Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, June 1999, p. 1367-1372, Vol. 43, No. 6
Departments of
Pathobiology1 and
Medicine,3 University of Washington,
Seattle, Washington 98195, and Catedra de Microbiologia,
Facultad de Quimica, Montevideo, Uruguay2
Received 1 October 1998/Returned for modification 20 January
1999/Accepted 12 March 1999
Two Neisseria gonorrhoeae isolates from Seattle and two
isolates from Uruguay were resistant to erythromycin (MIC, 4 to 16 µg/ml) and had reduced susceptibility to azithromycin (MIC, 1 to 4 µg/ml) due to the presence of the self-mobile rRNA methylase gene(s)
ermF or ermB and ermF. The two
Seattle isolates and one isolate from Uruguay were multiresistant,
carrying either the 25.2-MDa tetM-containing plasmid
(Seattle) or a Neisseria gonorrhoeae
isolates obtained in Denver, Colo., and Edinburgh, United Kingdom, and
having high-level resistance to erythromycin (MIC, >8 µg/ml) and
reduced susceptibility to azithromycin (MIC, 2 to 4 µg/ml) have been
described (4, 33). The MICs for these isolates were higher
than those normally associated with chromosomal mtr
mutations (3, 8, 13, 15, 30). Unfortunately, these isolates
were not available for examination of the mechanisms of resistance.
During a gonorrhea outbreak in 1994 to 95 in Seattle, Wash., caused by
strains containing the 25.2-MDa plasmid encoding tetracycline
resistance of the Pro Bacterial isolates.
Erythromycin-resistant (Emr)
Pro
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Erythromycin-Resistant Neisseria gonorrhoeae and Oral
Commensal Neisseria spp. Carry Known rRNA Methylase
Genes


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactamase plasmid (Uruguay). Sixteen
commensal Neisseria isolates (10 Neisseria perflava-N. sicca, 2 N. flava, and 4 N. mucosa) for which erythromycin MICs were 4 to 16 µg/ml
were shown to carry one or more known rRNA methylase genes, including
ermB, ermC, and/or ermF. Many of
these isolates also were multiresistant and carried the
tetM gene. This is the first time that a complete
transposon or a complete conjugative transposon carrying an antibiotic
resistance gene has been described for the genus Neisseria.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/IA-1,2 class, two isolates
resistant to both tetracycline and erythromycin (MICs,
16 µg/ml)
were identified. Two additional gonococci, isolated in 1991 and 1995 in
Uruguay and for which an erythromycin MIC (4 µg/ml) higher than that
previously found in this setting was determined, were available for
study. In addition to the identification of these isolates with
high-level erythromycin resistance (4, 33), plasmids
carrying an ermC gene (34) and conferring
erythromycin resistance to both N. gonorrhoeae and
N. meningitidis have been created. These findings
prompted us to evaluate whether these four N. gonorrhoeae
isolates had acquired one or more of the erm genes known for
other urogenital species (2). Investigations further sought
to define the location of these methylase genes (plasmid versus
chromosome), to determine whether their location was on conjugative
units, as have been found in many other species (2, 18, 19, 26,
29), and to examine the transfer of such genes to other isolates
and species. The methylase gene composition of oral commensal
Neisseria spp. for which the erythromycin MICs were 4 to 16 µg/ml was compared to that of the gonococcal isolates.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/IA-1,2 N. gonorrhoeae isolates were
isolated in Seattle during the 1994-1995 gonococcal outbreak (Table
1). Both Seattle isolates (94-965 and
95-1) were also tetracycline resistant. The 1995 Uruguay isolate, 581, was Pro
/IB-3, and the 1991 Uruguay isolate, 1101, was
nonrequiring Proto/IB-3. Strain 1101 carried the 3.2-MDa
-lactamase
plasmid and was resistant to penicillin in addition to erythromycin,
while all the other N. gonorrhoeae isolates did not carry a
-lactamase plasmid. Six other Tcr
Pro
/IA-1,2 N. gonorrhoeae isolates that were
from the Seattle outbreak but that were not resistant to erythromycin
were available for comparison with the two Emr
Tcr N. gonorrhoeae isolates. The NRL
(Neisseria Reference Laboratory, University of Washington,
Seattle) strains were isolated prior to 1986. The N. gonorrhoeae isolates were confirmed by biochemical methods
(11). Auxotypes, protein I serovars, and plasmid contents of
the gonococcal isolates were determined by established methods (5,
6, 9, 32).
