INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Opportunistic fungal infections represent a significant cause of morbidity and mortality in immunocompromised patients, including those with AIDS, cancer, and organ transplants (3, 6, 11, 14, 34). Despite the increase in fungal infections, therapeutic options are very limited and are often unsatisfactory because of elevated toxicity and an inability to eradicate infections (35, 43). Despite treatment with antifungal agents such as fluconazole (FCZ) and amphotericin B, the mortality rate associated with systemic Candida albicans infection is greater than 50% (18, 42).

The interaction of the host with the infecting pathogen has clearly defined the course of systemic C. albicans disease. Activated macrophages (Ms) play a primary role in the host defense against fungi. Several investigators have documented the importance of M activation for efficient fungistatic and fungicidal activity (22, 38). The activation of immunoeffectors may also be sustained by antifungal agents such as amphotericin B or azole compounds (4, 13, 15, 26, 29, 30, 36, 40). Moreover, it has been reported that azole compounds and phagocytic cells have synergy for the killing of C. albicans and Candida species (13, 15).

The synthesis and antifungal activities of 1,4-benzothiazine derivatives for evaluation of the effect of substitution of the aromatic ring with the 1,4-benzothiazine nucleus, which shows some antifungal activity when it is part of FCZ- and miconazole-like analogues, have recently been reported (12). Of these derivatives, 7-[1-[(4-chlorobenzyl)oxy]-2-(1H-1-imidazolyl)ethyl]-4-methyl-3,4-dihydro-2H-1,4-benzothiazin-3-one (FS5) shows good efficacy against systemic candidiasis in a murine experimental model (12). In particular, compound FS5 exhibited poor antifungal activity in vitro against C. albicans compared with that of FCZ. However, a marked antifungal effect was observed in a murine model of fatal candidiasis (12). This study was designed to evaluate whether the observed FS5-mediated anti-Candida effect could be due to the immunopotentiating properties of professional phagocytes such as Ms. For this purpose, the effector and secretory functions of Ms from FS5-treated mice were evaluated. The results showed that compound FS5 promotes the intracellular antifungal activities of Ms in different anatomical districts and induces synthesis of tumor necrosis factor alpha (TNF-) and nitric oxide (NO) secretion. Our results suggest that the beneficial effect of FS5 observed in vivo could be a consequence of direct toxicity against the fungus and the indirect effect ascribed to induction of synthesis of immune molecules involved in the antifungal activities of professional phagocytes.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Mice. Female CD₁ mice (age, 8 to 10 weeks; weight, 25 to 30 g) were obtained from Charles River Breeding Laboratories (Calco, Milan, Italy). For the in vitro assays, effector cells from three to five animals were pooled.

C. albicans. C. albicans CA-6, which was used throughout this study, was isolated from a vaginal swab (8) and was identified by the taxonomic criteria of van Uden and Buckley (37) as described previously (8). The yeast was grown at 28°C in Sabouraud dextrose agar. Under these conditions the organism grew as an essential pure yeast-phase population. Before use, yeast cells were harvested from a 24-h culture, suspended in pyrogen-free saline, washed twice, quantified by hemocytometry, and adjusted to the desired concentration. C. albicans cells were heat inactivated by autoclaving at 121°C for 15 min for experiments requiring killed C. albicans cells. Live or killed C. albicans cells were unopsonized prior to use for experimentation.

Chemicals. The FS5 derivative was solubilized in dimethyl sulfoxide and was diluted with sterile, pyrogen-free water (ratio 1:4) to stock concentrations of 1,000 µg/ml. FCZ (Pfizer Pharmaceuticals) was dissolved in sterile, pyrogen-free water to stock concentrations of 1,000 µg/ml. Stock solutions, sterilized by filtration and protected from light, were stored at 4°C until use. The chemicals had <0.25 EU/ml by the Limulus amebocyte lysate assay (BioWhittaker, Walkersville, Md.).

In vivo studies. (i) Systemic candidiasis model. Mice were infected intravenously (i.v.) with 2 × 10⁵ C. albicans blastoconidia via the lateral tail vein. Diluent (dimethyl sulfoxide and H₂O; ratio, 1:4) or chemicals (FS5 and FCZ) were administered intraperitoneally (i.p.) at a dose of 10 mg/kg of body weight 2 h before infection and then daily for 7 consecutive days. The dose and administration schedules used in this study were chosen from previously reported data (12) and were based on the dose and treatment schedules reported in the literature for a novel azole with a broad antifungal spectrum, such as ER-30346 (16) and voriconazole (17, 35). For survival studies, mice were observed through day 60. Three mice per group were killed by CO₂ asphyxiation 8 days after infection for quantitative culture of both kidneys.

