (We found that addition of 700 mM potassium glutamate increased the activity of S. pneumoniae gyrase approximately 15-fold [32a]). Although we do not have wild-type S. pneumoniae proteins for analysis, from these results, it appears that the histidine-tagged S. pneumoniae gyrase proteins display comparable activity to the native E. coli and S. aureus counterparts. Moreover, it has been reported recently that S. aureus gyrase and topoisomerase IV holoenzymes reconstituted from His-tagged subunits have specific activities identical to published values, and these proteins behaved similarly to the native enzymes in their responses to quinolones (35).

For S. pneumoniae, there are a number of interesting features of the in vitro and in vivo responses to quinolones that deserve comment (Table 1). First, sparfloxacin and ciprofloxacin had very similar inhibitory activities in vitro, whether measured in the DNA supercoiling, DNA decatenation, or DNA breakage assays. Despite these similarities, comparison of MICs shows that sparfloxacin was fourfold more potent than ciprofloxacin against S. pneumoniae 7785 (Table 1). One factor that could plausibly explain the greater in vivo activity of sparfloxacin is less-efficient efflux compared to that of ciprofloxacin. Second, a striking feature of Table 1 is that clinafloxacin, when examined in any of the enzyme assays, was a markedly more potent inhibitor than sparfloxacin or ciprofloxacin. Thus, the IC₅₀s of clinafloxacin for DNA supercoiling by gyrase and for DNA decatenation by topoisomerase IV were some 10- to 20-fold lower. Moreover, the CC₂₅s obtained in the DNA cleavage experiments were 32-fold lower for gyrase and 10-fold lower for topoisomerase IV. The CC₂₅s are useful, because trapping of type II topoisomerases by quinolones as cleavable complexes on DNA is thought to be the cytotoxic lesion initiating the antibacterial action of these drugs (18, 19). The much lower values for clinafloxacin support our recent suggestion that the greater antibacterial activity of the drug is due to intrinsic tight binding to its enzyme targets in vivo (32). However, the 10- to 32-fold differences in CC₂₅s over those of sparfloxacin and ciprofloxacin are not reflected proportionally in the MICs (Table 1), suggesting that other factors contribute to drug action in vivo. Third, it is interesting that all three quinolones showed an in vitro preference for topoisomerase IV, with CC₂₅s that were 25- to 80-fold lower than those against gyrase (Table 1), the inverse of that seen with E. coli gyrase and topoisomerase IV. This was particularly surprising, because genetic experiments have shown that the three quinolones have different targets in S. pneumoniae: ciprofloxacin and sparfloxacin act preferentially through topoisomerase IV and gyrase, respectively, whereas clinafloxacin acts through both, with a weak preference for gyrase (32). (A recent abstract has also reported the preferential targeting of topoisomerase IV by sparfloxacin in vitro and the equipotency of sitafloxacin [24].) Overall, there was no rigid correlation between enzyme inhibition, MICs, and target preferences in vivo.

Recently, the preference of quinolones for topoisomerase IV has also been observed in comparisons of S. aureus topoisomerase IV and gyrase in vitro, using either native or His-tagged holoenzymes (4, 35). Thus, ciprofloxacin, sparfloxacin, and norfloxacin were some 10- to 250-fold more effective in stabilizing covalent complexes with native S. aureus topoisomerase IV than with DNA gyrase (4). Similarly clinafloxacin, trovafloxacin, ciprofloxacin, norfloxacin, and oxolinic acid showed a 2- to 50-fold preference for His-tagged topoisomerase IV (35). Although for a number of quinolones, these results concur with the known in vivo target preference for topoisomerase IV, in the case of sparfloxacin, there are differences between the in vivo and in vitro data. Sparfloxacin is >50-fold more effective in stimulating DNA cleavage by topoisomerase IV over gyrase in vitro (4), and yet it appears to kill S. aureus cells by acting through both gyrase and topoisomerase IV (8). Clearly, for both S. aureus and S. pneumoniae, there are differences between targeting preferences seen in vitro with purified proteins and those suggested by genetic approaches.

