![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, May 1999, p. 1252-1255, Vol. 43, No. 5
Pharmaceutical Research Center,
Received 8 September 1998/Returned for modification 16 December
1998/Accepted 27 February 1999
The sequence of an approximately 1.1-kb DNA fragment of the
pbp2x gene, which encodes the transpeptidase domain, was
determined for 35 clinical isolates of Streptococcus
pneumoniae for which the cefotaxime (CTX) MICs varied. Strains
with substitutions within a conserved amino acid motif changing STMK to
SAFK and a Leu-to-Val change just before the KSG motif were highly
resistant to CTX (MIC, Clinical isolates of penicillin
(PC)-resistant Streptococcus pneumoniae (PRSP) for which
cefotaxime (CTX) MICs are The high-molecular-weight PC-binding proteins (PBPs) 1A, 2X, and 2B,
usually detected in S. pneumoniae, are involved in
transpeptidase activity and contain conserved amino acid motifs of
SXXK, including the active-site serine residue as a target of
Genetic analyses of pbp1a (1, 18),
pbp2x (15, 16), and pbp2b
(6) in PC-susceptible S. pneumoniae (PSSP) and
PRSP have already been conducted. As for PBP 1A, of the many amino acid
substitutions in the transpeptidase domain, substitution of Ala or Ser
for Thr-371 in the conserved STMK motif has been most important for the
development of PC resistance (1, 26). As for PBP 2B,
substitutions of Ala or Ser for Thr just after the SSN motif, and of
Gly for conserved Glu, were important in developing PC resistance
(6, 25, 31). On the other hand, substitution of Ala for Thr
just after the KSG motif in PBP 2X involved low-level resistance of
cephalosporins (10, 23). Recently, structural evidence
linking resistance to multiple We determined the nucleotide sequence of a 1.1-kb region encoding
transpeptidase activity, from bp 1018 to 2080, in the
pbp2x gene sequence of S. pneumoniae strains
(n = 35) isolated in Japan between 1993 and 1997. Amplification of DNA fragments and the sequencing reaction were carried
out as described previously (1) with the following PCR
primers: 5'-T958ATGAAAAGGATCGTCTGGG977 and
5'-A2105GAGAGTCTTTCATAGCTGAAGC2083.
The correlation between amino acid substitutions in PBP 2X and
the development of cephalosporin resistance was then examined.
The amino acid sequence of PBP 2X in the strains for which the CTX MICs
were Four strains were classified into group I. In this group, Thr-550 just
after the KSG motif was replaced with Ala. From the X-ray
crystallographic structure of a complex of a homologous DD-peptidase and CTX, Kuzin et al. (14) showed
that the loss of a hydrogen bond between the Thr and CTX by the change
to Ala can account for the higher CTX MICs. Other than this Thr, only one or two amino acid substitutions were confirmed. The CTX MIC for
these strains was 0.125 µg/ml, which was four to eight times higher
than that for PSSP.
Eight strains were classified into group II. Ala-393 and His-394 just
before the SSN motif were replaced with Val and Leu, respectively, or
His-394 and Leu-546 just before the SSN and KSG motifs were replaced
with Leu and Val, respectively. The CTX MICs for these strains were
also about 0.125 µg/ml.
Five strains that were classified into group III showed a substitution
of Ala for Thr-338 in the STMK motif. The CTX MICs for these strains
ranged from 0.125 to 0.25 µg/ml. The homology of amino acid sequences
between these strains and the R6 strain was 90.7%.
PRSP strains classified into group IV were isolated predominantly in
Japan. These strains had altered pbp1a, pbp2x,
and pbp2b genes and two amino acid substitutions, Ala for
Thr-338 in STMK and Val for Leu-546 adjacent to KSG, in the
pbp2x gene product.
CTX MICs for strains that were classified into group V ranged from 2 to
8 µg/ml, which is four to eight times higher than those for group IV.