(ii) Quantitation of C. albicans in the kidneys. The kidneys of mice were aseptically removed and were homogenized with 3 ml of sterile distilled water. The number of CFU was determined by a plate dilution method of Sabouraud dextrose agar as described previously (4). Colonies of C. albicans cells were counted after 48 h of incubation at room temperature, and the results were expressed as the number of CFU per organ.

In vitro studies. (i) Susceptibility testing. Susceptibility testing was performed by the M27-A microdilution method of the National Committee for Clinical Laboratory Standards (27) in 0.165 M MOPS (morpholinepropanesulfonic acid)-buffered (pH 7) RPMI 1640 medium (Gibco BRL, Paisley, United Kingdom). The activity of compound FS5 or FCZ against C. albicans was tested by using serial twofold dilutions ranging from 0.9 to 500 µg/ml. The MIC was the lowest concentration of chemical that produced an 80% reduction in the turbidity compared to that for the chemical-free control (27, 31). In selected experiments the activity of sera from untreated or chemical-treated mice against C. albicans was tested by using serial twofold dilutions of sera ranging from 2 to 1,024. Growth reduction was estimated spectrophotometrically as described previously (31).

(ii) Peritoneal and splenic Ms. After in vivo treatment with chemicals, on day 8 peritoneal and splenic Ms were collected from five animals in each experimental group. Peritoneal Ms were harvested by rinsing the exposed peritoneal cavity with RPMI 1640 medium, and splenic Ms were isolated from aseptically removed spleens, minced by homogenization, and then filtered on sterile gauze. Both cell populations were washed three times with RPMI 1640 medium to which 10% fetal calf serum was added and which was supplemented with 2 mM L-glutamine (Sigma) and penicillin-streptomycin (50 IU and 50 µg/ml, respectively) (cRPMI), quantified by hemocytometry, and allowed to adhere to 90-mm tissue culture plates. After 2 h of incubation in 5% CO₂ at 37°C, the plates were washed with cRPMI to remove nonaderent cells. Ms were recovered with a cell scraper, washed three times, suspended in cRPMI, counted, and adjusted to the desired concentrations. The adherent cells were >98% viable, as evaluated by trypan blue dye exclusion, and at least 95% were macrophages, as determined by Wright-Giemsa staining. Peritoneal and splenic Ms were used immediately for in vitro studies.

(iii) Phagocytosis of C. albicans by peritoneal or splenic Ms. Assessment of immune cell phagocytic activity against heat-inactivated C. albicans yeast cells was done as described previously (39). Briefly, phagocytic cells (2 × 10⁶) resuspended in cRPMI were incubated for 1 h at 37°C in 5% CO₂ with target particles at an effector-to-target (E:T) cell ratio of 1:10. After ingestion the unbound microorganisms were removed by centrifugation of the cell suspension on a Ficoll cushion at 400 × g for 10 min. The cells at the interface were recovered and washed. C. albicans uptake was directly evaluated in Giemsa-stained cytospin preparations. A minimum of 200 cells was microscopically scored. The percentage of phagocytosis was defined as the percentage of Ms with one or more ingested yeast cells. Four determinations were made in duplicate, and these were used to calculate the mean I standard error (SE) percentage of phagocytosis.

(iv) Inhibition of C. albicans growth by peritoneal or splenic Ms. Anti-Candida activity was evaluated by comparing the percentage of viable yeasts incubated in the presence of effector cells (peritoneal or splenic Ms) with control growth in the absence of effector cells. Viable yeasts were determined by a quantitative pour plate assay (4). Briefly, effector cells were plated at different concentrations (0.1 ml per well) in 96-well plates (Corning Glass Works, Corning, N.Y.) and were infected with 0.1 ml of viable C. albicans (5 × 10⁴ per ml). After 4 h of incubation at 37°C under 5% CO₂, Triton X-100 (final concentration, 0.1%) was added to the wells and the plates were shaken vigorously. Serial dilutions from each well were made in distilled water, and the dilutions were plated on Sabouraud dextrose agar. The colonies of C. albicans were counted after 24 h at 37°C. The results were expressed as the percent reduction of CFU by the following formula: 100  [(CFU in experimental group/CFU in control cultures) × 100].

(v) Nitrate assay and TNF- quantification. Peritoneal or splenic Ms (10⁶/well) were cultured in 96-well plates (Corning) in cRPMI with or without stimuli as described previously (9). Culture supernatants were collected after 24 h of culture. The nitrate concentration in the supernatants was assayed by the Griess reaction adapted for microplates (5). The concentration of TNF- in the supernatants was quantified by the L-929 cytotoxic bioassay as described previously (33). The L-929 cytotoxicity of the supernatants was completely abrogated with polyclonal TNF- antibody (Genzyme), confirming that the bioassay specifically measured TNF-. Each sample was run in duplicate, and the results were averaged.