How can these differences be reconciled? One hypothesis would be to assume that all quinolones preferentially target DNA topoisomerase IV in S. pneumoniae. For those quinolones such as sparfloxacin and clinafloxacin that select gyrA (but not parC or parE) QRDR mutants in the first step, it would then have to be assumed that these are not genuine single-step mutants, but carry a second mutation (thus far undetected) in topoisomerase IV lying outside of the QRDRs. However, to explain the lack of cross-resistance with other quinolones, this putative second mutation would have to affect specifically sparfloxacin and clinafloxacin and not, e.g., ciprofloxacin. Second, the observed frequencies of first-step gyrA mutants obtained by challenge with sparfloxacin (at 4 × MIC) and clinafloxacin (at the MIC) are each in the range 5 × 10¹⁰ to 8 × 10¹⁰, values that appear very high for single-step selection of putative double mutants (31, 32). Third, from studies with E. coli and other gram-negative bacteria, it is known that gyrase is the in vivo and in vitro target of a variety of quinolones, including ciprofloxacin. Thus, either gyrase or topoisomerase IV can be a primary quinolone target. Although full sequence analysis of topoisomerase IV genes in quinolone-resistant mutants would be desirable, these constraints would seem to argue against the hypothesis favoring topoisomerase IV as the invariant quinolone target in S. pneumoniae.

The converse explanation is that measurements of cleavable complex formation using purified enzymes in vitro may not faithfully reflect the situation inside bacteria. First, it is possible that recombinant enzymes prepared by expression in E. coli may not reproduce the characteristics of the native proteins. For example, in our case, the renaturation of topoisomerase IV subunits from inclusion bodies, which was not required for gyrase subunits, may have affected the sensitivity of the reconstituted topoisomerase IV to quinolones. Although unlikely, such explanations remain to be formally excluded. Second, the in vivo targeting of gyrase by clinafloxacin and sparfloxacin in S. pneumoniae could result from preferential cleavable complex formation with gyrase (instead of topoisomerase IV) under intracellular conditions. Obviously, the particular DNA template, salt, Mg²⁺, polyamine, ATP, DNA supercoiling, enzyme, and other conditions that prevail in the bacterium may be difficult to reproduce in vitro. It is also conceivable that individual quinolones are uniquely and unevenly distributed in the bacterial cell in a way that could affect complex formation with the two enzymes. This could be important if the target enzymes are themselves distributed in a nonuniform fashion. In fact, it is already known from studies with Bacillus subtilis that topoisomerase IV has a bipolar localization, whereas gyrase is associated with the nucleoid (14). More data will be needed about cleavable complex formation in S. pneumoniae.

Finally, and our preferred model, the discrepancy between in vitro and in vivo results could arise through differential lethality of cleavable complexes in vivo. Obviously, unlike the assay of DNA breakage in vitro, which largely reflects drug-target affinity, in vivo targeting revealed through genetic experiments identifies the most important killing pathway, in which killing is a complex process involving drug-enzyme binding and formation of a cleavable complex, followed by downstream events, such as collisions with replication forks that convert the cleavable complex into a lethal lesion thought to be a chromosomal double-stranded DNA break. It has been suggested from studies of E. coli that gyrase acts ahead of the replication fork, whereas topoisomerase IV acts predominantly behind the fork, allowing time for repair of quinolone-induced DNA damage (44). This scenario predicts that cleavable complex formation through gyrase would give rapid killing, whereas that involving topoisomerase IV would be a slow process, a pattern of behavior that has recently been observed in comparisons of norfloxacin's actions against E. coli and its gyrA mutants (18). However, unlike E. coli, in which gyrase is usually the primary quinolone target, the situation in S. pneumoniae is more complex, in that different quinolones appear to have different targets in vivo. Conceivably, cleavable complex formation through topoisomerase IV or gyrase may be more or less lethal for some quinolones than for others. Resolution of these questions must await the development of an in vitro S. pneumoniae replication model in which quinolone effects can be examined in detail. However, the efficient expression system for S. pneumoniae type II topoisomerases described in this paper should facilitate further studies of the selectivity of antipneumococcal fluoroquinolones and open the way to crystallographic approaches aimed at elucidating the molecular basis of quinolone-topoisomerase interactions.