This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pitzurra, L.
Right arrow Articles by Vecchiarelli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pitzurra, L.
Right arrow Articles by Vecchiarelli, A.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, September 1999, p. 2170-2175, Vol. 43, No. 9
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

A New Azole Derivative of 1,4-Benzothiazine Increases the Antifungal Mechanisms of Natural Effector Cells

Lucia Pitzurra,1 Renata Fringuelli,2 Stefano Perito,1 Fausto Schiaffella,2 Roberta Barluzzi,1 Francesco Bistoni,1 and Anna Vecchiarelli1,*

Microbiology Section, Department of Experimental Medicine and Biochemical Sciences,1 and the Institute of Drug Chemistry and Technology,2 University of Perugia, Perugia, Italy

Received 24 February 1999/Returned for modification 30 March 1999/Accepted 15 June 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The most widely used drug for treatment of candidiasis is fluconazole (FCZ). Recently, a new derivative of 1,4-benzothiazine, compound FS5, was developed. FS5 had an appreciable protective effect against murine candidiasis. The present study was designed to dissect the antifungal mechanisms triggered by FS5 and to establish whether this compound could enhance the antimicrobial abilities of natural effector cells. The results show that intraperitoneal injection of FS5 in mice (i) induced an increase in circulating neutrophil levels comparable to that observed in FCZ-treated mice; (ii) enhanced phagocytosis and the killing activities of macrophages (Mphi s) isolated from the spleen or peritoneal cavity, with the latter effect correlating with induction of nitric oxide synthesis and production by Mphi s; and (iii) increased the levels of expression and synthesis of tumor necrosis factor alpha. These results suggest that the compound-induced synthesis of antimicrobial and proinflammatory molecules by heterogeneous Mphi populations is part of the beneficial effect of FS5 exerted against murine candidiasis.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Opportunistic fungal infections represent a significant cause of morbidity and mortality in immunocompromised patients, including those with AIDS, cancer, and organ transplants (3, 6, 11, 14, 34). Despite the increase in fungal infections, therapeutic options are very limited and are often unsatisfactory because of elevated toxicity and an inability to eradicate infections (35, 43). Despite treatment with antifungal agents such as fluconazole (FCZ) and amphotericin B, the mortality rate associated with systemic Candida albicans infection is greater than 50% (18, 42).

The interaction of the host with the infecting pathogen has clearly defined the course of systemic C. albicans disease. Activated macrophages (Mphi s) play a primary role in the host defense against fungi. Several investigators have documented the importance of Mphi activation for efficient fungistatic and fungicidal activity (22, 38). The activation of immunoeffectors may also be sustained by antifungal agents such as amphotericin B or azole compounds (4, 13, 15, 26, 29, 30, 36, 40). Moreover, it has been reported that azole compounds and phagocytic cells have synergy for the killing of C. albicans and Candida species (13, 15).

The synthesis and antifungal activities of 1,4-benzothiazine derivatives for evaluation of the effect of substitution of the aromatic ring with the 1,4-benzothiazine nucleus, which shows some antifungal activity when it is part of FCZ- and miconazole-like analogues, have recently been reported (12). Of these derivatives, 7-[1-[(4-chlorobenzyl)oxy]-2-(1H-1-imidazolyl)ethyl]-4-methyl-3,4-dihydro-2H-1,4-benzothiazin-3-one (FS5) shows good efficacy against systemic candidiasis in a murine experimental model (12). In particular, compound FS5 exhibited poor antifungal activity in vitro against C. albicans compared with that of FCZ. However, a marked antifungal effect was observed in a murine model of fatal candidiasis (12). This study was designed to evaluate whether the observed FS5-mediated anti-Candida effect could be due to the immunopotentiating properties of professional phagocytes such as Mphi s. For this purpose, the effector and secretory functions of Mphi s from FS5-treated mice were evaluated. The results showed that compound FS5 promotes the intracellular antifungal activities of Mphi s in different anatomical districts and induces synthesis of tumor necrosis factor alpha (TNF-alpha ) and nitric oxide (NO) secretion. Our results suggest that the beneficial effect of FS5 observed in vivo could be a consequence of direct toxicity against the fungus and the indirect effect ascribed to induction of synthesis of immune molecules involved in the antifungal activities of professional phagocytes.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Mice. Female CD1 mice (age, 8 to 10 weeks; weight, 25 to 30 g) were obtained from Charles River Breeding Laboratories (Calco, Milan, Italy). For the in vitro assays, effector cells from three to five animals were pooled.

C. albicans. C. albicans CA-6, which was used throughout this study, was isolated from a vaginal swab (8) and was identified by the taxonomic criteria of van Uden and Buckley (37) as described previously (8). The yeast was grown at 28°C in Sabouraud dextrose agar. Under these conditions the organism grew as an essential pure yeast-phase population. Before use, yeast cells were harvested from a 24-h culture, suspended in pyrogen-free saline, washed twice, quantified by hemocytometry, and adjusted to the desired concentration. C. albicans cells were heat inactivated by autoclaving at 121°C for 15 min for experiments requiring killed C. albicans cells. Live or killed C. albicans cells were unopsonized prior to use for experimentation.