The general amino acid substitutions in group V strains were virtually
the same as those in the group IV strains, but Thr-Met in STMK was
replaced with Ala-Phe. The amino acid sequence of these strains was
highly homologous to that of the high-level CTX resistant strain CS111
isolated in the United States in 1991 (homology ranging from 99.7 to
100%) (5). The serotypes of the strains with high-level
resistance were 14, 19, and 23.
Many strains in groups IV and V showed simultaneous alterations in PBP
1A, 2X, and 2B, while strains of other groups showed resistance
mediated by an alteration in PBP 2X only. To clarify the effect of
substitutions in the conserved amino acid motifs of PBP 2X on CTX MICs,
the amplified pbp2x genes of strains in groups IV and V were
used to transform a PSSP strain, KK97 (Table 2). Transformation of pbp2x
genes was monitored by procedures previously described (27,
28). Transformants were selected on blood agar containing CTX and
were confirmed by sequencing to contain the pbp2x gene of
donor DNA. CTX MICs for transformants containing pbp2x DNA
of the 34/H31 and 40/H29 strains (group IV) increased from 0.016 to 0.5 µg/ml. In contrast, CTX MICs for transformants from the 29/KK133 and
32/KU81 strains (group V) increased to 1.0 µg/ml. Although the
pbp2x gene from group V strains could not transform a
susceptible recipient strain to donor-level CTX resistance by itself,
it increased the resistance to a slightly higher level than that of the
others.
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Diversity of Substitutions within or Adjacent to
Conserved Amino Acid Motifs of Penicillin-Binding Protein 2X in
Cephalosporin-Resistant Streptococcus pneumoniae
Isolates
ABSTRACT
Top
Abstract
Text
References
2 µg/ml). Strains with substitutions
adjacent to SSN or KSG motifs had low-level resistance. The amino acid
substitutions were plotted on the three-dimensional crystallographic
structure of the transpeptidase domain of PBP2X. Transformants
containing pbp2x from strains with high-level CTX
resistance increased the CTX MIC from 0.016 µg/ml to 0.5 to 1.0 µg/ml.
TEXT
Top
Abstract
Text
References
2 µg/ml have been reported in recent
years (3, 5, 8, 24, 30). In Japan, PRSP isolates for which
CTX MICs ranged from 2 to 8 µg/ml have been recently isolated.
-lactams, SXN, and KT(S)G. The decreased affinity of PBP 1A, 2B, and
2X for -lactams has been shown to play an important role in the
development of their resistance (2, 12, 17, 20, 29). In
particular, alterations in PBP 2B mediate low-level resistance to PCs
(25), while those in PBP 2X mediate low-level resistance to
cephalosporins (7, 10, 13). Additional alterations in PBP 1A
increased PC MICs to 1 µg/ml and CTX MICs to 0.5 µg/ml
(20, 22, 29). The evidence that PBP 2A and PBP 1B with low
affinity also affect -lactam resistance was presented by Hakenbeck
et al. (11).
-lactams to amino acid substitutions
for Thr-338 and/or Ser-571 within a buried cavity near the Ser-337 of a
catalytic site in PBP 2X has been presented by Mouz et al.
(19).
0.125 µg/ml exhibited a variety of amino acid substitutions
different from those of CTX-susceptible strains. On the basis of the
substitution patterns within or adjacent to the three conserved amino
acid motifs of STMK, SSN, and KSG, resistant strains were classified
into five groups (Table 1). Table 1 also
shows (i) the serotypes of the strains, (ii) the susceptibilities of
the strains to PC, CTX, cefpodoxime, cefditoren, cefdinir, and
cefaclor, and (iii) mutations in the pbp1a and
pbp2b genes. Figure 1 shows
the predicted amino acid sequence from residues 271 to 610 of a
representative strain from each group. The nucleotide sequences of five
PSSP strains were determined for comparison. They were identical to
those of the strain R6.
TABLE 1.
