Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bäckman, A. Articles by Olcén, P. Search for Related Content PubMed PubMed Citation Articles by Bäckman, A. Articles by Olcén, P.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, January 2000, p. 210-212, Vol. 44, No. 1
0066-4804/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Complete Sequence of a -Lactamase-Encoding Plasmid in Neisseria meningitidis

Anders Bäckman,^1,* Paula Orvelid,¹ Julio A. Vazquez,² Ola Sköld,³ and Per Olcén¹

Department of Clinical Microbiology and Immunology, Örebro Medical Center Hospital, SE-701 85 Örebro,¹ and Department of Pharmaceutical Bioscience, Biomedical Centre, Uppsala University, SE-751 23 Uppsala,³ Sweden, and Servicio de Bacteriologíca, Centro Nacional de Microbiologíca, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain²

Received 25 February 1999/Returned for modification 4 June 1999/Accepted 6 October 1999

	ABSTRACT

Top Abstract Text References

Identical -lactamase-encoding (TEM-1) plasmids were found in two different clinical Neisseria meningitidis strains. They were completely sequenced (5,597 bp) and designated pAB6. The plasmid is almost identical to Neisseria gonorrhoeae plasmid pJD5 (5,599 kb) and may have been picked up from a gonococcus in vivo.

	TEXT

Top Abstract Text References

Plasmids in Neisseria meningitidis are found at various frequencies in different strain collections (1, 10, 12). Their presence is sometimes correlated with -lactamase-mediated resistance to penicillin (5, 6).

N. meningitidis is basically highly susceptible to penicillin, with MICs of 0.05 mg/liter, and this drug is still the major antimicrobial agent used for the treatment of meningococcal disease. However, increasing numbers of N. meningitidis strains with decreased susceptibility to penicillin G (MICs of >0.1 mg/liter) have been reported in recent years from many countries (11), such as Spain (15; D. Fontanals, V. Pineda, I. Pons, and R. C. Rojo, Letter, Eur. J. Clin. Microbiol. Infect. Dis. 8:90-91, 1989), Italy (17), Greece (18), the United Kingdom (E. M. Sutcliffe, D. M. Jones, S. el-Sheikh, and A. Percival, Letter, Lancet i:657-658, 1988), the United States (20), Canada (2), Israel (C. Block, Y. Davidson, E. Melamed, and N. Kelier, Letter, J. Antimicrob. Chemother. 32:166-168, 1993), The Netherlands (8), and Sweden (1).

A few isolates of N. meningitidis resistant to penicillin via plasmid-encoded -lactamase production have been found in Canada, South Africa, and Spain (6, 19; P. Botha, Letter, Lancet i:54, 1988; D. Fontanals, V. Pineda, I. Pons, and J. C. Rojo, Letter, Eur. J. Clin. Microbiol. Infect. Dis. 8:90-91, 1989). Two of these strains were shown to carry a plasmid-borne -lactamase (6, 19), but it was not further characterized. The other isolates probably also contained -lactamase-encoding plasmids, since the -lactamase was of the TEM-1 type (19; P. Botha, Letter, Lancet i:54, 1988).

Plasmids with this -lactamase gene, e.g., pJD4 and pJD5 (also named pFA3 and pFA7, respectively), were found to mediate penicillin resistance in Neisseria gonorrhoeae (4, 5, 14) and, according to Dillon and Yeung (5), were probably derived from a common ancestor. Therefore, the pJD5 sequence can be postulated from the main part of the pJD4 sequence. The pJD4 plasmid was estimated to have a size of 7.2 kb (size estimate range, 4.4 to 4.7 MDa) (5), but sequencing (GenBank accession no. U20374) has shown that it is actually 7,426 bp (4.9 MDa). The pJD5 plasmid was thought to be 5.1 kb (size estimate range, 3.2 to 3.4 MDa) (5), but it was recently reported to be 5,599 bp (3.7 MDa) (7).