TABLE 1.
MICs for and antibiotic resistance determinants of
N. gonorrhoeae and commensal Neisseria spp.
Media. GC base or GCP broth (Difco Laboratories, Detroit, Mich.) supplemented as previously described (9, 20) was used for routine culturing of N. gonorrhoeae, Neisseria spp., and Enterococcus faecalis.
Antimicrobial susceptibilities. Mueller-Hinton medium (Difco) was used to determine the MICs for the commensal Neisseria spp., N. meningiditis, and E. faecalis transconjugants, and supplemented GC medium base (Difco) was used for N. gonorrhoeae, as recommended by the National Committee on Clinical Laboratory Standards for aerobic bacteria (12). The antibiotic concentrations tested were as follows: erythromycin, 0.06 to 32 µg/ml; azithromycin, 0.03 to 8 µg/ml; and tetracycline, 0.06 to 32 µg/ml. MIC plates were incubated at 36.5°C for 24 h with CO2 for N. gonorrhoeae and without CO2 for commensal Neisseria spp., N. meningitidis, and E. faecalis transconjugants.
Proteinase K treatment. Isolates and transconjugants were treated with proteinase K as previously described (2) and used as templates for the PCR assays. Each proteinase K-treated sample was not used more than three times, since repeated freezing and thawing has been shown to degrade DNA samples (2).
PCR of the ermF gene. The PCR primers used in the study were F1 (5' CGGGTCAGCACTTTACTATTG 3', starting at bp 1235) and F2 (5' GGACCTACCTCATAGACAAG 3', antisense sequence ending at bp 1700). The expected size of the PCR fragment was 466 bp (2, 14, 28). Each 100-µl reaction mixture contained 2 U of Taq polymerase (Boehringer Mannheim Indianapolis, Ind.), 200 mM deoxynucleoside triphosphate, 1× PCR buffer I (1.5 mM MgCl2), and 100 ng of each primer. Ten to 40 ng of DNA or 1 to 2 µl of proteinase K-treated bacteria were used as the DNA template. The PCR conditions were as follows: denaturing at 94°C for 30 s, annealing at 50°C for 30 s, and elongation at 72°C for 2 min. The cycle was repeated 35 times. Plasmid pBF4 (2), containing the cloned ermF gene, and water were used as positive and negative controls, respectively. The PCR products were dried on a lyophilizer, resuspended in 10 µl of sterile H2O, run on 1.5% agarose gels, and stained with ethidium bromide for visualization. Southern blots of these gels were hybridized with labeled ermF-containing plasmid probes for confirmation of PCR products as previously described (2).
PCR primers and conditions for the ermA, ermB, and ermC genes. AF (5' CTTCGATAGTTTATTAATATTAGT 3') and AR (5' TCTAAAAAGCATGTAAAAGAA 3'), BF (5' AGTAACGGTACTTAAATTGTTTAC 3') and BR (5' GAAAAGGTACTCAACCAAATA 3'), and CF (5' GCTAATATTGTTTAAATCGTCAAT 3') and CR (5' TCAAAACATAATATAGATAAA 3') have been described previously (2). The PCR conditions for the ermB reaction were the same as those for the ermF reaction. The PCR assay used for ermA consisted of denaturing at 94°C for 30 s, annealing at 48°C for 1 min, and elongation at 72°C for 2 min; that used for ermC consisted of denaturing at 94°C for 30 s, annealing at 43°C for 1 min, and elongation at 72°C for 2 min.
