Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, September 1999, p. 2144-2147, Vol. 43, No. 9
Department of Microbiology,
Received 4 February 1999/Returned for modification 19 May
1999/Accepted 24 June 1999
A total of 3,205 group A streptoccal isolates were collected in
1997 through a private laboratory which serves community physicians in
southern Ontario and which represents a population base of 6 million
people. Nonsusceptibility to erythromycin was detected for 67 (2.1%)
isolates both by disk diffusion and by broth microdilution. Of these,
47 (70%) were susceptible to clindamycin and were found by PCR to
possess the mef gene. Of the other 20 strains, 18 and 2 showed inducible and constitutive resistance, respectively, to
clindamycin. Nineteen of these strains were shown by PCR to possess the
ermTR gene, and a single constitutively resistant strain
harbored an ermB gene. Sixteen (24%)
erythromycin-resistant strains were also resistant to tetracycline. All
were susceptible to penicillin and chloramphenicol.
Although there have been no
confirmed reports of decreased susceptibility to penicillin in group A
streptococci (GAS), resistance to erythromycin has emerged in some
countries. Rates of resistance in Europe in the last decade have ranged
from 10% in Sweden (13) up to 17% in Finland
(15), 22% in the United Kingdom (23), and 47%
in parts of Italy (3). Rates of resistance in excess of 50%
have been reported in Taiwan and Japan (12, 19). Prevalence rates in some countries are still low, as in Argentina, where the
current rate of erythromycin resistance is less than 1%
(18).
Macrolides exert their action by binding to the bacterial ribosome and
inhibiting protein synthesis. Resistance in streptococci has been shown
to arise either through the presence of erm gene-encoded methyltransferases which induce ribosomal modification or through efflux. Macrolide efflux in GAS is effected by a membrane protein encoded by the mefA gene and is specific for 14- and
15-member macrolides such as erythromycin, clarithromycin, and
azithromycin; the lincosamides and streptogramin antibiotics remain
unaffected (M phenotype) (2). Erm methylases methylate 23S
rRNA and induce ribosomal modification, which results in loss of
binding not only to macrolides but also to lincosamides and the
streptogramin B class of antimicrobials (MLSB phenotype)
(29). Several methylases have been described for
gram-positive bacteria (6); the ErmB (ErmAM) group is that
most commonly found in streptococci (17). The
ermTR gene in GAS has more homology to the ermA
gene (83%) found in staphylococci than to the ermB gene
(58%) from GAS (25). In a recent report, it was noted that
in Finland, 60% of erythromycin-resistant strains had the M phenotype
and all but one of the remaining strains with the MLSB
phenotype had the ermTR gene (16).
Strains with a particular mechanism of resistance may have different
prevalence rates depending on the country of origin. For example, with
erythromycin-resistant Streptococcus pneumoniae, the M
phenotype predominates in strains isolated in Canada and the United
States (14, 28), whereas in South Africa, the
MLSB phenotype is more prevalent (30). Although
GAS strains with the M phenotype have been reported in the United
States (4), there is little information about prevalence
rates of mef and erm genes.
In this study we looked at the prevalence of erythromycin resistance in
GAS clinical isolates collected in southern Ontario and examined their
mechanisms of resistance.
Strains.
From August to November 1997, all consecutive
clinical isolates of GAS, 3,205 strains in total, were collected by a
private laboratory serving community physicians throughout southern
Ontario, Canada, representing a population base of 6 million people.
Strains were identified by PathoDx (Diagnostic Products Corp., Los
Angeles, Calif.).
Susceptibility testing.
Erythromycin-resistant strains were
initially identified by disk diffusion on Mueller-Hinton agar
supplemented with 5% sheep blood using 15-µg erythromycin disks
(Becton Dickinson, Cockeysville, Md.) according to National Committee
for Clinical Laboratory Standards (NCCLS) guidelines (21).
MICs of penicillin, erythromycin, clindamycin, tetracycline,
chloramphenicol (Sigma-Aldrich, Canada, Oakville, Ontario), and
quinopristin-dalfopristin (Rhone-Poulenc Rorer, Collegeville, Pa.) were
determined for erythromycin-resistant strains by using
cation-supplemented Mueller-Hinton broth with 2% lysed horse blood in
accordance with NCCLS guidelines (21). Incubation was
performed at 37°C in O2, except for two strains which
required CO2 for growth. S. pneumoniae ATCC
49619 and ATCC 6303 and Enterococcus faecalis ATCC 29212 were used as controls. In order to distinguish between M and
MLSB phenotypes, erythromycin (15 µg) and clindamycin (2 µg) disks were placed on plates approximately 12 mm apart, and the
plates were incubated overnight at 37°C in 5% CO2.