The -lactamase-encoding plasmids from N. gonorrhoeae can be transferred in vitro to N. meningitidis by a conjugative plasmid (24.5 or 25.2 MDa) present in some strains of N. gonorrhoeae (6, 13, 14). This probably also happens in vivo since both species occasionally coexist in the genitourinary tract (6). The spread of penicillin resistance among strains of N. meningitidis can be monitored by examining the characteristics of the types of -lactamase-encoding plasmids and the -lactamase genes.

The aim of the present study was to sequence and identify the type of -lactamase plasmids found in two strains of N. meningitidis isolated in Spain (19). The -lactamase-producing N. meningitidis strains MC9690-129 and MC9690-130 were isolated from the blood of a patient with meningitis and from the throat of a contact person, respectively. Both strains were B:4:P1.15 (19). The strains were cultured on GC agar plates (3% GC medium base; Difco Laboratories) with 1% supplements (0.4% D-glucose, 0.01% L-glutamine, 0.1% cocarboxylase, and 0.5% ferric nitrate), 0.5% IsoVitaleX enrichment (BBL), and 0.5 mg of penicillin G/liter at 37°C in an atmosphere with 5% CO₂ for 18 to 20 h.

Antibiograms for the N. meningitidis strains were established with the E-test (Biodisk, Solna, Sweden) on chocolate Mueller-Hinton agar (9). The MICs (in micrograms per milliliter) of penicillin G (1.0), penicillin V (3.0), ampicillin (3.0), piperacillin (0.032), oxacillin (24), piperacillin-tazobactam (0.016), cefuroxime (0.38), ceftriaxone (<0.002), ceftazidime (0.023), imipenem (0.19), ciprofloxacin (0.004), rifampin (0.008), and chloramphenicol (0.75) for the two plasmid-carrying N. meningitidis strains were identical. The strains were tested for -lactamase production by the chromogenic cephalosporin method (16), using nitrocefin discs (Biodisk, Solna, Sweden). The tests were performed with aqueous suspensions of bacteria at room temperature, and the results were noted after 10 to 15 min and compared with those of positive and negative controls. Both strains were confirmed as -lactamase producers.

The Wizard Plus Midipreps DNA purification system (Promega) and the QIAprep Spin Miniprep kit (Qiagen GmbH, Hilden, Germany) were used to prepare plasmid DNA. Plasmid DNA was digested with XbaI and PvuII, and the TEM fragment was ligated into the M13mp18/19 vectors (Pharmacia, Biotech, Uppsala, Sweden) according to the manufacturer's instructions. The recombinant DNA was transformed into E. coli JM105, which was cultured according to the manufacturer's instructions (Pharmacia Biotech).

Sequencing was performed with the ABI PRISM BigDye Terminator cycle sequencing system, using a Ready Reaction kit, on an ABI PRISM 310 genetic analyzer according to the manufacturer's instructions (Perkin-Elmer Applied Biosystems). The TEM gene sequence was determined by direct sequencing of the clones. The complete primer sequence was then determined by primer walking.