DNA hybridization. DNA was extracted from N. gonorrhoeae, commensal Neisseria spp., N. meningitidis, and selected transconjugants as previously described (9, 20). Uncut whole-cell DNA was visualized on a 0.7% agarose gel stained with ethidium bromide, and Southern blots were prepared. Fragment probes prepared from rRNA methylase genes from the cloned plasmids pEM9592, pJIR229, pBR328:33RV, pBF4, and pJI3, which carried the genes ermA, ermB, ermC, ermF, and tetM, respectively, or oligonucleotide probes for the appropriate genes were used (2, 16). The DNA probes were labeled with the appropriate Genius 3 chemiluminescence kit as recommended by the manufacturer (Boehringer). Hybridization under stringent conditions and detection were done according to the manufacturer's instructions as previously described (2, 19). Positive and negative controls were included in each Southern blot.
Hybridization of PCR products. Plasmids pEM9592, pJIR229, pBR328:33RV, and pBF4 or oligonucleotide probes for ermA, ermB, ermC, and ermF were labeled with nonradioactive Genius kits as recommended by the manufacturer (Boehringer). The labeled plasmids were used for hybridization with Southern blots of the appropriate PCR product or purified whole-cell DNA. The hybridization and wash steps were performed at stringent temperatures according to the manufacturer's instructions. Detection was done with a CDP-Star detection kit at a reagent concentration of 1:1,000 as described by the manufacturer (Boehringer).
Sequencing. The ermF PCR products from N. gonorrhoeae and commensal Neisseria spp. were sequenced separately with primers ermF1 and ermF2. A Taq Dye Deoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.) was used for PCR amplification, and the filtered PCR products (Nuclean D50 filters; Kodak, Rochester, N.Y.) were examined on a model 373A sequencer (Applied Biosystems) (2, 19). The two sequences for each isolate were overlapped, aligned and compared with the known GenBank sequence of ermF (accession no. M14730) by use of GCG software (Genetics Computer Group, Madison, Wis.). The putative amino acid sequences were determined from the DNA sequences and also compared with the known GenBank sequence of ErmF( 19).
Mating experiments.
Recipients included N. gonorrhoeae F62, with chromosomally mediated resistance to
rifampin (25 µg/ml), streptomycin (250 µg/ml), and nalidixic acid
(25 µg/ml) (21, 22, 27); N. gonorrhoeae CDC36N,
with chromosomally mediated resistance to nalidixic acid (25 µg/ml)
and carrying the 4.4-MDa
-lactamase plasmid (20); E. faecalis JH2-2, resistant to rifampin (25 µg/ml) and
fusidic acid (25 µg/ml) (2, 19, 24, 26); N. meningitidis NRL9205 (serogroup A), resistant to streptomycin (250 µg/ml) and rifampin (20 µg/ml) (23); and N. mucosa CTM 1.1, with chromosomally mediated resistance to
streptomycin (250 µg/ml) and rifampin (20 µg/ml). Donors included
Emr N. gonorrhoeae isolates and selected
isolates from each of the commensal Neisseria species.
Donors and recipients were grown separately for 24 h on agar
plates. The donor and recipient isolates were each resuspended in 0.5 ml of GCP broth to form turbid suspensions (>108/ml),
mixed together, and plated on a GC agar (Difco) plate without antibiotics as previously described (22, 23, 27). The
mixture was incubated at 36.5°C in 5% CO2 for 24 h.
N. meningitidis, N. mucosa, and N. gonorrhoeae F62 transconjugants were selected on medium containing
streptomycin (150 µg/ml) and erythromycin (10 µg/ml). The
transconjugants were confirmed by growth on rifampin (25 µg/ml)
(21-23). N. gonorrhoeae CDC36N transconjugants
were selected on medium containing penicillin (10 µg/ml) and
erythromycin (10 µg/ml). The transconjugants were verified by growth
on nalidixic acid (25 µg/ml) and the presence of the 4.4-MDa
-lactamase plasmid (21-23, 27). JH2-2 transconjugants
were selected on medium containing rifampin (10 µg/ml) and
erythromycin (10 µg/ml). The E. faecalis transconjugants
were confirmed by growth on medium supplemented with streptomycin (150 µg/ml) and by use of chromosomal DNA probe specific for E. faecalis (2). N. meningitidis
transconjugants were confirmed by growth on medium supplemented with
rifampin (20 µg/ml).