Blunting of the growth inhibition zone around clindamycin in the area
between the two disks was considered to indicate inducible MLSB resistance (MLSB phenotype); constitutive
resistance was defined as zones of PCR.
For the identification of ermABC and
mef genes, multiplex PCR was performed with published primer
sequences (27). Template DNA was prepared by mixing a
loopful of bacteria grown overnight on blood agar with 100 µl of
lysis buffer (100 mM NaCl, 10 mM Tris HCl [pH 8.3], 1 mM EDTA [pH
8.0], 1% Triton X-100) and boiling in a water bath for 10 min. After
cooling, the suspensions were spun, and 5 µl of the supernatant was
used as a template. Reactions were performed in a Perkin-Elmer 9600 thermocycler with a final reaction volume of 25 µl by using 4 mM
MgCl2 and the following cycling conditions: denaturation at
94°C for 4 min, followed by 30 cycles of 94°C for 1 min, 57°C for
1 min, and 72°C for 1 min. A final elongation step was performed at
72°C for 5 min. The following primer sequences based on the sequence
of the ermTR gene (GenBank accession no. AF002716) were used
for detection of ermTR: GAAGTTTAGCTTTCCTAA (ermTRA, sense, 5' to 3') and
GCTTCAGCACCTGTCTTAATTGAT (ermTRB, antisense, 5'
to 3'). Control strains were GAS 0261110 (ermTR) and
S. pneumoniae 02J1175 (mefE), both kindly
provided by J. Sutcliffe (Pfizer, Groton, Conn.). Reaction conditions
were as described above except that 1.5 mM MgCl2 was used
and amplification was carried out for 35 cycles with denaturation at
94°C for 30 s and annealing at 42°C for 30 s. PCR
products were resolved by electrophoresis on 1% agarose gels. The
expected sizes were 640 bp for ermA, ermB, or
ermC; 348 bp for mef; and 400 bp for
ermTR.
Southern hybridization.
Genomic DNA was isolated by lysis of
a cell pellet derived from 1.5 ml of an overnight culture. Cells were
washed with 1.0 ml of lysis buffer (50 mM glucose, 25 mM Tris [pH
8.0], 10 mM EDTA [pH 8.0], 150 mM NaCl) and incubated in 0.5 ml of
lysis mixture consisting of lysis buffer plus 10 µl of DNase-free
RNase (10 mg/ml), 50 µl of mutanolysin (1 mg/ml), and 50 µl of
lysozyme (10 mg/ml) (all components were purchased from Sigma-Aldrich, Canada). Following lysis, DNA was extracted as described by Smith et
al. (26) and resolved by electrophoresis on 1% agarose
gels. Southern blotting was performed according to standard procedures (1). Hybridization was carried out with mefAE,
ermB, and ermTR probes, derived by PCR as
described above, from the following control strains. S. pneumoniae 02J1175 was used for mefE, and GAS 0261110 was used for ermTR. The ermB probe was amplified
from S. pneumoniae BSP3585, which contains Tn1545
harboring ermB. Staphylococcus aureus RN4220,
harboring plasmid pE194, was used for ermC, and ermA was amplified from Escherichia coli RN7951,
containing an ermA gene from Tn554 cloned into
pUC18 (both kindly provided by B. Kreiswirth, Public Health Research
Institute, New York, N.Y.). Labeling and detection were carried out by
using the ECL direct labeling enhanced chemiluminescence kit (Amersham
Life Science, Oakville, Ontario, Canada) as outlined by the manufacturer.
PFGE.
DNA to be used for pulsed-field gel electrophoretic
(PFGE) analysis was extracted essentially as described by Murray et al. (20) with modifications. A sample of 108 CFU
from an overnight culture was washed in PIV buffer (1 M NaCl-10 mM
Tris-HCl [pH 7.6]) and resuspended in 750 µl of the same buffer. An
equal volume of 1.6% low-melting-point agarose (Bio-Rad Laboratories, Richmond, Calif.) at 65°C was added to the PIV-bacterial suspension; approximately 260 µl was aliquoted into PFGE plug molds (Bio-Rad Laboratories) and cooled to 4°C for 30 min. Plugs were incubated at
37°C in 1.5 ml of lysis mixture (100 mM Tris-HCl at pH 8.0-50 mM
EDTA-1 M NaCl) containing 67 µg of RNase (Boehringer-Mannheim Canada, Laval, Quebec)/ml, 33 µg of mutanolysin/ml, and 300 µg of
lysozyme (Sigma-Aldrich, Canada)/ml. After 5 h, 50 µl of
10-mg/ml proteinase K (Boehringer-Mannheim Canada) was added to the
lysis mixture, and incubation was continued for 18 h. Plugs were
washed three times with TE buffer (10 mM Tris-HCl-0.1 mM EDTA [pH
7.5]) and incubated with 10 U of SmaI (Boehringer-Mannheim
Canada) at 25°C. DNA was resolved by using a contour-clamped
homogeneous electric field (CHEF)-DRII apparatus (Bio-Rad Laboratories)
in a 1% agarose gel at 175 V with an initial pulse time of 5 s
and a final pulse time of 60 s for 24 h at 12°C in 0.5×
Tris-borate-EDTA.