The nucleotide sequences of the two plasmids were determined and compared to each other and to registered sequences in the international databases GenBank, European Molecular Biology Laboratory (EMBL), DNA Data Bank of Japan (DDBJ), and Protein Data Bank (PDB) by BLAST search (http://www.ncbi.nlm.nih.gov). The comparisons between the two plasmids showed that they had identical DNA sequences of 5,597 bp. Thus, the same plasmid was found in the two strains, and it was designated pAB6. The sequence of pAB6 was almost identical in size to pJD5 and in sequence to the major part of pJD4 (accession no. U20374) (5, 14) (which probably corresponds to pJD5), as well as to the database-reported region in pJD5 flanking the deletion site (883 bp; accession no. U20375) (Fig. 1); the only base differences between pJD4/pJD5 and pAB6 were at bp 442 (AG) and bp 3369 (GT). Open reading frames for four proteins were identified from the gene sequence (Fig. 1): one for a transposon Tn2 resolvase, TnpR (a variant of the reported Tn3 resolvase [3]), at bp 506 (5') to bp 907 (3') (accession no. P03011); one for a TEM-1 -lactamase at bp 1090 (5') to bp 1950 (3') (accession no. P00810); one for a DNA replication protein at bp 2252 (3') to bp 3238 (5') (accession no. P17492); and one for a plasmid mobilization protein at bp 4363 (5') to bp 42 (3') (accession no. P07112). The TEM-1 -lactamase gene was found to be identical to that in pJD4/pJD5, which is the same as that in Tn2. Two differences between pAB6 and Tn2 were seen: CT at base 913 and AT at base 439 on pAB6, identical to base switches at positions 3773 and 3299, respectively, on Tn2 in the 4.4-MDa plasmid (pJD4; 7.4 kb) (3, 4). An inverted repeat, IR1 (AACCCTTAAAGAACTCGCAACAAGTTGCAAATTCTTTAAGGGTT), was also identified, identical to the one in pJD4. Deletion site-flanking repeats, r1 (AACAGGAAATTTGTTGTCTTAT), 1r (3'-5') (TATTCTGTTGTTTAAAGGACAA), and r2 (CTTTTTTGGGCT T TCAGCCC TAAT T T T T TCT T T T T TCAGGAAT TAA), were identified as well, identical to the repeats found on pJD4/pJD5.

View larger version (17K): [in this window] [in a new window]   FIG. 1.   Identical DNA sequences in meningococcal plasmid pAB6 (accession no. AF126482) and the part of gonococcal plasmid pJD4 (accession no. U20374) corresponding to pJD5 are shown with black bars. Identical sequence was also seen in the reported deletion site-flanking region (14) (883 bp; accession no. U20375) of pJD5 (8) and pJD4. The part of pJD5 not reported in the database is also shown (  ). The base differences determined (see text) are indicated by asterisks. The restriction enzyme cleavage sites on the plasmids are indicated. Evident are open reading frames for four functional proteins: a transposon Tn2 resolvase (TnpR; bp 506 [5'] to 907 [3']) similar to the one encoded in Tn3 (3) (accession no. P03011); a TEM-1 -lactamase identical to the Tn2 -lactamase (bp 1090 [5'] to 1950 [3']; accession no. P00810), a DNA replication protein (REPLICATION; bp 2252 [3'] to 3238 [5']; accession no. P17492), and a plasmid mobilization protein (MOBILIZATION; bp 4363 [5'] to 42 [3']; accession no. P07112). The deletion end points on pJD4 probably resulting in the creation of the pAB6 and pJD5 plasmids (14) are at bp 1917 and 3746 (), and the corresponding point on pAB6 is at bp 3549 (). The region deleted from pJD4, which includes two restriction enzyme sites, is indicated (==). The right inverted repeat from Tn2 (38 bp) is shown (IR-R; bp 1990 to 2028), as is an inverted repeat (IR1; bp 235 to 279) close to the start of the Tn2 insertion in pAB6 (). Repeats close to the deletion sites were identified (r1 [bp 3373 to 3395 and 3396 to 3418], 1r [bp 3259 to 3237], and r2 [bp 3504 to 3549] [see text]).

Conclusions. In the present study, two -lactamase plasmids isolated from N. meningitidis were completely sequenced for the first time; they were found to be identical and designated pAB6 (Fig. 1). The sizes and sequences of pAB6 and pJD5 (5, 7) as seen with pJD4 [Fig. 1]) are almost identical. pAB6 could thus be a variant of pJD5 picked up from a gonococcus in vivo.

If these types of pathogenic meningococcal strains harboring plasmids like pAB6 become common, they will cause problems for the treatment of meningococcal meningitis and septicemia. Therefore, it appears to be important to evaluate N. meningitidis strains regularly for any changes in susceptibility patterns and for the introduction of -lactamase plasmids.