PFGE.
Pulsed-field gel electrophoresis (PFGE) was used to
compare the Emr N. gonorrhoeae isolates to six
Tcr Pro
/IA-1,2 Seattle N. gonorrhoeae isolates which were part of the outbreak. The isolates
were digested with NheI or SpeI (Promega, Madison, Wis.) as previously described (31, 32). The PFGE patterns were compared and assumed to be genetically related if they
were identical or had three or fewer band differences.
| |
RESULTS |
|---|
|
|
|---|
Characterization of macrolide-resistant N. gonorrhoeae.
The two Seattle Pro
/IA-1,2 isolates were identified
because of the high MICs of erythromycin (16 µg/ml) and azithromycin
(4 µg/ml) for them (Table 1). Both Seattle isolates carried 25.2-MDa plasmids (tetracycline MIC, 16 µg/ml) which hybridized with the tetM probe (data not shown). For the two Uruguay isolates,
the erythromycin MIC was 4 µg/ml and the azithromycin MIC was 1 µg/ml (Table 1). Uruguay isolate 1101 was resistant to penicillin and carried a 3.2-MDa
-lactamase plasmid (data not shown). All four N. gonorrhoeae isolates carried an ermF gene,
which encodes a known rRNA methylase, and one isolate (95-1) also
carried ermB (Table 1). The other isolates did not hybridize
with ermA, ermB, or ermC gene probes,
while 95-1 did not hybridize with ermA or ermC
gene probes (data not shown). The ermF probe hybridized with the chromosomal fraction of the gel when whole-cell DNA was used for
the Southern blots, suggesting a chromosomal location for the
ermF gene. In addition, the 2.6- and 3.2-MDa
-lactamase
plasmids or the 25.2-MDa tetM-containing plasmid common to
N. gonorrhoeae was found, but no other plasmids were found
in any of the four isolates.
|
|
/IA-1,2 N. gonorrhoeae isolates obtained during the 1994-1995 Seattle
outbreak had NheI PFGE patterns (Fig. 3, lanes 1 to 6) that were
indistinguishable from the NheI PFGE patterns of the two
Emr Tcr N. gonorrhoeae isolates
(Fig. 3, lanes 7 and 8), but the Seattle Emr isolates
differed from the two Emr N. gonorrhoeae
isolates from Uruguay (Fig. 3, lanes 9 and 10). The two Uruguay
isolates appeared unrelated to the Seattle isolates or to each other
(the PFGE patterns differed by more than three fragments) (Fig. 3).
Similar results were found when SpeI was used for PFGE
analysis (data not shown). Both enzymes gave identical patterns for the
eight Seattle isolates, strongly suggesting a very close relationship
between the two Emr and the six Ems
N. gonorrhoeae isolates from the outbreak.
|
Characterization of macrolide resistance in commensal Neisseria spp. The erythromycin MICs for the other Neisseria spp. ranged from 4 to 16 µg/ml (Table 1). Compared to the N. gonorrhoeae isolates studied, these commensal species contained a more heterologous group of known erm genes (ermB, ermC, and ermF). Among the 10 N. perflava-N. sicca isolates, 4 carried the ermB gene and had erythromycin MICs ranging from 4 to 8 µg/ml; 2 carried ermC and had an erythromycin MIC of 16 µg/ml; 2 carried both ermB and ermC and had erythromycin MICs of 4 to 16 µg/ml; and 2 carried ermB, ermC, and ermF and had erythromycin MICs of 4 to 16 µg/ml (Table 1). Among the four N. perflava-N. sicca strains isolated before 1990, three carried one erm gene, while three of six strains isolated after 1990 carried multiple erm genes. One N. flava strain carried ermC, and the other strain carried ermB (erythromycin MICs, 8 to 16 µg/ml). Among the four N. mucosa strains, two carried both ermB and ermC, one carried ermB, and one carried ermC; the erythromycin MIC for all four strains was 8 µg/ml (Table 1).