M typing.
Serotyping was carried out by the National
Reference Center for Streptococci, Edmonton, Alberta, Canada, according
to standard protocols (10).
Phenotypic characterization.
Of 3,205 isolates tested, 67 (2.1%) were found to be erythromycin resistant by disk diffusion.
These isolates were also found to be erythromycin resistant by broth
microdilution tests. Disk susceptibility results demonstrated that 47 (70%) were of the M phenotype and 20 (30%) were of the
MLSB phenotype. Of the 20 MLSB resistant
strains, 18 demonstrated blunting of the clindamycin inhibition zone
when placed 12 mm from an erythromycin disk, indicating inducible
resistance. Only two strains showed constitutive resistance to clindamycin.
Genotypic characterization.
As predicted, all of the 47 (70%)
strains bearing an M phenotype yielded an amplification product of 348 bp, which was consistent with the presence of the mef gene.
The primers chosen in this study were based on conserved regions of the
mefA gene from GAS and the mefE gene from
S. pneumoniae, which have 90% homology. None of the strains
with an M phenotype contained an erm determinant. Surprisingly, in the multiplex PCR assay using ermABC
primers, only a single (constitutively resistant) MLSB
strain yielded a product consistent with the presence of
ermA, ermB, or ermC. This strain, for
which the MIC was >16 µg/ml, was shown by Southern blotting to
possess an ermB gene. However, when primers based on the
ermTR gene were used, 19 strains were found to harbor
ermTR (Table 2). Southern
blotting of 12 representative strains confirmed these results. No
hybridization with any of the probes was observed for five randomly
selected erythromycin-sensitive strains. MICs for strains harboring
ermTR genes generally were lower than those for strains
possessing mef genes (Fig. 1).
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Prevalence and Mechanisms of Macrolide Resistance
in Clinical Isolates of Group A Streptococci from Ontario,
Canada
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
15 mm around both the clindamycin
and the erythromycin disk (21). The M phenotype was
characterized by resistance to erythromycin and susceptibility to clindamycin.
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
In vitro susceptibility of 67 GAS strains to select
antimicrobial agents
TABLE 2.
Correlation of phenotype, M type, and genotype
View larger version (15K):
[in a new window]
FIG. 1.
Correlation of the erythromycin MIC with the presence of
mef and erm genes. For a single MLSB
phenotype strain, the erythromycin MIC was >16 g/liter. This strain
was constitutively resistant and was the only strain found to possess
an ermB gene.
PFGE. Of the 20 strains harboring ermTR, 12 showed different patterns, indicating that they were not clonal in origin. Despite several attempts, it was possible to resolve only 11 of 46 mef+ strains by PFGE, and among these, nine patterns were observed. No reason can be given for the lack of success in resolving M phenotype strains by PFGE, but this phenomenon has been noted by other groups (9).
Strain characteristics. Of the 67 erythromycin-resistant strains, 64 were throat isolates and 3 were isolated from wounds. As shown in Table 2, 19 strains (28%) were M serotype, type 4; however, a large proportion of strains were nontypeable (34 of 67; 51%). The presence of mef or ermTR genes did not correlate with particular serotypes.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In this study, the overall rate of erythromycin resistance in GAS strains was low, at 2.1%, compared with the overall rates of 10 to 47% reported in European countries (3, 13, 15, 23). In an earlier study of Canadian strains, resistant strains were detected at a rate of 0.24% in 1971, increasing to 1.4% in 1972 (7). It is encouraging that the prevalence has remained low in Canada. In some countries, such as Spain, it increased steadily from 1.2% before 1990 to 35% in 1995, falling to 18% in 1996, possibly as a result of decreased macrolide use (22). The prevalence of erythromycin-resistant strains with the M phenotype (70%) in this study is lower than that reported in Spain and Sweden (90%) but is similar to that recently reported in Finland (13, 16, 22). In Sweden, the M phenotype has been highly prevalent since the early 1980s (13), and it was also present in Spanish isolates collected in the late 1980s (22). In the study of Canadian isolates collected in 1971 to 1972 in which 145 erythromycin-resistant strains were examined, no M phenotype isolates were identified (7). It is interesting that this phenotype has become so prevalent in Canada in a relatively short time, not only in GAS but also in S. pneumoniae (14). Kataja et al. (16) have shown that the mefA gene can be transferred from GAS to E. faecalis by conjugation, which may explain the spread.