Nucleotide sequence accession number. The nucleotide sequence of pAB6 has been submitted to the GenBank database under accession no. AF126482.

	ACKNOWLEDGMENTS

This work was supported by grants from the Örebro County Council Research Committee and the Foundations for Medical Research, Örebro Medical Center Hospital.

We thank Amanda Wraith, Department of Medical Pharmacology, as well as Mats Gullberg and Amera Gibreel, Department of Pharmaceutical Bioscience, Biomedical Center, Uppsala University, for help with setting up sequencing at our laboratory. We also thank Inga Lind at Statens Serum Institut in Copenhagen for supplying reference strains.

	FOOTNOTES

^* Corresponding author. Mailing address: Department of Clinical Microbiology and Immunology, Örebro Medical Center Hospital, SE-701 85 Örebro, Sweden. Phone: 4619151520. Fax: 4619127416. E-mail: anders.backman{at}orebroll.se.

	REFERENCES

Top Abstract Text References

1.	Bäckman, A., D. Danielsson, and P. Olcén. 1993. Plasmid carriage and antibiotic susceptibility of Neisseria meningitidis strains isolated in Sweden 1981-1990. Eur. J. Clin. Microbiol. Infect. Dis. 12:683-689[CrossRef][Medline].
2.	Blondeau, J. M., F. E. Ashton, M. Isaacson, Y. Yaschuck, C. Anderson, and G. Ducasse. 1995. Neisseria meningitidis with decreased susceptibility to penicillin in Saskatchewan, Canada. J. Clin. Microbiol. 33:1784-1786[Abstract].
3.	Chen, S.-T., and R. C. Clowes. 1987. Variations between the nucleotide sequences of Tn1, Tn2, and Tn3 and expression of -lactamase in Pseudomonas aeruginosa and Escherichia coli. J. Bacteriol. 169:913-916[Abstract/Free Full Text].
4.	Chen, S.-T., and R. C. Clowes. 1987. Nucleotide sequence comparison of plasmids pHD131, pJB1, pFA3, and pFA7 and -lactamase expression in Escherichia coli, Haemophilus influenzae, and Neisseria gonorrhoeae. J. Bacteriol. 169:3124-3130[Abstract/Free Full Text].
5.	Dillon, J.-A. R., and K.-H. Yeung. 1989. -Lactamase plasmids and chromosomally mediated antibiotic resistance in pathogenic Neisseria species. Clin. Microbiol. Rev. 2(Suppl.):S125-S133.
6.	Dillon, J. R., M. Pauzé, and K.-H. Yeung. 1983. Spread of penicillinase-producing and transfer plasmids from the gonococcus to Neisseria meningitidis. Lancet i:779-781.
7.	Dillon, J. R., H. Li, K.-H. Yeung, and T. A. Aman. 1999. A PCR assay for discriminating Neisseria gonorrhoeae -lactamase-producing plasmids. Mol. Cell. Probes 13:89-92[CrossRef][Medline].
8.	Enting, R. H., L. Spanjaard, D. van de Beek, E. F. Hensen, J. de Gans, and J. Dankert. 1994. Antimicrobial susceptibility of Haemophilus influenzae, Neisseria meningitidis and Streptococcus pneumoniae isolates causing meningitis in The Netherlands, 1993-1994. J. Antimicrob. Chemother. 38:777-786[Abstract/Free Full Text].
9.	Hughes, J. H., D. J. Biedenbach, M. E. Erwin, and R. N. Jones. 1993. E test as susceptibility test and epidemiologic tool for evaluation of Neisseria meningitidis isolates. J. Clin. Microbiol. 31:3255-3259[Abstract/Free Full Text].