To confirm the presence of the erm genes, we used PCR sequencing. The PCR fragment of the ermF gene from N. perflava-N. sicca 10915 was sequenced; the DNA sequence homology between the PCR fragment and the ermF gene from Bacteroides spp. showed 97% identity over 374 bp, and the amino acid homology was 94% (data not shown).Transfer of erythromycin resistance.
All four of the N. gonorrhoeae isolates and seven of the commensal
Neisseria sp. isolates were examined for their ability to
transfer the Emr phenotype to Neisseria and
E. faecalis recipients (Table
2). N. gonorrhoeae donors
transferred the ermF gene at frequencies of
10
6/recipient with the two different N. gonorrhoeae recipients, 10
7/recipient with N. meningitidis as the recipient, and 10
7 to
10
8/recipient with E. faecalis as the
recipient.
|
5 to 10
9 for E. faecalis and N. meningitidis. Matings were done at
least twice, and only a portion of the transconjugants were
characterized and described in Table 2. The donor N. mucosa
CTM 2.2 could move the ermB gene but not the ermC
gene to the recipient N. mucosa CTM 1.1 (Table 2) at a
frequency of 10
8/recipient. The other N. mucosa donor (CTM 8.1) and the various N. perflava-N. sicca and N. flava donors used
in the matings, which transferred erm genes to E. faecalis and/or N. meningitidis recipients, could
not transfer erm genes at measurable frequencies (>10
9/recipient) to the recipient N. mucosa
CTM 1.1 (Table 2). Both E. faecalis and N. meningitidis recipients were able to acquire one or more
erm genes. No N. meningitidis with
ermF was isolated from the transconjugants with the
commensal donors, but ermF was found in N. meningitidis transconjugants when N. gonorrhoeae
carrying the ermF gene was used as the donor (Table 2).
The 25.2-MDa plasmid, conferring tetracycline resistance, was
transferred from a Seattle N. gonorrhoeae donor to N. gonorrhoeae and N. meningitidis recipients but not to
E. faecalis recipients (data not shown). No plasmids
carrying the tetM gene were found in the commensal species,
and we were unable to transfer tetracycline resistance from these
species to either N. meningitidis or E. faecalis.
However, this result was anticipated, since we have previously shown
that commensal Neisseria sp. isolates carry an incomplete
tetM transposon in the chromosome and were unable to transfer tetM by conjugation (16, 17, 25).
| |
DISCUSSION |
|---|
|
|
|---|
This is the first description of a known erm gene(s) in
the genus Neisseria, since both the TEM
-lactamase and
the tetM genes have incomplete transposons in N. gonorrhoeae, N. meningitidis, and the commensal
Neisseria spp. (5, 16, 17). The data indicates
that the ermF genes have been in N. gonorrhoeae
since at least 1991, the ermB genes have been in N. gonorrhoeae since 1995, and various erm genes have been
in three commensal species (N. perflava-N. sicca,
N. flava, and N. mucosa) since at least the 1980s
(Table 1). Whether erm genes are relatively new (last 20 years) in Neisseria spp. or whether they predate the
identification of the
-lactamase plasmids in N. gonorrhoeae (5) is currently under investigation.
Donors carrying the 25.2-MDa plasmid with the tetM gene
transferred this gene into N. gonorrhoeae and N. meningitidis recipients but not into E. faecalis (data
not shown), indicating that the ermF gene had a wider host
range than the gonococcal 25.2-MDa plasmid (17, 22) or the
gonococcal 24.5-MDa and
-lactamase plasmids (17, 23).
Although 10 (63%) of the commensal Neisseria isolates
carried the tetM gene (Table 1), none could move this gene,
as has previously been described (16, 17).