All but 1 of the 20 strains showing the MLSB phenotype possessed the ermTR gene. The MICs of erythromycin for these strains, in general, were lower than those for strains harboring mef genes. This is unusual, since it has been noted previously in GAS, and also in S. pneumoniae, that MICs for MLSB (ermB+) strains tend to be higher than those for strains with the M phenotype (14, 22). It was also interesting that 14 of 16 tetracycline-resistant strains were of the MLSB phenotype. In S. pneumoniae, Tn1545, which confers MLSB resistance through the presence of the ermB gene, also confers tetracycline resistance through the tetM gene (5). Future studies should examine whether MLSB resistance in GAS might also be transposon mediated. The fact that the ermTR strains in this study had 12 different PFGE patterns suggests that the gene may have spread by horizontal transfer to strains of different genetic backgrounds.
It is encouraging that the GAS strains in this study were uniformly
susceptible to penicillin and indeed that resistance to most
antimicrobials was nonexistent or extremely low. Resistance to
penicillin has not emerged in GAS despite extensive use of 
-lactam
drugs in many countries, and the reason for this is unknown (11). On the other hand, erythromycin resistance has
correlated with antibiotic usage both in Finland and in Japan, and
resistance was shown to decline when the use of macrolides was
restricted (8, 24). It is, therefore, important to continue
to monitor macrolide resistance rates on a national level so that if
prevalence rates begin to increase significantly, attempts to control
their use can be made.
| |
ACKNOWLEDGMENTS |
|---|
This work was funded in part by the Canadian Bacterial Diseases Network.
We thank the MDS Laboratory Service for providing the clinical isolates.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, 600 University Ave., Rm. 1483, Toronto, Ontario, Canada M5G 1X5. Phone: (416) 586-8549. Fax: (416) 586-8746. E-mail: jdeazavedo{at}mtsinai.on.ca.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 2. | Clancy, J., J. Petitpas, F. Dib-Hajj, W. Yuan, M. Cronan, A. V. Kamath, J. Bergeron, and J. A. Retsema. 1996. Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22:867-879[Medline]. |
| 3. | Cocuzza, C. E., R. Mattina, A. Mazzariol, G. Orefici, R. Rescaldani, A. Primavera, S. Bramati, G. Masera, F. Parizzi, G. Cornaglia, and R. Fontana. 1997. High incidence of erythromycin-resistant Streptococcus pyogenes in Monza (North Italy) in untreated children with symptoms of acute pharyngo-tonsillitis: an epidemiological and molecular study. Microb. Drug Resist. 3:371-378. [Medline] |
| 4. | Coonan, K. M., and E. L. Kaplan. 1994. In vitro susceptibility of recent North American group A streptococcal isolates to eleven oral antibiotics. Pediatr. Infect. Dis. J. 13:630-635[Medline]. |
| 5. | Courvalin, P., and C. Carlier. 1986. Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205:291-297[Medline]. |
| 6. | Courvalin, P., H. Ounissi, and M. Arthur. 1985. Multiplicity of macrolide-lincosamide-streptogramin antibiotic resistance determinants. J. Antimicrob. Chemother. 16(Suppl. A):91-100. |
| 7. | Dixon, J. M., and A. E. Lipinski. 1974. Infections with beta-hemolytic Streptococcus resistant to lincomycin and erythromycin and observations on zonal-pattern resistance to lincomycin. J. Infect. Dis. 130:351-356[Medline]. |
| 8. | Fujita, K., K. Murono, M. Yoshikawa, and T. Murai. 1994. Decline of erythromycin resistance of group A streptococci in Japan. Pediatr. Infect. Dis. J. 13:1075-1078[Medline]. |
| 9. | Goossens, H., S. Chapelle, M. Hauchecorne, M. Wijdooghe, and P. Descheemaeker. 1998. Characterization of macrolide resistance among group A Streptococcus in Belgium, abstr. C-14, p. 72. In Abstracts of the 38th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C. |
| 10. | Griffith, F. 1934. Serological classification of Streptococcus pyogenes. J. Hyg. (London) 34:542-584. (Abstract.) |
| 11. | Horn, D. L., J. B. Zabriskie, R. Austrian, P. P. Cleary, J. J. Ferretti, V. A. Fischetti, E. Gotschlich, E. L. Kaplan, M. McCarty, S. M. Opal, R. B. Roberts, A. Tomasz, and Y. Wachtfogel. 1998. Why have group A streptococci remained susceptible to penicillin? Report on a symposium. Clin. Infect. Dis. 26:1341-1345[Medline]. |
| 12. | Hsueh, P. R., H. M. Chen, A. H. Huang, and J. J. Wu. 1995. Decreased activity of erythromycin against Streptococcus pyogenes in Taiwan. Antimicrob. Agents Chemother. 39:2239-2242[Abstract]. |
| 13. |
Jasir, A., and C. Schalen.