RNA extraction and reverse transcriptase (RT) PCR. Total RNA was isolated from Ms by established procedures (2). For each experiment, equivalent amounts of intact RNA (5 µg) were reverse transcribed as described previously (2). Equivalent amounts of cDNA in 5-µl aliquots were amplified by PCR in a reaction mixture containing 6.5 µl of double-distilled sterile water, 3.2 µl of 10× PCR buffer (Pharmacia, Uppsala), 3.2 µl of 1.25 mM deoxynucleoside triphosphates (Promega), 1 µl each of 3' and 5' primers (final concentration, 25 pM; Promega), and 0.1 µl of Taq polymerase (5 U/µl; Pharmacia). Each cycle consisted of denaturation at 94°C for 1 min, annealing at 60°C (for GAPDH and TNF-) or 65°C (for iNOS) for 1 min, and extension at 72°C for 1 min. Amplification was repeated for 30 cycles in a Perkin-Elmer Cetus DNA thermal cycler. Ten microliters of each of the PCR amplification products was separated on an ethidium bromide-stained 1.5% agarose gel, and the fragments were visualized by UV transillumination. Densitometric analysis was performed with a Gel Doc 1000 densitometer (Bio-Rad Laboratories, Hercules, Calif.), and relative peak areas were expressed in arbitrary densitometric units as described previously (2). Aliquots of 0.05 µg of X174 replicative-form DNA-HaeIII-digested fragments (New England BioLabs, Beverly, Mass.) were run in parallel as molecular size markers. The amplified bands were of the predicted sizes. Cytokine-specific primers were DNA specific and were nonreactive with RNA. The following 5' and 3' oligonucleotide primer sequences were used: for TNF-, AGCCCACGTCGTAGCAAACCACCAA and ACACCCATTCCCTTCACAGAGCAAT; for iNOS, CCCTTCCGAAGTTTCTGGCAGCAGC and GGCTGTCAGAGCCTCGTGGCTTTG; and for GAPDH, CCTTCATTGACCTCAACTACATGG and AGTCTTCTGGGTGGCAGTGATGG.

Statistical analysis. Differences in median survival time were determined by the Mann-Whitney U test (28). Student's t test was used to evaluate the significance of all other data. Each experiment was repeated three to five times.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Experiments were performed to examine the ability of FS5 compound to cure systemic Candida infection. Mice were injected i.p. with FS5 or FCZ 2 h before C. albicans infection and 1 to 7 days postinfection; survival was observed through day 60. Increased survival time and organism counts in kidney tissues 8 days after infection were used as indicators of treatment efficacy. As shown in Fig. 1, all control mice infected i.v. with C. albicans died by day 28. The administration of compound FS5 prolonged the median survival time from 12 to >60 days, with 52% survivors (Fig. 1). As expected, FCZ treatment induced protection in 80% of mice (Fig. 1). A consistent reduction of C. albicans growth was observed in the kidneys of FS5-treated mice compared with the growth for the untreated controls (data not shown).

View larger version (16K): [in this window] [in a new window]   FIG. 1.   Effect of i.p. FS5 and FCZ administration on survival of mice infected i.v. with C. albicans (2 × 105). FS5 and FCZ were administered i.p. (10 mg/kg) 2 h before challenge and daily for 7 consecutive days. The rates of survival of FS5- or FCZ-treated-mice mice were significantly higher than that of diluent-treated mice from day 8 (P < 0.05 to day 60). Ten mice per group were used in each experiment. The figure represents pooled data from five experiments.

Under our experimental conditions, the MIC of compound FS5 was 46 µg/ml (Fig. 2A). This MIC was significantly higher than that of FCZ (<0.9 µg/ml). However, it has been reported that the in vitro antifungal effect does not necessarily correlate with in vivo activity (1, 31, 32). Consistent with this premise, sera from FS5- or FCZ-treated mice, collected 3 h after the last administration, showed similar anti-Candida activity (Fig. 2B). In contrast, sera collected 72 h after the last administration of FS5 or FCZ showed no differences in anti-Candida activity compared with the activity of sera from untreated controls (data not shown).