N. gonorrhoeae with reduced susceptibility to erythromycin
(MICs, 2 to 4 µg/ml) has been reported since the 1960s (1,
15). Some studies have shown a positive association
between reduced susceptibility to penicillin, erythromycin,
chloramphenicol, and tetracycline and mtr mutations
(3). It was hypothesized that resistant N. gonorrhoeae isolates for which erythromycin MICs were 2 to 4 µg/ml were due to the presence of mtr mutations (3, 8). However, the maximum azithromycin MICs for these isolates generally were 0.25 to 0.5 µg/ml (unpublished observations). Based upon our finding with the two Uruguay isolates, for which the erythromycin MIC was 4 µg/ml and the azithromycin MIC was 1 µg/ml (Table 1), it is tempting to speculate that other N. gonorrhoeae isolates for which erythromycin MICs are 2 to 4 µg/ml also may carry erm genes with or without
mtr mutations. We are currently examining isolates obtained
during different decades and for which erythromycin MICs range
from 0.5 to 8 µg/ml. It will be of interest to determine whether the
characteristics attributed to the mtr mutations are due to
the combination of mtr mutations and erm genes or whether reduced susceptibility to penicillin and tetracycline is associated with mtr mutations but reduced susceptibility
to erythromycin is associated not with mtr mutations but
with the presence of erm genes (3). Clinically,
this information will be of interest because many infections in
homosexual and bisexual men in Seattle-King County (10) are
due to N. gonorrhoeae isolates with a phenotypic pattern
(reduced susceptibility to erythromycin, penicillin, and tetracycline)
suggesting mtr mutations. Some of these isolates have been
shown to carry an mtr mutation by sequencing of PCR
products. One can speculate that one or more of the four Emr N. gonorrhoeae isolates in this study may
carry both erm genes and mtr mutations. However,
mtr mutations cannot be transferred by conjugation, nor do
they influence the transfer of coresident
-lactamase plasmids. Since
the ermF-tetQ transposons in colonic Bacteroides
spp. are able to transfer mobilizable plasmids between Bacteroides spp., the ability of mobile ermF to
conjugally transfer gonococcal
-lactamase plasmids is under
investigation (2).
Three of the N. gonorrhoeae isolates and over 60% of the
commensal species isolates were multiresistant (Table 1). The
ermF gene in N. gonorrhoeae and the
ermB, ermC, and ermF genes in the commensal species (Table 2) were able to move themselves by conjugation to other Neisseria spp. and to E. faecalis
recipients. This finding implies that these erm genes are
associated with complete conjugative elements, and this is the first
description of complete transposable elements in Neisseria.
Previously described TEM
-lactamase genes and the tetM
gene are both on incomplete elements (5, 9, 17).
There was greater diversity among the erm genes carried by the 16 commensal Neisseria isolates than by the 4 N. gonorrhoeae isolates. Within this study, there was no association of erythromycin MIC with the number of erm genes found or with a particular gene among the commensal Neisseria spp. Further studies are needed to determine whether clinical isolates of N. gonorrhoeae carrying the ermC gene can be found or whether carriage of this gene is unique to the commensal species. Studies are needed to determine the influence of these erm genes on the treatment of gonococcal disease with the newer macrolides. It also remains to be determined if the commensal Neisseria spp. are reservoirs for these erm genes, how long these genes have actually been in the genus, whether most erm genes are on mobile conjugative elements, and whether isolates carrying erm genes are more likely to be multiresistant than the general Neisseria population.
| |
ACKNOWLEDGMENT |
|---|
This work was supported in part by National Institutes of Health grants AI-131448 and DE-10913.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pathobiology, Box 357238, University of Washington, Seattle, WA 98195-7238. Phone: (206) 543-8001. Fax: (206) 543-3873. E-mail: marilynr{at}u.washington.edu.
Present address: Dade MicroScan Inc., West Sacramento, CA 95691.
Present address: Department of Medicine, University of Washington,
Seattle, WA 98195.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amies, C. R. 1969. Sensitivity of N. gonorrhoeae to penicillin and other antibiotics. Br. J. Vener. Dis. 45:216-222[Medline]. |
| 2. |
Chung, W. O.,
C. Werckenthin,
S. Schwarz, and M. C. Roberts.
1999.
Host range of the ermF rRNA methylase gene in human and animal bacteria.
J. Antimicrob. Chemother.
43:5-14 |
| 3. |
Delahay, R. M.,
B. D. Robertson,
J. T. Balthazar,
W. M. Shafer, and C. A. Ison.
1997.