Chemicals. The FS5 derivative was solubilized in dimethyl sulfoxide and was diluted with sterile, pyrogen-free water (ratio 1:4) to stock concentrations of 1,000 µg/ml. FCZ (Pfizer Pharmaceuticals) was dissolved in sterile, pyrogen-free water to stock concentrations of 1,000 µg/ml. Stock solutions, sterilized by filtration and protected from light, were stored at 4°C until use. The chemicals had <0.25 EU/ml by the Limulus amebocyte lysate assay (BioWhittaker, Walkersville, Md.).

In vivo studies. (i) Systemic candidiasis model. Mice were infected intravenously (i.v.) with 2 × 105 C. albicans blastoconidia via the lateral tail vein. Diluent (dimethyl sulfoxide and H2O; ratio, 1:4) or chemicals (FS5 and FCZ) were administered intraperitoneally (i.p.) at a dose of 10 mg/kg of body weight 2 h before infection and then daily for 7 consecutive days. The dose and administration schedules used in this study were chosen from previously reported data (12) and were based on the dose and treatment schedules reported in the literature for a novel azole with a broad antifungal spectrum, such as ER-30346 (16) and voriconazole (17, 35). For survival studies, mice were observed through day 60. Three mice per group were killed by CO2 asphyxiation 8 days after infection for quantitative culture of both kidneys.

(ii) Quantitation of C. albicans in the kidneys. The kidneys of mice were aseptically removed and were homogenized with 3 ml of sterile distilled water. The number of CFU was determined by a plate dilution method of Sabouraud dextrose agar as described previously (4). Colonies of C. albicans cells were counted after 48 h of incubation at room temperature, and the results were expressed as the number of CFU per organ.

In vitro studies. (i) Susceptibility testing. Susceptibility testing was performed by the M27-A microdilution method of the National Committee for Clinical Laboratory Standards (27) in 0.165 M MOPS (morpholinepropanesulfonic acid)-buffered (pH 7) RPMI 1640 medium (Gibco BRL, Paisley, United Kingdom). The activity of compound FS5 or FCZ against C. albicans was tested by using serial twofold dilutions ranging from 0.9 to 500 µg/ml. The MIC was the lowest concentration of chemical that produced an 80% reduction in the turbidity compared to that for the chemical-free control (27, 31). In selected experiments the activity of sera from untreated or chemical-treated mice against C. albicans was tested by using serial twofold dilutions of sera ranging from 2 to 1,024. Growth reduction was estimated spectrophotometrically as described previously (31).

(ii) Peritoneal and splenic Mphi s. After in vivo treatment with chemicals, on day 8 peritoneal and splenic Mphi s were collected from five animals in each experimental group. Peritoneal Mphi s were harvested by rinsing the exposed peritoneal cavity with RPMI 1640 medium, and splenic Mphi s were isolated from aseptically removed spleens, minced by homogenization, and then filtered on sterile gauze. Both cell populations were washed three times with RPMI 1640 medium to which 10% fetal calf serum was added and which was supplemented with 2 mM L-glutamine (Sigma) and penicillin-streptomycin (50 IU and 50 µg/ml, respectively) (cRPMI), quantified by hemocytometry, and allowed to adhere to 90-mm tissue culture plates. After 2 h of incubation in 5% CO2 at 37°C, the plates were washed with cRPMI to remove nonaderent cells. Mphi s were recovered with a cell scraper, washed three times, suspended in cRPMI, counted, and adjusted to the desired concentrations. The adherent cells were >98% viable, as evaluated by trypan blue dye exclusion, and at least 95% were macrophages, as determined by Wright-Giemsa staining. Peritoneal and splenic Mphi s were used immediately for in vitro studies.

(iii) Phagocytosis of C. albicans by peritoneal or splenic Mphi s. Assessment of immune cell phagocytic activity against heat-inactivated C. albicans yeast cells was done as described previously (39). Briefly, phagocytic cells (2 × 106) resuspended in cRPMI were incubated for 1 h at 37°C in 5% CO2 with target particles at an effector-to-target (E:T) cell ratio of 1:10. After ingestion the unbound microorganisms were removed by centrifugation of the cell suspension on a Ficoll cushion at 400 × g for 10 min. The cells at the interface were recovered and washed. C. albicans uptake was directly evaluated in Giemsa-stained cytospin preparations. A minimum of 200 cells was microscopically scored. The percentage of phagocytosis was defined as the percentage of Mphi s with one or more ingested yeast cells. Four determinations were made in duplicate, and these were used to calculate the mean I standard error (SE) percentage of phagocytosis.