1998.
Survey of macrolide resistance phenotypes in Swedish clinical isolates of Streptococcus pyogenes.
J. Antimicrob. Chemother.
41:135-137 |
| 14. |
Johnston, N. J.,
J. C. De Azavedo,
J. D. Kellner, and D. E. Low.
1998.
Prevalence and characterization of the mechanisms of macrolide, lincosamide, and streptogramin resistance in isolates of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:2425-2426 |
| 15. | Kataja, J., P. Huovinen, A. Muotiala, J. Vuopio-Varkila, A. Efstratiou, G. Hallas, the Finnish Study Group for Antimicrobial Resistance, and H. Seppala. 1998. Clonal spread of group A streptococcus with the new type of erythromycin resistance. J. Infect. Dis. 177:786-789[Medline]. |
| 16. |
Kataja, J.,
P. Huovinen,
M. Skurnik,
the Finnish Study Group for Antimicrobial Resistance, and H. Seppala.
1999.
Erythromycin resistance genes in group A streptococci in Finland.
Antimicrob. Agents Chemother.
43:48-52 |
| 17. |
Leclercq, R., and P. Courvalin.
1991.
Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification.
Antimicrob. Agents Chemother.
35:1267-1272 |
| 18. | Lopardo, H. A., M. E. Venuta, P. Vidal, L. Rosaenz, C. Corthey, A. Farinati, E. Couto, B. Sarachian, M. Sparo, S. Kaufman, C. A. De Mier, L. Gubbay, V. Scilingo, and P. Villaverde. 1997. Argentinian collaborative study on prevalence of erythromycin and penicillin susceptibility in Streptococcus pyogenes. The Argentinian Streptococcus Study Group. Diagn. Microbiol. Infect. Dis. 29:29-32. |
| 19. |
Maruyama, S.,
H. Yoshioka,
K. Fujita,
M. Takimoto, and Y. Satake.
1979.
Sensitivity of group A streptococci to antibiotics. Prevalence of resistance to erythromycin in Japan.
Am. J. Dis. Child.
133:1143-1145 |
| 20. |
Murray, B. E.,
K. V. Singh,
J. D. Heath,
B. R. Sharma, and G. M. Weinstock.
1990.
Comparison of genomic DNAs of different enterococcal isolates using restriction endonucleases with infrequent recognition sites.
J. Clin. Microbiol.
28:2059-2063 |
| 21. | National Committee for Clinical Laboratory Standards. 1998. Performance standards for antimicrobial susceptibility testing. M100-S8. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 22. | Perez-Trallero, E., M. Urbieta, M. Montes, I. Ayestaran, and J. M. Marimon. 1998. Emergence of Streptococcus pyogenes strains resistant to erythromycin in Gipuzkoa, Spain. Eur. J. Clin. Microbiol. Infect. Dis. 17:25-31[Medline]. |
| 23. |
Phillips, G.,
D. Parratt,
G. V. Orange,
I. Harper,
H. McEwan, and N. Young.
1990.
Erythromycin-resistant Streptococcus pyogenes.
J. Antimicrob. Chemother.
25:723-724 |
| 24. |
Seppala, H.,
T. Klaukka,
J. Vuopio-Varkila,
A. Muotiala,
H. Helenius,
K. Lager, and P. Huovinen.
1997.
The effect of changes in the consumption of macrolide antibiotics on erythromycin resistance in group A streptococci in Finland.
N. Engl. J. Med.
337:441-446 |
| 25. |
Seppala, H.,
M. Skurnik,
H. Soini,
M. C. Roberts, and P. Huovinen.
1998.
A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes.
Antimicrob. Agents Chemother.
42:257-262 |
| 26. |
Smith, A. M.,
K. P. Klugman,
T. J. Coffey, and B. G. Spratt.
1993.
Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.
Antimicrob. Agents Chemother.
37:1938-1944 |
| 27. | Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566[Abstract]. |
| 28. | Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824[Abstract]. |
| 29. |
Weisblum, B.
1985.
Inducible resistance to macrolides, lincosamides and streptogramin type B antibiotics: the resistance phenotype, its biological diversity, and structural elements that regulate expression a review.
J. Antimicrob. Chemother.
16(Suppl. A):63-90.
|
| 30. | Widdowson, C. A., and K. P. Klugman. 1998. Emergence of the M phenotype of erythromycin-resistant pneumococci in South Africa. Emerg. Infect. Dis. 4:277-281[Medline]. |
Antimicrobial Agents and Chemotherapy, September 1999, p. 2144-2147, Vol. 43, No. 9
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Smith, K., Ednie, L. M., Appelbaum, P. C., Hawser, S., Lociuro, S.