Involvement of the gonococcal MtrE protein in the resistance of Neisseria gonorrhoeae to toxic hydrophobic agents.
Microbiology
143:2127-2133 |
| 4. | Ehret, J. M., L. J. Nims, and F. N. Judson. 1996. A clinical isolate of Neisseria gonorrhoeae with in vitro resistance to erythromycin and decreased susceptibility to azithromycin. Sex. Transm. Dis. 23:270-272[Medline]. |
| 5. |
Elwell, L. P.,
M. Roberts,
L. W. Mayer, and S. Falkow.
1977.
Plasmid-mediated beta-lactamase production in Neisseria gonorrhoeae.
Antimicrob. Agents Chemother.
11:528-533 |
| 6. |
Evins, G. M., and J. S. Knapp.
1988.
Characterization of Neisseria gonorrhoeae reference strains used in the development of a serologic classification system.
J. Clin. Microbiol.
26:358-363 |
| 7. |
Knapp, J. S.,
S. R. Johnson,
J. M. Zenilman,
M. C. Roberts, and S. A. Morse.
1988.
High-level tetracycline resistance resulting from TetM in strains of Neisseria spp., Kingella denitrificans, and Eikenella corrodens.
Antimicrob. Agents Chemother.
32:765-767 |
| 8. | Maness, M. J., and P. F. Sparling. 1973. Multiple antibiotic resistance due to single mutation in Neisseria gonorrhoeae. J. Infect. Dis. 128:321-330[Medline]. |
| 9. |
Morse, S. A.,
S. R. Johnson,
J. W. Biddle, and M. C. Roberts.
1986.
High-level tetracycline resistance in Neisseria gonorrhoeae is the result of acquisition of a streptococcal tetM determinant.
Antimicrob. Agents Chemother.
30:664-670 |
| 10. |
Morse, S. A.,
P. G. Lysko,
L. McFarland,
J. S. Knapp,
E. Sandstrom,
C. Critchlow, and K. K. Holmes.
1982.
Gonococcal strains from homosexual men have outer membranes with reduced permeability to hydrophobic molecules.
Infect. Immun.
37:432-438 |
| 11. | Murray, P. R., E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.). 1995. Manual of clinical microbiology, 6th ed. American Society for Microbiology, Washington, D.C. |
| 12. | National Committee for Clinical Laboratory Standards. 1993. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A2. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 13. |
Piot, P.,
E. van Dyck,
J. Colaert,
J.-P. Ursi,
E. Bosmans, and A. Meheus.
1979.
Antibiotic susceptibility of Neisseria gonorrhoeae strains from Europe and Africa.
Antimicrob. Agents Chemother.
15:535-539 |
| 14. |
Rasmussen, J. L.,
D. A. Odelson, and F. L. Macrina.
1986.
Complete nucleotide sequence and transcription of ermF, a macrolide-lincosamide-streptogramin B resistance determinant from Bacteroides fragilis.
J. Bacteriol.
168:523-533 |
| 15. | Reyn, A., and M. W. Bentzon. 1969. Relationships between the sensitivities in vitro of Neisseria gonorrhoeae to spiramycin, penicillin, streptomycin, tetracycline and erythromycin. Br. J. Vener. Dis. 45:223-227[Medline]. |
| 16. |
Roberts, M. C.
1990.
Characterization of the Tet M determinants in urogenital and respiratory bacteria.
Antimicrob. Agents Chemother.
34:476-478 |
| 17. | Roberts, M. C. 1989. Plasmids of Neisseria gonorrhoeae and other Neisseria species. Clin. Microbiol. Rev. 2:S18-S23. |
| 18. | Roberts, M. C., and M. B. Brown. 1994. Macrolide-lincosamide resistance determinants in streptococcal species isolated from the bovine mammary gland. Vet. Microbiol. 40:253-261[Medline]. |
| 19. |
Roberts, M. C.,
W. O. Chung, and D. E. Roe.
1996.
Characterization of tetracycline and erythromycin resistance determinants in Treponema denticola.