Classification based on PBP 2X sequence differences and
properties of S. pneumoniae strains
View larger version (30K):
[in a new window]
FIG. 1.
Deduced amino acid sequences of part of PBP 2X from
representative strains from each group. The sequence of PSSP R6 is
shown on the top line. Numbering is based on published data on the R6
strain (15). Only amino acids differing from the R6 sequence
are shown. Boxes represent conserved amino acid motifs.
TABLE 2.
Susceptibilities to -lactam antibiotics of S. pneumoniae transformants obtained with pbp2x DNA
Charlier et al. (4) crystallized PBP 2X, and Pares et al.
(21) determined its three-dimensional structure by X-ray
crystallography. According to their observations, PBP 2X consisted of
three domains. Its central domain was the transpeptidase domain, with a
long groove surrounded with conserved motifs of STMK, SSN, and KSG. The
active-site serine to which -lactam binds was located in the STMK
motif at the center of this groove. Figure
2 shows a stereoview of the PBP 2X
transpeptidase domain of the PRSP strain 31/KU5, in which amino acids
differing from the R6 sequence are marked with yellow, green, and blue
circles.
|
Distinct amino acid changes, as well as those near the conserved motif, are probably important but are more difficult to understand. An extended structural analysis, while far beyond the scope of this paper, would be worthwhile.
Zhao et al. (32) reported that the kinetics of the transpeptidase activity of PBP 2X differed significantly between penicillin-resistant and -susceptible strains of S. pneumoniae. The resistant strain used in their study was classified into group IV in the present study. Furthermore, Garcia-Bustos and Tomasz (9) used whole cells and documented that the products of pentaglycine bridge reactions differed between susceptible and resistant strains. It was speculated that these changes were attributable to modification of the three-dimensional structure of the active domain of high-molecular-mass PBPs in the resistant strains.
We have not yet isolated S. pneumoniae with high-level CTX resistance with substitutions such as Pro for Ser-571 in PBP 2X. Nevertheless, since many oral cephalosporins are currently in use in Japan, we fear that the strains with high-level cephalosporin resistance with the PBP 2X alterations so far described will predominate among strains isolated in the future.
Nucleotide sequence accession numbers. The nucleotide sequences determined in this study will appear in the DDBJ/EMBL/Gen Bank nucleotide sequence databases under the following accession numbers: AB011198 to AB011210 and AB015846 to AB015852.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Pharmaceutical Research Center, Meiji Seika Kaisha, Ltd., 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567, Japan. Phone: 81-45-545-3106. Fax: 81-45-545-3152. E-mail: kimiko_ubukata{at}meiji.co.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Asahi, Y., and K. Ubukata.
1998.
Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:2267-2273 |
| 2. | Barcus, V. A., K. Ghanekar, M. Yeo, T. J. Coffey, and C. G. Dowson. 1995. Genetics of high level penicillin resistance in clinical isolates of Streptococcus pneumoniae. FEMS Microbiol. Lett. 126:299-303[Medline]. |
| 3. | Bradley, J. S., and J. D. Connor. 1991. Ceftriaxone failure in meningitis caused by Streptococcus pneumoniae with reduced susceptibility to beta-lactam antibiotics. Pediatr. Infect. Dis. J. 10:871-873[Medline]. |
| 4. | Charlier, P., G. Buisson, O. Dideberg, J. Wierenga, W. Keck, G. Laible, and R. Hakenbeck. 1993. Crystallization of a genetically engineered water-soluble primary penicillin target enzyme. The high molecular mass PBP2x of Streptococcus pneumoniae. J. Mol. Biol. 232:1007-1009[Medline]. |
| 5. | Coffey, T. J., M. Daniels, L. K. McDougal, C. G. Dowson, F. C. Tenover, and B. G. Spratt. 1995. Genetic analysis of clinical isolates of Streptococcus pneumoniae with high-level resistance to expanded-spectrum cephalosporins. Antimicrob. Agents Chemother. 39:1306-1313[Abstract]. |
| 6. | Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Extensive re-modelling of the transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South African isolate of Streptococcus pneumoniae. Mol. Microbiol. 3:95-102[Medline]. |
| 7. |
Dowson, C. G.,
A. P. Johnson,
E. Cercenado, and R. C. George.
1994.