View larger version (16K): [in this window] [in a new window]   FIG. 2.   Effect of FS5 or FCZ on C. albicans (CA) growth. (A) MICs of FS5 and FCZ determined as described in Materials and Methods. (B) Percentage of inhibition of C. albicans (CA) growth by sera from diluent-, FS5-, or FCZ-treated mice. FS5 and FCZ were administered i.p. (10 mg/kg) daily for 7 consecutive days. Sera were collected 3 h after the last administration. The results represent the means ± SEs of four separate experiments. *, P < 0.05 (for FS- or FCZ-treated mice versus untreated mice).

An increase in the peripheral leukocyte (WBC) count in mice treated with antifungal agents has been observed (20). In agreement with previous reports, the administration of FCZ significantly increased the WBC count in murine blood, and a similar effect was observed for FS5. The increase in the WBC count correlated with a significant increase in the percentage of professional phagocytes, such as neutrophils (data not shown). Given the increased antimicrobial activity of phagocytic cells induced by antifungal agents (4, 13, 15, 19, 26, 30, 36, 40, 41), we evaluated whether FS5 regulates the anti-Candida activity of Ms. Significant enhancement of phagocytic and killing activities of Ms from different anatomical districts was observed. As shown in Fig. 3, peritoneal Ms (Fig. 3A) as well as splenic Ms (Fig. 3B) from FS5- or FCZ-treated mice showed marked increases in candidacidal activity compared with those from untreated mice, reaching a maximum at an E:T ratio of 10:1. Similarly, phagocytosis was increased (Fig. 3C) in terms of the phagocytosis index (Fig. 3D).

View larger version (46K): [in this window] [in a new window]   FIG. 3.   Effect of FS5 administration on candidacidal activity of peritoneal (A) or splenic (B) Ms. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then peritoneal and splenic Ms were harvested and tested for their anticandidal activities. Candidacidal activity was evaluated against live C. albicans at different E:T ratios. (C) Percentage of phagocytic cells that ingested 1 or more killed C. albicans yeasts of 200 cells counted. (D) Average number of C. albicans cells ingested by phagocytic cells (phagocytic index). The results represent the means ±SEs of four separate experiments. *, P < 0.001 (for FS5- or FCZ-treated mice versus untreated mice).

Efficient killing of C. albicans by mononuclear phagocytes requires production of respiratory burst-associated toxic compounds (22). Recent data suggest that NO synthesis may also be included among the anticandidal mechanisms of Ms (5, 9). Thus, NO synthesis and production by splenic and peritoneal Ms from FS5-treated mice were evaluated as nitrite concentration and mRNA expression.

Under our experimental conditions, (i) peritoneal and splenic Ms from FS5- or FCZ-treated mice stimulated in vitro with lipopolysaccharide (LPS) plus C. albicans had a higher rate of NO secretion than Ms from untreated mice (Fig. 4A and 4C); (ii) NO production by peritoneal and splenic Ms from FS5-treated mice was similar to that observed by Ms from FCZ-treated mice (Fig. 4A and C); and (iii) peritoneal Ms had enhanced production of NO compared with that by splenic Ms. These results were confirmed by analysis of iNOS mRNA expression by RT-PCR (peritoneal M, Fig. 4B; splenic M, Fig. 4D).

View larger version (35K): [in this window] [in a new window]   FIG. 4.   Effect of FS5 administration on NO production from peritoneal (A and B) or splenic (C and D) Ms. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then the Ms were harvested and tested for NO as nitrate secretion or iNOS mRNA expression. Nitrate secretion in the supernatants of peritoneal (A) or splenic (C) Ms that were unstimulated (None) or stimulated with LPS (10 ng/ml) plus C. albicans (LPS + CA; E:T ratio, 1:1) was determined. iNOS mRNA expression was determined by RT-PCR (B and D) as described in Materials and Methods. Ms stimulated with LPS or C. albicans alone did not affect NO production with respect to the NO production of unstimulated cells (None). The results represent the means ± SEs of four separate experiments. *, P < 0.001 (for FS5- or FCZ-treated versus untreated mice).

Ms produce TNF-, which enhances the Ms' anti-Candida activity (38), raising the possibility that compound FS5 could contribute to M activation, which would affect cytokine secretion. For this purpose, TNF- production by peritoneal and splenic Ms from FS5-treated mice was examined as cytokine secretion or mRNA expression (Fig. 5). A significant increase in the level of TNF- production by peritoneal or splenic Ms from FS5- or FCZ-treated mice compared with the levels produced by Ms from untreated mice was observed (Fig. 5A and 5C). The amounts of TNF- produced by immune cells from FS5- or FCZ-treated mice were similar. This was supported by increased mRNA expression by TNF- (Fig. 5B and D). Treatment with FS5 or FCZ induced an effect on Ms similar to that of promoters of TNF- synthesis and secretion.