(iv) Inhibition of C. albicans growth by peritoneal or splenic Mphi s. Anti-Candida activity was evaluated by comparing the percentage of viable yeasts incubated in the presence of effector cells (peritoneal or splenic Mphi s) with control growth in the absence of effector cells. Viable yeasts were determined by a quantitative pour plate assay (4). Briefly, effector cells were plated at different concentrations (0.1 ml per well) in 96-well plates (Corning Glass Works, Corning, N.Y.) and were infected with 0.1 ml of viable C. albicans (5 × 104 per ml). After 4 h of incubation at 37°C under 5% CO2, Triton X-100 (final concentration, 0.1%) was added to the wells and the plates were shaken vigorously. Serial dilutions from each well were made in distilled water, and the dilutions were plated on Sabouraud dextrose agar. The colonies of C. albicans were counted after 24 h at 37°C. The results were expressed as the percent reduction of CFU by the following formula: 100 - [(CFU in experimental group/CFU in control cultures) × 100].

(v) Nitrate assay and TNF-alpha quantification. Peritoneal or splenic Mphi s (106/well) were cultured in 96-well plates (Corning) in cRPMI with or without stimuli as described previously (9). Culture supernatants were collected after 24 h of culture. The nitrate concentration in the supernatants was assayed by the Griess reaction adapted for microplates (5). The concentration of TNF-alpha in the supernatants was quantified by the L-929 cytotoxic bioassay as described previously (33). The L-929 cytotoxicity of the supernatants was completely abrogated with polyclonal TNF-alpha antibody (Genzyme), confirming that the bioassay specifically measured TNF-alpha . Each sample was run in duplicate, and the results were averaged.

RNA extraction and reverse transcriptase (RT) PCR. Total RNA was isolated from Mphi s by established procedures (2). For each experiment, equivalent amounts of intact RNA (5 µg) were reverse transcribed as described previously (2). Equivalent amounts of cDNA in 5-µl aliquots were amplified by PCR in a reaction mixture containing 6.5 µl of double-distilled sterile water, 3.2 µl of 10× PCR buffer (Pharmacia, Uppsala), 3.2 µl of 1.25 mM deoxynucleoside triphosphates (Promega), 1 µl each of 3' and 5' primers (final concentration, 25 pM; Promega), and 0.1 µl of Taq polymerase (5 U/µl; Pharmacia). Each cycle consisted of denaturation at 94°C for 1 min, annealing at 60°C (for GAPDH and TNF-alpha ) or 65°C (for iNOS) for 1 min, and extension at 72°C for 1 min. Amplification was repeated for 30 cycles in a Perkin-Elmer Cetus DNA thermal cycler. Ten microliters of each of the PCR amplification products was separated on an ethidium bromide-stained 1.5% agarose gel, and the fragments were visualized by UV transillumination. Densitometric analysis was performed with a Gel Doc 1000 densitometer (Bio-Rad Laboratories, Hercules, Calif.), and relative peak areas were expressed in arbitrary densitometric units as described previously (2). Aliquots of 0.05 µg of phi X174 replicative-form DNA-HaeIII-digested fragments (New England BioLabs, Beverly, Mass.) were run in parallel as molecular size markers. The amplified bands were of the predicted sizes. Cytokine-specific primers were DNA specific and were nonreactive with RNA. The following 5' and 3' oligonucleotide primer sequences were used: for TNF-alpha , AGCCCACGTCGTAGCAAACCACCAA and ACACCCATTCCCTTCACAGAGCAAT; for iNOS, CCCTTCCGAAGTTTCTGGCAGCAGC and GGCTGTCAGAGCCTCGTGGCTTTG; and for GAPDH, CCTTCATTGACCTCAACTACATGG and AGTCTTCTGGGTGGCAGTGATGG.

Positive control DNAs for each cytokine were obtained from Clontech Laboratories (Palo Alto, Calif.), while negative controls consisted of samples in which (i) RNA was replaced by diethylpyrocarbonate plus distilled water, (ii) the RT was omitted to detect any contamination by previously amplified cDNA, and (iii) the primers were not added.

Statistical analysis. Differences in median survival time were determined by the Mann-Whitney U test (28). Student's t test was used to evaluate the significance of all other data. Each experiment was repeated three to five times.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Experiments were performed to examine the ability of FS5 compound to cure systemic Candida infection. Mice were injected i.p. with FS5 or FCZ 2 h before C. albicans infection and 1 to 7 days postinfection; survival was observed through day 60. Increased survival time and organism counts in kidney tissues 8 days after infection were used as indicators of treatment efficacy. As shown in Fig. 1, all control mice infected i.v. with C. albicans died by day 28. The administration of compound FS5 prolonged the median survival time from 12 to >60 days, with 52% survivors (Fig. 1). As expected, FCZ treatment induced protection in 80% of mice (Fig. 1). A consistent reduction of C. albicans growth was observed in the kidneys of FS5-treated mice compared with the growth for the untreated controls (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1.   Effect of i.p. FS5 and FCZ administration on survival of mice infected i.v. with C. albicans (2 × 105). FS5 and FCZ were administered i.p. (10 mg/kg) 2 h before challenge and daily for 7 consecutive days. The rates of survival of FS5- or FCZ-treated-mice mice were significantly higher than that of diluent-treated mice from day 8 (P < 0.05 to day 60). Ten mice per group were used in each experiment. The figure represents pooled data from five experiments.