(2008). Antistreptococcal Activity of AR-709 Compared to That of Other Agents. Antimicrob. Agents Chemother.
52: 2279-2282
[Abstract] [Full Text] -
Luca-Harari, B., Ekelund, K., van der Linden, M., Staum-Kaltoft, M., Hammerum, A. M., Jasir, A.
(2008). Clinical and Epidemiological Aspects of Invasive Streptococcus pyogenes Infections in Denmark during 2003 and 2004. J. Clin. Microbiol.
46: 79-86
[Abstract] [Full Text] -
Bae, S. Y., Kim, J. S., Kwon, J.-A., Yoon, S.-Y., Lim, C. S., Lee, K. N., Cho, Y., Kim, Y. K., Lee, C. K.
(2007). Phenotypes and genotypes of macrolide-resistant Streptococcus pyogenes isolated in Seoul, Korea. J Med Microbiol
56: 229-235
[Abstract] [Full Text] -
Figueiredo, T. A., Aguiar, S. I., Melo-Cristino, J., Ramirez, M.
(2006). DNA Methylase Activity as a Marker for the Presence of a Family of Phage-Like Elements Conferring Efflux-Mediated Macrolide Resistance in Streptococci. Antimicrob. Agents Chemother.
50: 3689-3694
[Abstract] [Full Text] -
Robinson, D. A., Sutcliffe, J. A., Tewodros, W., Manoharan, A., Bessen, D. E.
(2006). Evolution and global dissemination of macrolide-resistant group a streptococci.. Antimicrob. Agents Chemother.
50: 2903-2911
[Abstract] [Full Text] -
Jing, H.-b., Ning, B.-a., Hao, H.-j., Zheng, Y.-l., Chang, D., Jiang, W., Jiang, Y.-q.
(2006). Epidemiological analysis of group A streptococci recovered from patients in China.. J Med Microbiol
55: 1101-1107
[Abstract] [Full Text] -
Gygax, S. E., Schuyler, J. A., Kimmel, L. E., Trama, J. P., Mordechai, E., Adelson, M. E.
(2006). Erythromycin and clindamycin resistance in group B streptococcal clinical isolates.. Antimicrob. Agents Chemother.
50: 1875-1877
[Abstract] [Full Text] -
Klaassen, C. H. W., Mouton, J. W.
(2005). Molecular Detection of the Macrolide Efflux Gene: To Discriminate or Not To Discriminate between mef(A) and mef(E). Antimicrob. Agents Chemother.
49: 1271-1278
[Full Text] -
Tyrrell, G. J., Lovgren, M., Kress, B., Grimsrud, K.
(2005). Invasive Group A Streptococcal Disease in Alberta, Canada (2000 to 2002). J. Clin. Microbiol.
43: 1678-1683
[Abstract] [Full Text] -
Ikebe, T., Hirasawa, K., Suzuki, R., Isobe, J., Tanaka, D., Katsukawa, C., Kawahara, R., Tomita, M., Ogata, K., Endoh, M., Okuno, R., Watanabe, H., the Working Group for Group A Streptococci in Japa,
(2005). Antimicrobial Susceptibility Survey of Streptococcus pyogenes Isolated in Japan from Patients with Severe Invasive Group A Streptococcal Infections. Antimicrob. Agents Chemother.
49: 788-790
[Abstract] [Full Text] -
Desjardins, M., Delgaty, K. L., Ramotar, K., Seetaram, C., Toye, B.
(2004). Prevalence and Mechanisms of Erythromycin Resistance in Group A and Group B Streptococcus: Implications for Reporting Susceptibility Results. J. Clin. Microbiol.
42: 5620-5623
[Abstract] [Full Text] -
Bingen, E., Bidet, P., Mihaila-Amrouche, L., Doit, C., Forcet, S., Brahimi, N., Bouvet, A., Cohen, R.
(2004). Emergence of Macrolide-Resistant Streptococcus pyogenes Strains in French Children. Antimicrob. Agents Chemother.
48: 3559-3562
[Abstract] [Full Text] -
Kim, S., Lee, N. Y.
(2004). Epidemiology and antibiotic resistance of group A streptococci isolated from healthy schoolchildren in Korea. J Antimicrob Chemother
54: 447-450
[Abstract] [Full Text] -
Hasenbein, M. E., Warner, J. E., Lambert, K. G., Cole, S. E., Onderdonk, A. B., McAdam, A. J.
(2004). Detection of Multiple Macrolide- and Lincosamide-Resistant Strains of Streptococcus pyogenes from Patients in the Boston Area. J. Clin. Microbiol.
42: 1559-1563
[Abstract] [Full Text] -
Heelan, J. S., Hasenbein, M. E., McAdam, A. J.
(2004). Resistance of Group B Streptococcus to Selected Antibiotics, Including Erythromycin and Clindamycin. J. Clin. Microbiol.