Antimicrob. Agents Chemother.
40:1690-1694 |
| 20. |
Roberts, M. C.,
L. P. Elwell, and S. Falkow.
1977.
Molecular characterization of two beta-lactamase-specifying plasmids isolated from Neisseria gonorrhoeae.
J. Bacteriol.
131:557-563 |
| 21. | Roberts, M. C., and S. Falkow. 1977. Conjugal transfer of R plasmids in Neisseria gonorrhoeae. Nature 266:630-631[Medline]. |
| 22. |
Roberts, M. C., and J. S. Knapp.
1988.
Host range of the conjugative 25.2-megadalton tetracycline resistance plasmid from Neisseria gonorrhoeae and related species.
Antimicrob. Agents Chemother.
32:488-491 |
| 23. |
Roberts, M. C., and J. S. Knapp.
1988.
Transfer of -lactamase plasmids from Neisseria gonorrhoeae to N. meningitidis and commensal Neisseria species by the 25.2-megadalton conjugative plasmid.
Antimicrob. Agents Chemother.
32:1430-1432 |
| 24. |
Roberts, M. C., and J. Lansciardi.
1990.
Transferable Tet M in Fusobacterium nucleatum.
Antimicrob. Agents Chemother.
34:1836-1838 |
| 25. |
Roberts, M. C., and B. J. Moncla.
1988.
Tetracycline resistance and TetM in oral anaerobic bacteria and Neisseria perflava-N. sicca.
Antimicrob. Agents Chemother.
32:1271-1273 |
| 26. |
Roe, D. E.,
A. Weinberg, and M. C. Roberts.
1995.
Mobility of rRNA methylase genes in Campylobacter (Wolinella) rectus.
J. Antimicrob. Chemother.
36:738-740 |
| 27. |
Sarafian, S. K.,
C. A. Genco,
M. C. Roberts, and J. S. Knapp.
1990.
Acquisition of -lactamase and TetM-containing conjugative plasmids by phenotypically different strains of Neisseria gonorrhoeae.
Sex. Transm. Dis.
17:67-71[Medline].
|
| 28. |
Smith, C. J.
1987.
Nucleotide sequence analysis of Tn4551: use of ermFS operon fusions to detect promoter activity in Bacteroides fragilis.
J. Bacteriol.
169:4589-4596 |
| 29. |
Sutcliffe, J.,
T. Grebe,
A. Tait-Kamradt, and L. Wondrack.
1996.
Detection of erythromycin-resistant determinants by PCR.
Antimicrob. Agents Chemother.
40:2562-2566 |
| 30. |
van Klingeren, B.,
M. C. Ansink-Schipper,
L. Doornbos,
A. S. Lampe,
J. H. T. Wagenvoort,
M. Dessens-Kroon, and M. Verheuvel.
1998.
Surveillance of the antibiotic susceptibility of non-penicillinase producing Neisseria gonorrhoeae in The Netherlands from 1983 to 1986.
J. Antimicrob. Chemother.
21:737-744 |
| 31. | Xia, M., W. L. Whittington, K. K. Holmes, F. A. Plummer, and M. C. Roberts. 1995. Pulsed-field gel electrophoresis for genomic analysis of Neisseria gonorrhoeae. J. Infect. Dis. 171:455-458[Medline]. |
| 32. | Xia, M., W. L. Whittington, K. L. Holmes, and M. C. Roberts. 1997. Genomic homogeneity of the AHU/IA-1,2 phenotype of Neisseria gonorrhoeae during its elimination from an urban population. Sex. Transm. Dis. 24:561-566[Medline]. |
| 33. | Young, H., A. Moyes, and A. McMillan. 1997. Azithromycin and erythromycin resistant Neisseria gonorrhoeae following treatment with azithromycin. Int. J. Sex. Transm. Dis. AIDS 8:299-302. |
| 34. |
Zhou, D., and M. A. Apicella.
1996.
Plasmids with erythromycin resistance and catechol 2,3-dioxygenase- or -galactosidase-encoding gene cassettes for use in Neisseria spp.
Gene
171:133-134[Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»