Under our experimental conditions, the MIC of compound FS5 was 46 µg/ml (Fig. 2A). This MIC was significantly higher than that of FCZ (<0.9 µg/ml). However, it has been reported that the in vitro antifungal effect does not necessarily correlate with in vivo activity (1, 31, 32). Consistent with this premise, sera from FS5- or FCZ-treated mice, collected 3 h after the last administration, showed similar anti-Candida activity (Fig. 2B). In contrast, sera collected 72 h after the last administration of FS5 or FCZ showed no differences in anti-Candida activity compared with the activity of sera from untreated controls (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2.   Effect of FS5 or FCZ on C. albicans (CA) growth. (A) MICs of FS5 and FCZ determined as described in Materials and Methods. (B) Percentage of inhibition of C. albicans (CA) growth by sera from diluent-, FS5-, or FCZ-treated mice. FS5 and FCZ were administered i.p. (10 mg/kg) daily for 7 consecutive days. Sera were collected 3 h after the last administration. The results represent the means ± SEs of four separate experiments. *, P < 0.05 (for FS- or FCZ-treated mice versus untreated mice).

An increase in the peripheral leukocyte (WBC) count in mice treated with antifungal agents has been observed (20). In agreement with previous reports, the administration of FCZ significantly increased the WBC count in murine blood, and a similar effect was observed for FS5. The increase in the WBC count correlated with a significant increase in the percentage of professional phagocytes, such as neutrophils (data not shown). Given the increased antimicrobial activity of phagocytic cells induced by antifungal agents (4, 13, 15, 19, 26, 30, 36, 40, 41), we evaluated whether FS5 regulates the anti-Candida activity of Mphi s. Significant enhancement of phagocytic and killing activities of Mphi s from different anatomical districts was observed. As shown in Fig. 3, peritoneal Mphi s (Fig. 3A) as well as splenic Mphi s (Fig. 3B) from FS5- or FCZ-treated mice showed marked increases in candidacidal activity compared with those from untreated mice, reaching a maximum at an E:T ratio of 10:1. Similarly, phagocytosis was increased (Fig. 3C) in terms of the phagocytosis index (Fig. 3D).


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 3.   Effect of FS5 administration on candidacidal activity of peritoneal (A) or splenic (B) Mphi s. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then peritoneal and splenic Mphi s were harvested and tested for their anticandidal activities. Candidacidal activity was evaluated against live C. albicans at different E:T ratios. (C) Percentage of phagocytic cells that ingested 1 or more killed C. albicans yeasts of 200 cells counted. (D) Average number of C. albicans cells ingested by phagocytic cells (phagocytic index). The results represent the means ±SEs of four separate experiments. *, P < 0.001 (for FS5- or FCZ-treated mice versus untreated mice).

Efficient killing of C. albicans by mononuclear phagocytes requires production of respiratory burst-associated toxic compounds (22). Recent data suggest that NO synthesis may also be included among the anticandidal mechanisms of Mphi s (5, 9). Thus, NO synthesis and production by splenic and peritoneal Mphi s from FS5-treated mice were evaluated as nitrite concentration and mRNA expression.

Under our experimental conditions, (i) peritoneal and splenic Mphi s from FS5- or FCZ-treated mice stimulated in vitro with lipopolysaccharide (LPS) plus C. albicans had a higher rate of NO secretion than Mphi s from untreated mice (Fig. 4A and 4C); (ii) NO production by peritoneal and splenic Mphi s from FS5-treated mice was similar to that observed by Mphi s from FCZ-treated mice (Fig. 4A and C); and (iii) peritoneal Mphi s had enhanced production of NO compared with that by splenic Mphi s. These results were confirmed by analysis of iNOS mRNA expression by RT-PCR (peritoneal Mphi , Fig. 4B; splenic Mphi , Fig. 4D).


View larger version (35K):
[in this window]
[in a new window]
 
FIG. 4.   Effect of FS5 administration on NO production from peritoneal (A and B) or splenic (C and D) Mphi s. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then the Mphi s were harvested and tested for NO as nitrate secretion or iNOS mRNA expression. Nitrate secretion in the supernatants of peritoneal (A) or splenic (C) Mphi s that were unstimulated (None) or stimulated with LPS (10 ng/ml) plus C. albicans (LPS + CA; E:T ratio, 1:1) was determined. iNOS mRNA expression was determined by RT-PCR (B and D) as described in Materials and Methods. Mphi s stimulated with LPS or C. albicans alone did not affect NO production with respect to the NO production of unstimulated cells (None). The results represent the means ± SEs of four separate experiments. *, P < 0.001 (for FS5- or FCZ-treated versus untreated mice).