42: 1263-1264
[Abstract] [Full Text] -
Low, D. E., Pichichero, M. E., Schaad, U. B.
(2004). Optimizing Antibacterial Therapy for Community-Acquired Respiratory Tract Infections in Children in an Era of Bacterial Resistance. CLIN PEDIATR
43: 135-151
[Abstract] -
Betriu, C., Culebras, E., Rodriguez-Avial, I., Gomez, M., Sanchez, B. A., Picazo, J. J.
(2004). In Vitro Activities of Tigecycline against Erythromycin-Resistant Streptococcus pyogenes and Streptococcus agalactiae: Mechanisms of Macrolide and Tetracycline Resistance. Antimicrob. Agents Chemother.
48: 323-325
[Abstract] [Full Text] -
Katz, K. C., McGeer, A. J., Duncan, C. L., Ashi-Sulaiman, A., Willey, B. M., Sarabia, A., McCann, J., Pong-Porter, S., Rzayev, Y., de Azavedo, J. S., Low, D. E.
(2003). Emergence of Macrolide Resistance in Throat Culture Isolates of Group A Streptococci in Ontario, Canada, in 2001. Antimicrob. Agents Chemother.
47: 2370-2372
[Abstract] [Full Text] -
Ho, P. L., Johnson, D. R., Yue, A. W. Y., Tsang, D. N. C., Que, T. L., Beall, B., Kaplan, E. L.
(2003). Epidemiologic Analysis of Invasive and Noninvasive Group A Streptococcal Isolates in Hong Kong. J. Clin. Microbiol.
41: 937-942
[Abstract] [Full Text] -
Jones, H. E., Brenwald, N. P., Owen, K. A., Gill, M. J.
(2003). A multidrug efflux phenotype mutant of Streptococcus pyogenes. J Antimicrob Chemother
51: 707-710
[Abstract] [Full Text] -
Dicuonzo, G., Fiscarelli, E., Gherardi, G., Lorino, G., Battistoni, F., Landi, S., De Cesaris, M., Petitti, T., Beall, B.
(2002). Erythromycin-Resistant Pharyngeal Isolates of Streptococcus pyogenes Recovered in Italy. Antimicrob. Agents Chemother.
46: 3987-3990
[Abstract] [Full Text] -
Cresti, S., Lattanzi, M., Zanchi, A., Montagnani, F., Pollini, S., Cellesi, C., Rossolini, G. M.
(2002). Resistance Determinants and Clonal Diversity in Group A Streptococci Collected during a Period of Increasing Macrolide Resistance. Antimicrob. Agents Chemother.
46: 1816-1822
[Abstract] [Full Text] -
Gershon, A. S., de Azavedo, J. C. S., McGeer, A., Ostrowska, K. I., Church, D., Hoban, D. J., Harding, G. K. M., Weiss, K., Abbott, L., Smaill, F., Gourdeau, M., Murray, G., Low, D. E.
(2002). Activities of New Fluoroquinolones, Ketolides, and Other Antimicrobials against Blood Culture Isolates of Viridans Group Streptococci from across Canada, 2000. Antimicrob. Agents Chemother.
46: 1553-1556
[Abstract] [Full Text] -
Nagai, K., Appelbaum, P. C., Davies, T. A., Kelly, L. M., Hoellman, D. B., Andrasevic, A. T., Drukalska, L., Hryniewicz, W., Jacobs, M. R., Kolman, J., Miciuleviciene, J., Pana, M., Setchanova, L., Thege, M. K., Hupkova, H., Trupl, J., Urbaskova, P.
(2002). Susceptibility to Telithromycin in 1,011 Streptococcus pyogenes Isolates from 10 Central and Eastern European Countries. Antimicrob. Agents Chemother.
46: 546-549
[Abstract] [Full Text] -
Teng, L.-J., Hsueh, P.-R., Ho, S.-W., Luh, K.-T.
(2001). High Prevalence of Inducible Erythromycin Resistance among Streptococcus bovis Isolates in Taiwan. Antimicrob. Agents Chemother.
45: 3362-3365
[Abstract] [Full Text] -
de Azavedo, J. C. S., McGavin, M., Duncan, C., Low, D. E., McGeer, A.
(2001). Prevalence and Mechanisms of Macrolide Resistance in Invasive and Noninvasive Group B Streptococcus Isolates from Ontario, Canada. Antimicrob. Agents Chemother.
45: 3504-3508
[Abstract] [Full Text] -
Nagai, K., Davies, T. A., Ednie, L. M., Bryskier, A., Palavecino, E., Jacobs, M. R., Appelbaum, P. C.