Genetics of oxacillin resistance in clinical isolates of Streptococcus pneumoniae that are oxacillin resistant and penicillin susceptible.
Antimicrob. Agents Chemother.
38:49-53 |
| 8. |
Figueiredo, A. M. S.,
J. D. Connor,
A. Severin,
M. V. Vaz Pato, and A. Tomasz.
1992.
A pneumococcal clinical isolate with high-level resistance to cefotaxime and ceftriaxone.
Antimicrob. Agents Chemother.
36:886-889 |
| 9. |
Garcia-Bustos, J., and A. Tomasz.
1990.
A biological price of antibiotic resistance: major changes in the peptidoglycan structure of penicillin-resistant pneumococci.
Proc. Natl. Acad. Sci. USA
87:5415-5419 |
| 10. |
Grebe, T., and R. Hakenbeck.
1996.
Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of -lactam antibiotics.
Antimicrob. Agents Chemother.
40:829-834[Abstract].
|
| 11. |
Hakenbeck, R.,
A. König,
I. Kern,
M. van der Linden,
W. Keck,
D. Billot-Klein,
R. Legrand,
B. Schoot, and L. Gutmann.
1998.
Acquisition of five high-Mr penicillin-binding protein variants during transfer of high-level -lactam resistance from Streptococcus mitis to Streptococcus pneumoniae.
J. Bacteriol.
180:1831-1840 |
| 12. | Kell, C. M., U. K. Sharma, C. G. Dowson, C. Town, T. S. Balganesh, and B. G. Spratt. 1993. Deletion analysis of the essentiality of penicillin-binding proteins 1A, 2B, 2X of Streptococcus pneumoniae. FEMS. Microbiol. Lett. 106:171-175[Medline]. |
| 13. | Krauss, J., M. van der Linden, T. Grebe, and R. Hakenbeck. 1996. Penicillin-binding protein 2x and 2b as primary PBP targets in Streptococcus pneumoniae. Microb. Drug Resist. 2:183-186. [Medline] |
| 14. |
Kuzin, A. P.,
H. Liu,
J. A. Kelly, and J. R. Knox.
1995.
Binding of cephalothin and cefotaxime to D-Ala-D-Ala-peptidase reveals a functional basis of a natural mutation in a low-affinity penicillin-binding protein and in extended-spectrum -lactamases.
Biochemistry
34:9532-9540[Medline].
|
| 15. | Laible, G., R. Hakenbeck, M. A. Sicard, B. Joris, and J. M. Ghuysen. 1989. Nucleotide sequences of the pbpX genes encoding the penicillin-binding proteins 2X from Streptococcus pneumoniae R6 and a cefotaxime-resistant mutant, C506. Mol. Microbiol. 3:1337-1348[Medline]. |
| 16. | Laible, G., B. G. Spratt, and R. Hakenbeck. 1991. Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5:1993-2002[Medline]. |
| 17. |
Markiewicz, Z., and A. Tomasz.
1989.
Variation in penicillin-binding protein patterns of penicillin-resistant clinical isolates of pneumococci.
J. Clin. Microbiol.
27:405-410 |
| 18. |
Martin, C.,
T. Briese, and R. Hakenbeck.
1992.
Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin-binding proteins 1A and 1B.
J. Bacteriol.
174:4517-4523 |
| 19. |
Mouz, N.,
E. Gordon,
A. M. Di Guilmi,
I. Petit,
Y. Petillot,
Y. Dupont,
R. Hakenbeck,
T. Vernet, and O. Dideberg.
1998.
Identification of a structural determinant for resistance to -lactam antibiotics in gram-positive bacteria.