Mphi s produce TNF-alpha , which enhances the Mphi s' anti-Candida activity (38), raising the possibility that compound FS5 could contribute to Mphi activation, which would affect cytokine secretion. For this purpose, TNF-alpha production by peritoneal and splenic Mphi s from FS5-treated mice was examined as cytokine secretion or mRNA expression (Fig. 5). A significant increase in the level of TNF-alpha production by peritoneal or splenic Mphi s from FS5- or FCZ-treated mice compared with the levels produced by Mphi s from untreated mice was observed (Fig. 5A and 5C). The amounts of TNF-alpha produced by immune cells from FS5- or FCZ-treated mice were similar. This was supported by increased mRNA expression by TNF-alpha (Fig. 5B and D). Treatment with FS5 or FCZ induced an effect on Mphi s similar to that of promoters of TNF-alpha synthesis and secretion.


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 5.   Effect of i.p. FS5 administration on TNF-alpha production from peritoneal (A) or splenic (C) Mphi s. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then peritoneal and splenic Mphi s were harvested and tested for TNF-alpha as secreted cytokine or mRNA expression. TNF-alpha secretion in the supernatants of peritoneal (A) or splenic (C) Mphi s unstimulated (None) or stimulated with LPS (10 ng/ml) plus C. albicans (LPS + CA; E:T ratio, 1:1) was determined. TNF-alpha mRNA expression was determined by RT-PCR (B and D) as described in Materials and Methods. The results represent the means ± SEs of five separate experiments. *, P < 0.001 (for FS5- or FCZ-treated versus untreated mice).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The results reported here show that the FS5 azole derivative of 1,4-benzothiazine significantly prolongs the survival and decreases the kidney fungal burden of mice systemically infected with C. albicans. This new antifungal agent appears to work in vivo as a toxic agent against C. albicans and as a promoter of antifungal mechanisms in natural immune cells. The latter effect is the result of (i) a consistent increase in the percentage of circulating professional phagocytes, (ii) enhanced serum fungistatic activity, (iii) the increased capacity of Mphi s to ingest and kill C. albicans yeast cells, and (iv) enhanced synthesis and secretion of nitrogen-reactive intermediates and TNF-alpha at levels comparable to that obtained with FCZ.

In a previous study we demonstrated that FS compounds exhibit an appreciable level of protection in murine candidiasis (12). Of eight newly synthesized azole derivatives, the ether derivative FS5 is the most active (12). As observed previously, FS5 has an inhibitory effect on C. albicans growth in vitro. Here we report that its beneficial effect in murine candidiasis could be due to the synergy of its direct toxic effects against C. albicans and its capability to enhance the antimicrobial activities of natural effector cells. The increased anti-Candida activity in FS5-treated mice correlated with enhanced phagocytosis and NO production. Thus, enhanced intracellular killing involving NO should be considered an antifungal mechanism induced by FS5. This hypothesis is supported by previous observations showing that an increase in the level of inducible Mphi NO synthase correlates with anti-Candida activity (9, 38).

At present the pharmacokinetic and pharmacodynamic patterns of FS5 in a murine model are not available. However, preliminary data on its toxicity showed that the tolerance of mice exposed to this new drug was excellent.

The combined activities of azoles, such as voriconazole, with polymorphonuclear neutrophils or monocytes against C. albicans have been reported, but the mechanisms involved are unknown (41). Here we describe a new effect of FCZ, as an inducer of NO production by Mphi s. The induction of NO production is a possible explanation for the observed collaboration between FCZ and phagocytic cells, which results in the enhancement of anti-Candida activity (41). A similar effect was observed with our new azole derivative in the cure of murine systemic candidiasis.

Despite the similar candidacidal activities, significant differences in NO production were observed in peritoneal and splenic Mphi s, which could reflect differences in the production or utilization of NO by heterogeneous Mphi s, thus implying that phagocytes from different anatomical districts have different behaviors depending on microenvironmental conditions. This is not surprising, as previous findings have shown that phagocytes from different anatomical districts could have different antifungal potentials (10).

A lack of correlation between the in vitro and in vivo effects of antifungal agents has been observed (1, 31, 32, 35). Although FS5 had a beneficial effect against murine candidiasis, a scarce anti-Candida effect was observed in vitro, as determined from the MICs. This apparent discrepancy could be attributed to the fact that FS5 is metabolized to an active antifungal compound and may have in vivo activity through immune-enhancing and direct antifungal effects.

Given the appreciable beneficial effect of FS5 in the treatment of fungal infections, it is reasonable to speculate that the effect could be improved by using FS5 in combination with exogenous NO, cytokines, or a monoclonal antibody to the fungus, as described for other azoles and fungi (7, 23-26, 41).

TNF-alpha has also been proposed to be an inducer of C. albicans killing of Mphi s (21). More importantly, the beneficial effect of endogenous TNF-alpha in antifungal therapy with FCZ and amphotericin B in a murine model of fatal candidiasis has been reported (20). Thus, the enhanced production of TNF-alpha observed in cells from FS5- or FCZ-treated mice could contribute to the therapeutic efficacies of these drugs against systemic candidiasis.