(2001). Activities of a New Fluoroketolide, HMR 3787, and Its (Des)-Fluor Derivative RU 64399 Compared to Those of Telithromycin, Erythromycin A, Azithromycin, Clarithromycin, and Clindamycin against Macrolide-Susceptible or -Resistant Streptococcus pneumoniae and S. pyogenes. Antimicrob. Agents Chemother.
45: 3242-3245
[Abstract] [Full Text] -
Fluit, A. C., Visser, M. R., Schmitz, F.-J.
(2001). Molecular Detection of Antimicrobial Resistance. Clin. Microbiol. Rev.
14: 836-871
[Abstract] [Full Text] -
Fines, M., Gueudin, M., Ramon, A., Leclercq, R.
(2001). In vitro selection of resistance to clindamycin related to alterations in the attenuator of the erm(TR) gene of Streptococcus pyogenes UCN1 inducibly resistant to erythromycin. J Antimicrob Chemother
48: 411-416
[Abstract] [Full Text] -
Mitten, M. J., Meulbroek, J., Nukkala, M., Paige, L., Jarvis, K., Oleksijew, A., Tovcimak, A., Hernandez, L., Alder, J. D., Ewing, P., Or, Y. S., Ma, Z., Nilius, A. M., Mollison, K., Flamm, R. K.
(2001). Efficacies of ABT-773, a New Ketolide, against Experimental Bacterial Infections. Antimicrob. Agents Chemother.
45: 2585-2593
[Abstract] [Full Text] -
Jacobs, J. A., van Baar, G. J., London, N. H. H. J., Tjhie, J. H. T., Schouls, L. M., Stobberingh, E. E.
(2001). Prevalence of Macrolide Resistance Genes in Clinical Isolates of the Streptococcus anginosus (""S. milleri"") Group. Antimicrob. Agents Chemother.
45: 2375-2377
[Abstract] [Full Text] -
Weiss, K., De Azavedo, J., Restieri, C., Galarneau, L. A., Gourdeau, M., Harvey, P., Paradis, J. F., Salim, K., Low, D. E.
(2001). Phenotypic and genotypic characterization of macrolide-resistant group A Streptococcus strains in the province of Quebec, Canada. J Antimicrob Chemother
47: 345-348
[Abstract] [Full Text] -
Reig, M., Galan, J.-C., Baquero, F., Perez-Diaz, J. C.
(2001). Macrolide Resistance in Peptostreptococcus spp. Mediated by ermTR: Possible Source of Macrolide-Lincosamide-Streptogramin B Resistance in Streptococcus pyogenes. Antimicrob. Agents Chemother.
45: 630-632
[Abstract] [Full Text] -
Palavecino, E. L., Riedel, I., Berrios, X., Bajaksouzian, S., Johnson, D., Kaplan, E., Jacobs, M. R.
(2001). Prevalence and Mechanisms of Macrolide Resistance in Streptococcus pyogenes in Santiago, Chile. Antimicrob. Agents Chemother.
45: 339-341
[Abstract] [Full Text] -
Syrogiannopoulos, G. A., Grivea, I. N., Tait-Kamradt, A., Katopodis, G. D., Beratis, N. G., Sutcliffe, J., Appelbaum, P. C., Davies, T. A.
(2001). Identification of an erm(A) Erythromycin Resistance Methylase Gene in Streptococcus pneumoniae Isolated in Greece. Antimicrob. Agents Chemother.
45: 342-344
[Abstract] [Full Text] -
Kataja, J., Huovinen, P., The Macrolide Resistance Study Group, , Seppala, H.
(2000). Erythromycin resistance genes in group A streptococci of different geographical origins. J Antimicrob Chemother
46: 789-792
[Abstract] [Full Text] -
Betriu, C., Redondo, M., Palau, M. L., Sánchez, A., Gómez, M., Culebras, E., Boloix, A., Picazo, J. J.
(2000). Comparative In Vitro Activities of Linezolid, Quinupristin-Dalfopristin, Moxifloxacin, and Trovafloxacin against Erythromycin-Susceptible and -Resistant Streptococci. Antimicrob. Agents Chemother.
44: 1838-1841
[Abstract] [Full Text] -
Yan, J.-J., Wu, H.-M., Huang, A.-H., Fu, H.-M., Lee, C.-T., Wu, J.-J.
(2000). Prevalence of Polyclonal mefA-Containing Isolates among Erythromycin-Resistant Group A Streptococci in Southern Taiwan. J. Clin. Microbiol.
38: 2475-2479
[Abstract] [Full Text] -
Bingen, E., Fitoussi, F., Doit, C., Cohen, R., Tanna, A., George, R., Loukil, C., Brahimi, N., Le Thomas, I., Deforche, D.
(2000). Resistance to Macrolides in Streptococcus pyogenes in France in Pediatric Patients. Antimicrob. Agents Chemother.
44: 1453-1457
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»