Proc. Natl. Acad. Sci. USA
95:13403-13406 |
| 20. | Muñoz, R., C. G. Dowson, M. Daniels, T. J. Coffey, C. Martin, R. Hakenbeck, and B. G. Spratt. 1992. Genetics of resistance to third-generation cephalosporins in clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 6:2461-2465[Medline]. |
| 21. | Pares, S., N. Mouz, Y. Petillot, R. Hakenbeck, and O. Dideberg. 1996. X-ray structure of Streptococcus pneumoniae PBP2x, a primary target enzyme. Nat. Struct. Biol. 3:284-289[Medline]. |
| 22. | Reichmann, P., A. König, A. Marton, and R. Hakenbeck. 1996. Penicillin-binding proteins as resistance determinants in clinical isolates of Streptococcus pneumoniae. Microb. Drug Resist. 2:177-181. [Medline] |
| 23. |
Sifaoui, F.,
M. D. Kitzis, and L. Gutmann.
1996.
In vitro selection of one-step mutants of Streptococcus pneumoniae resistant to different oral -lactam antibiotics is associated with alterations of PBP2x.
Antimicrob. Agents Chemother.
40:152-156[Abstract].
|
| 24. | Sloas, M. M., F. F. Barrett, P. J. Chesney, B. K. English, B. C. Hill, F. C. Tenover, and R. J. Leggiadro. 1992. Cephalosporin treatment failure in penicillin- and cephalosporin-resistant Streptococcus pneumoniae meningitis. Pediatr. Infect. Dis. J. 11:662-666[Medline]. |
| 25. | Smith, A. M., and K. P. Klugman. 1995. Alterations in penicillin-binding protein 2B from penicillin-resistant wild-type strains of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 39:859-867[Abstract]. |
| 26. |
Smith, A. M., and K. P. Klugman.
1998.
Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:1329-1333 |
| 27. |
Tomasz, A., and R. D. Hotchkiss.
1964.
Regulation of the transformability of pneumococcal cultures by macromolecular cell products.
Proc. Natl. Acad. Sci. USA
51:480-487 |
| 28. |
Tomasz, A., and J. L. Mosser.
1966.
On the nature of the pneumococcal activator substance.
Proc. Natl. Acad. Sci. USA
55:58-66 |
| 29. | Ubukata, K., T. Muraki, A. Igarashi, Y. Asahi, and M. Konno. 1997. Identification of penicillin and other beta-lactam resistance in Streptococcus pneumoniae by polymerase chain reaction. J. Infect. Chemother. 3:190-197. |
| 30. |
Viladrich, P. F.,
F. Gudiol,
J. Linares,
R. Pallares,
I. Sabate,
G. Rufi, and J. Ariza.
1991.
Evaluation of vancomycin for therapy of adult pneumococcal meningitis.
Antimicrob. Agents Chemother.
35:2467-2472 |
| 31. | Yamane, A., H. Nakano, Y. Asahi, K. Ubukata, and M. Konno. 1996. Directly repeated insertion of 9-nucleotide sequence detected in penicillin-binding protein 2B gene of penicillin-resistant Streptococcus pneumoniae. Antimicrob. Agents Chemother. 40:1257-1259[Abstract]. |
| 32. |
Zhao, G.,
W. K. Yeh,
R. H. Carnahan,
J. Flokowitsch,
T. I. Meier,
W. E. Alborn, Jr.,
G. W. Becker, and S. R. Jaskunas.
1997.
Biochemical characterization of penicillin-resistant and -sensitive penicillin-binding protein 2x transpeptidase activities of Streptococcus pneumoniae and mechanistic implications in bacterial resistance to -lactam antibiotics.
J. Bacteriol.
179:4901-4908 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clin. Vaccine Immunol. | Clin. Microbiol. Rev. |
|---|---|
| J. Clin. Microbiol. | ALL ASM JOURNALS |