Our data indicate that the efficacy of FS5 in the treatment of murine candidiasis may be related to a direct effect on C. albicans and may be via induction of potent antifungal molecules such as NO and TNF-alpha . This new azole derivative appears to be a promising contribution to new therapeutic strategies for the treatment of Candida infections.


    ACKNOWLEDGMENTS

We are grateful to Eileen Mahoney Zannetti for excellent editorial assistance.

This study was supported by the National Research Project on AIDS ("Opportunistic Infections and Tuberculosis" contract 50B.39) of Italy.


    FOOTNOTES

* Corresponding author. Mailing address: Microbiology Section, Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Via del Giochetto, 06122 Perugia, Italy. Phone: 39-075-585-3407. Fax: 39-075-585-3400. E-mail: vecchiar{at}unipg.it.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Anaissie, E. J., N. C. Karyotakis, R. Hachem, M. C. Dignani, J. H. Rex, and V. Paetznick. 1994. Correlation between in vitro and in vivo activity of antifungal agents against Candida species. J. Infect. Dis. 170:384-389[Medline].
2. Barluzzi, R., R. Mazzolla, A. Brozzetti, M. Puliti, G. Mariucci, P. Mosci, F. Bistoni, and E. Blasi. 1997. A low virulent strain of C. albicans enhances brain anticryptococcal defenses: characterization of the local immune reaction by RT-PCR and histochemical analysis. J. Neuroimmunol. 79:37-48[Medline].
3. Beck-Sague, C., and W. R. Jarvis. 1993. Secular trends in the epidemiology of nosocomial fungal infections in the United States, 1980-1990. National Nosocomial Infections Surveillance System. J. Infect. Dis. 167:1247-1251[Medline].
4. Bistoni, F., A. Vecchiarelli, R. Mazzolla, P. Puccetti, P. Marconi, and E. Garaci. 1985. Immunoadjuvant activity of amphotericin B as displayed in mice infected with Candida albicans. Antimicrob. Agents Chemother. 27:625-631[Abstract/Free Full Text].
5. Blasi, E., L. Pitzurra, M. Puliti, A. R. Chimienti, R. Mazzolla, R. Barluzzi, and F. Bistoni. 1995. Differential susceptibility of yeast and hyphal forms of Candida albicans to macrophage-derived nitrogen-containing compounds. Infect. Immun. 63:1806-1809[Abstract].
6. Bodey, G. P. 1966. Fungal infections complicating acute leukemia. J. Chronic Dis. 19:667-687[Medline].
7. Casadevall, A., W. Cleare, M. Feldmesser, A. Glatman-Freedman, D. L. Goldman, T. R. Kozel, N. Lendvai, J. Mukherjee, L. A. Pirofski, J. Rivera, A. L. Rosas, M. D. Scharff, P. Valadon, K. Westin, and T. Zhong. 1998. Characterization of a murine monoclonal antibody to Cryptococcus neoformans polysaccharide that is a candidate for human therapeutic studies. Antimicrob. Agents Chemother. 42:1437-1446[Abstract/Free Full Text].
8. Cassone, A., P. Marconi, F. Bistoni, E. Mattia, G. Sbaraglia, E. Garaci, and E. Bonmassar. 1981. Immunoadjuvant effects of Candida albicans and its cell wall fractions in a mouse lymphoma model. Cancer Immunol. Immunother. 10:181-190.
9. Cenci, E., L. Romani, A. Mencacci, R. Spaccapelo, E. Schiaffella, P. Puccetti, and F. Bistoni. 1993. Interleukin-4 and interleukin-10 inhibit nitric oxide-dependent macrophage killing of Candida albicans. Eur. J. Immunol. 23:1034-1038[Medline].
10. Decker, T., M.-L. Lohmann-Matthes, and M. Baccarini. 1986. Heterogeneous activity of immature and mature cells of the murine monocyte-macrophage lineage derived from different anatomical districts against yeast-phase Candida albicans. Infect. Immun. 54:477-486[Abstract/Free Full Text].
11. Fisher-Hoch, S. P., and L. Hutwagner. 1995. Opportunistic candidiasis: an epidemic of the 1980s. Clin. Infect. Dis. 21:897-904[Medline].
12. Fringuelli, R., F. Schiaffella, F. Bistoni, L. Pitzurra, and A. Vecchiarelli. 1998. Azole derivatives of 1,4-benzothiazine as antifungal agents. Bioorg. Med. Chem. 6:103-108[Medline].
13. Garcha, U. K., E. Brummer, and D. A. Stevens. 1995. Synergy of fluconazole with macrophages for antifungal activity against Candida albicans. Mycopathologia 132:123-128[Medline].
14. Georgopapadakou, N. H., and T. J. Walsh. 1996. Antifungal agents: chemotherapeutic targets and immunologic strategies. Antimicrob. Agents Chemother. 40:279-291[Medline].
15. Gujral, S., E. Brummer, and D. A. Stevens. 1966. Role of extended culture time on synergy of fluconazole and human monocyte-derived macrophages for killing Candida species. J. Infect. Dis. 174:888-889.
16. Hata, K., J. Kimura, H. Miki, T. Toyosawa, T. Nakamura, and K. Katsu. 1996. In vitro and in vivo antifungal activities of ER-30346, a novel oral triazole with a broad antifungal spectrum. Antimicrob. Agents Chemother. 40:2237-2242[Abstract].
17. Hitchcock, C. A., G. W. Pye, G. P. Oliver, and P. F. Troke. 1995. UK-109,496, a novel, wide-spectrum triazole derivative for the treatment of fungal infections: antifungal activity and selectivity in vitro, abstr. F72, p. 125. In Program and abstracts of the 35th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C.
18. Komashian, S. V., A. K. Uwaydah, J. D. Sobel, and L. R. Crame. 1989. Fungemia caused by Candida species and Torulopsis glabrata in hospitalized patients: frequency, characteristics, and evaluation of factors influencing outcome. Rev. Infect. Dis. 11:379-390[Medline].
19. Louie, A., A. L. Baltch, M. A. Franke, R. P. Smith, and M. A. Gordon. 1994. Comparative capacity of four antifungal agents to stimulate murine macrophages to produce tumor necrosis factor alpha. An effect that is attenuated by pentoxifylline, liposomal vesicles, and dexamethasone. J. Antimicrob. Chemother. 34:975-987[Abstract/Free Full Text].
20. Louie, A., A. L. Baltch, and R. P. Smith. 1994. Tumor necrosis factor alpha has a protective role in a murine model of systemic candidiasis. Infect. Immun. 62:2761-2772[Abstract/Free Full Text].