View larger version (36K): [in this window] [in a new window]   FIG. 5.   Effect of i.p. FS5 administration on TNF- production from peritoneal (A) or splenic (C) Ms. FS5 was administered i.p. (10 mg/kg) for 7 consecutive days, and then peritoneal and splenic Ms were harvested and tested for TNF- as secreted cytokine or mRNA expression. TNF- secretion in the supernatants of peritoneal (A) or splenic (C) Ms unstimulated (None) or stimulated with LPS (10 ng/ml) plus C. albicans (LPS + CA; E:T ratio, 1:1) was determined. TNF- mRNA expression was determined by RT-PCR (B and D) as described in Materials and Methods. The results represent the means ± SEs of five separate experiments. *, P < 0.001 (for FS5- or FCZ-treated versus untreated mice).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The results reported here show that the FS5 azole derivative of 1,4-benzothiazine significantly prolongs the survival and decreases the kidney fungal burden of mice systemically infected with C. albicans. This new antifungal agent appears to work in vivo as a toxic agent against C. albicans and as a promoter of antifungal mechanisms in natural immune cells. The latter effect is the result of (i) a consistent increase in the percentage of circulating professional phagocytes, (ii) enhanced serum fungistatic activity, (iii) the increased capacity of Ms to ingest and kill C. albicans yeast cells, and (iv) enhanced synthesis and secretion of nitrogen-reactive intermediates and TNF- at levels comparable to that obtained with FCZ.

In a previous study we demonstrated that FS compounds exhibit an appreciable level of protection in murine candidiasis (12). Of eight newly synthesized azole derivatives, the ether derivative FS5 is the most active (12). As observed previously, FS5 has an inhibitory effect on C. albicans growth in vitro. Here we report that its beneficial effect in murine candidiasis could be due to the synergy of its direct toxic effects against C. albicans and its capability to enhance the antimicrobial activities of natural effector cells. The increased anti-Candida activity in FS5-treated mice correlated with enhanced phagocytosis and NO production. Thus, enhanced intracellular killing involving NO should be considered an antifungal mechanism induced by FS5. This hypothesis is supported by previous observations showing that an increase in the level of inducible M NO synthase correlates with anti-Candida activity (9, 38).

At present the pharmacokinetic and pharmacodynamic patterns of FS5 in a murine model are not available. However, preliminary data on its toxicity showed that the tolerance of mice exposed to this new drug was excellent.

The combined activities of azoles, such as voriconazole, with polymorphonuclear neutrophils or monocytes against C. albicans have been reported, but the mechanisms involved are unknown (41). Here we describe a new effect of FCZ, as an inducer of NO production by Ms. The induction of NO production is a possible explanation for the observed collaboration between FCZ and phagocytic cells, which results in the enhancement of anti-Candida activity (41). A similar effect was observed with our new azole derivative in the cure of murine systemic candidiasis.

Despite the similar candidacidal activities, significant differences in NO production were observed in peritoneal and splenic Ms, which could reflect differences in the production or utilization of NO by heterogeneous Ms, thus implying that phagocytes from different anatomical districts have different behaviors depending on microenvironmental conditions. This is not surprising, as previous findings have shown that phagocytes from different anatomical districts could have different antifungal potentials (10).

A lack of correlation between the in vitro and in vivo effects of antifungal agents has been observed (1, 31, 32, 35). Although FS5 had a beneficial effect against murine candidiasis, a scarce anti-Candida effect was observed in vitro, as determined from the MICs. This apparent discrepancy could be attributed to the fact that FS5 is metabolized to an active antifungal compound and may have in vivo activity through immune-enhancing and direct antifungal effects.

Given the appreciable beneficial effect of FS5 in the treatment of fungal infections, it is reasonable to speculate that the effect could be improved by using FS5 in combination with exogenous NO, cytokines, or a monoclonal antibody to the fungus, as described for other azoles and fungi (7, 23-26, 41).

TNF- has also been proposed to be an inducer of C. albicans killing of Ms (21). More importantly, the beneficial effect of endogenous TNF- in antifungal therapy with FCZ and amphotericin B in a murine model of fatal candidiasis has been reported (20). Thus, the enhanced production of TNF- observed in cells from FS5- or FCZ-treated mice could contribute to the therapeutic efficacies of these drugs against systemic candidiasis.

Our data indicate that the efficacy of FS5 in the treatment of murine candidiasis may be related to a direct effect on C. albicans and may be via induction of potent antifungal molecules such as NO and TNF-. This new azole derivative appears to be a promising contribution to new therapeutic strategies for the treatment of Candida infections.