21. Louie, A., A. L. Baltch, R. P. Smith, M. A. Franke, W. J. Ritz, J. K. Singh, and M. A. Gordon. 1995. Fluconazole and amphotericin B antifungal therapies do not negate the protective effect of endogenous tumor necrosis factor in a murine model of fatal disseminated candidiasis. J. Infect. Dis. 171:406-415[Medline].
22. Marodi, L., J. R. Forehand, and R. B. Johnston, Jr. 1991. Mechanisms of host defense against Candida species. II. Biochemical basis for the killing of Candida by mononuclear phagocytes. J. Immunol. 146:2790-2794[Abstract].
23. Marodi, L., C. Tournay, R. Kaposzta, R. B. Johnston, Jr., and N. Moguilevsky. 1998. Augmentation of human macrophage candidacidal capacity by recombinant human myeloperoxidase and granulocyte-macrophage colony-stimulating factor. Infect. Immun. 66:2750-2754[Abstract/Free Full Text].
24. McElhaney-Feser, G. E., R. E. Raulli, and R. L. Cihlar. 1998. Synergy of nitric oxide and azoles against Candida species in vitro. Antimicrob. Agents Chemother. 42:2342-2346[Abstract/Free Full Text].
25. Mukherjee, J., M. Feldmesser, M. D. Scharff, and A. Casadevall. 1995. Monoclonal antibodies to Cryptococcus neoformans glucuronoxylomannan enhance fluconazole efficacy. Antimicrob. Agents Chemother. 39:1398-1405[Abstract].
26. Natarajan, U., N. Randhawa, E. Brummer, and D. A. Stevens. 1998. Effect of granulocyte-macrophage colony-stimulating factor on candidacidal activity of neutrophils, monocytes or monocyte-derived macrophages and synergy with fluconazole. J. Med. Microbiol. 47:359-363[Abstract/Free Full Text].
27. National Committee for Clinical Laboratory Standards. 1997. Reference method for broth dilution antifungal susceptibility testing of yeasts. Approved standard. NCCLS document M27-A. National Committee for Clinical Laboratory Standards, Wayne, Pa.
28. Norman, G. R., and D. L. Streiner. 1986. Non-parametric statistics, p. 79-82. In PDQ statistics. B. C. Decker Inc., Toronto, Ontario, Canada.
29. Nosanchuk, J. D., W. Cleare, S. P. Franzot, and A. Casadevall. 1999. Amphotericin B and fluconazole affect cellular charge, macrophage phagocytosis, and cellular morphology of Cryptococcus neoformans at subinhibitory concentrations. Antimicrob. Agents Chemother. 43:233-239[Abstract/Free Full Text].
30. Perfect, J. R., D. L. Granger, and D. T. Durack. 1987. Effects of antifungal agents and gamma interferon on macrophage cytotoxicity for fungi and tumor cells. J. Infect. Dis. 156:316-323[Medline].
31. Rex, J. H., P. W. Nelson, V. L. Paetznick, M. Lozano-Chiu, A. Espinel-Ingroff, and E. J. Anaissie. 1998. Optimizing the correlation between results of testing in vitro and therapeutic outcome in vivo for fluconazole by testing critical isolates in a murine model of invasive candidiasis. Antimicrob. Agents Chemother. 42:129-134[Abstract/Free Full Text].
32. Rex, J. H., M. A. Pfaller, J. N. Galgiani, M. S. Bartlett, A. Espinel-Ingroff, M. A. Ghannoum, M. Lancaster, F. C. Odds, M. G. Rinaldi, T. J. Walsh, A. L. Barry, and Subcommittee on Antifungal Susceptibility Testing of the National Committee for Clinical Laboratory Standards. 1997. Development of interpretative breakpoints for antifungal susceptibility testing: conceptual framework and analysis of in vitro-in vivo correlation data for fluconazole, itraconazole, and Candida infections. Clin. Infect. Dis. 24:235-247[Medline].
33. Rubin, B. Y., S. L. Anderson, S. A. Sullivan, B. D. Williamson, E. A. Carswell, and L. J. Old. 1985. Purification and characterization of a human tumor necrosis factor from the LuKII cell line. Proc. Natl. Acad. Sci. USA 82:6637-6641[Abstract/Free Full Text].
34. Schroter, G. P. J., M. Hoelscher, C. W. Putman, K. A. Porter, and T. E. Starzl. 1977. Fungus infections after liver transplantation. Ann. Surg. 186:115-122[Medline].
35. Sheehan, D. J., A. C. Hitchcock, and C. M. Sibley. 1999. Current and emerging azole antifungal agents. Clin. Microbiol. Rev. 12:40-79[Abstract/Free Full Text].
36. van Etten, E. W., N. E. van de Rhee, K. M. van Kampen, and I. A. Bakker-Woudenberg. 1991. Effects of amphotericin B and fluconazole on the extracellular and intracellular growth of Candida albicans. Antimicrob. Agents Chemother. 35:2275-2281[Abstract/Free Full Text].
37. van Uden, N., and H. Buckley. 1970. Candida Berkhout, p. 914. In J. Lodder (ed.), The yeasts: a taxonomic study. North-Holland Publishing Co., Amsterdam, The Netherlands.
38. Vazquez-Torres, A., and E. Balish. 1997. Macrophages in resistance to candidiasis. Microbiol. Mol. Biol. Rev. 61:170-192[Abstract].
39. Vecchiarelli, A., M. Dottorini, C. Cociani, D. Pietrella, T. Todisco, and F. Bistoni. 1993. Mechanism of intracellular candidacidal activity mediated by calcium ionophore in human alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 9:19-25.
40. Vecchiarelli, A., G. Verducci, S. Perito, P. Puccetti, P. Marconi, and F. Bistoni. 1986. Involvement of host macrophages in the immunoadjuvant activity of amphotericin B in a mouse fungal infection model. J. Antibiot. 39:846-855[Medline].
41. Vora, S., N. Purimetla, E. Brummer, and D. A. Stevens. 1998. Activity of voriconazole, a new triazole, combined with neutrophils or monocytes against Candida albicans: effect of granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor. Antimicrob. Agents Chemother. 42:907-910[Abstract/Free Full Text].
42. Wey, S. B., M. Mori, M. A. Pfaller, R. F. Woolson, and R. P. Wenzel. 1988. Hospital-acquired candidemia. The attributable mortality and excess length of stay. Arch. Intern. Med. 148:2642-2645[Abstract/Free Full Text].
43. White, T. C., K. A. Marr, and R. A. Bowden. 1998. Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11:382-402[Abstract/Free Full Text].


Antimicrobial Agents and Chemotherapy, September 1999, p. 2170-2175, Vol. 43, No. 9
0066-4804/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Rachini, A., Pietrella, D., Lupo, P., Torosantucci, A., Chiani, P., Bromuro, C., Proietti, C., Bistoni, F., Cassone, A., Vecchiarelli, A. (2007). An Anti-{beta}-Glucan Monoclonal Antibody Inhibits Growth and Capsule Formation of Cryptococcus neoformans In Vitro and Exerts Therapeutic, Anticryptococcal Activity In Vivo. Infect. Immun. 75: 5085-5094 [Abstract] [Full Text]  
  • Yeaman, M. R., Cheng, D., Desai, B., Kupferwasser, L. I., Xiong, Y.-Q., Gank, K. D., Edwards, J. E. Jr., Bayer, A. S. (2004). Susceptibility to Thrombin-Induced Platelet Microbicidal Protein Is Associated with Increased Fluconazole Efficacy against Experimental Endocarditis Due to Candida albicans. Antimicrob. Agents Chemother. 48: 3051-3056 [Abstract] [Full Text]  
  • Marchetti, C., Ulisse, S., Bruscoli, S., Russo, F. P., Migliorati, G., Schiaffella, F., Cifone, M. G., Riccardi, C., Fringuelli, R. (2002). Induction of Apoptosis by 1,4-Benzothiazine Analogs in Mouse Thymocytes. J. Pharmacol. Exp. Ther. 300: 1053-1062 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pitzurra, L.
Right arrow Articles by Vecchiarelli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pitzurra, L.
Right arrow Articles by Vecchiarelli, A.