10.	Ison, C. A., C. M. Bellinger, and C. S. F. Easmon. 1985. Plasmids in meningococci, p. 216-218. In G. K. Schoolnik, et al. (ed.), The pathogenic neisseriae. American Society for Microbiology, Washington, D.C.
11.	Oppenheim, B. A. 1997. Antibiotic resistance in Neisseria meningitidis. Clin. Infect. Dis. 24(Suppl. 1):98-101.
12.	Prère, M. F., O. Fayet, C. Delmas, M. B. Lareng, and H. Dabernat. 1985. Présence de plasmides chez Neisseria meningitidis. Ann. Inst. Pasteur Microbiol. 136:271-276[CrossRef].
13.	Roberts, M. C., and J. S. Knapp. 1988. Transfer of -lactamase plasmids from Neisseria gonorrhoeae to Neisseria meningitidis and commensal Neisseria species by the 25.2-megadalton conjugative plasmid. Antimicrob. Agents Chemother. 32:1430-1432[Abstract/Free Full Text].
14.	Roberts, M. C. 1989. Plasmids of Neisseria gonorrhoeae and other Neisseria species. Clin. Microbiol. Rev. 2(Suppl.):S18-S23.
15.	Sáez-Nieto, J. A., R. Lujan, S. Berrón, J. Campos, M. Viñas, C. Fusté, J. A. Vazquez, Q.-Y. Zhang, L. D. Bowler, J. V. Martinez-Suarez, and B. G. Spratt. 1992. Epidemiology and molecular basis of penicillin-resistant Neisseria meningitidis in Spain: a 5-year history (1985-1989). Clin. Infect. Dis. 14:394-402[Medline].
16.	Schoenknecht, F. D., L. D. Sabath, and C. Thornsberry. 1985. Susceptibility tests: special tests, p. 1006. In E. H. Lennette, A. Balows, W. J. Hausler, and H. J. Shadomy, Jr. (ed.), Manual of clinical microbiology, 4th ed. American Society for Microbiology, Washington, D.C.
17.	Stroffolini, T., M. E. Congiu, M. Occhionero, and P. Mastrantonio. 1989. Meningococcal disease in Italy. J. Infect. 19:69-74[CrossRef][Medline].
18.	Tzanakaki, G., C. C. Blackwell, J. Kremastinou, C. Kallergi, G. Kouppari, and D. M. Weir. 1992. Antibiotic sensitivities of Neisseria meningitidis isolates from patients and carriers in Greece. Epidemiol. Infect. 108:449-455[Medline].
19.	Vázquez, J. A., A. M. Enriquez, L. De La Fuente, S. Berrón, and M. Baquero. 1996. Isolation of a strain of -lactamase producing Neisseria meningitidis in Spain. Eur. J. Clin. Microbiol. Infect. Dis. 15:181-182[CrossRef][Medline].
20.	Woods, C. R., A. L. Smith, B. L. Wasilauskas, J. Campos, and L. B. Givner. 1994. Invasive disease caused by Neisseria meningitidis relatively resistant to penicillin in North Carolina. J. Infect. Dis. 170:453-456[Medline].

---

Antimicrobial Agents and Chemotherapy, January 2000, p. 210-212, Vol. 44, No. 1
0066-4804/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

This article has been cited by other articles:

• San Millan, A., Escudero, J. A., Gutierrez, B., Hidalgo, L., Garcia, N., Llagostera, M., Dominguez, L., Gonzalez-Zorn, B. (2009). Multiresistance in Pasteurella multocida Is Mediated by Coexistence of Small Plasmids. Antimicrob. Agents Chemother. 53: 3399-3404 [Abstract] [Full Text]  
• Nicolas, P., Manchanda, V., Bhalla, P. (2007). Emergence of Non-Ceftriaxone-Susceptible Neisseria meningitidis in India. J. Clin. Microbiol. 45: 1378-1378 [Full Text]  
• Schmitt, J., Jacobs, E., Schmidt, H. (2007). Molecular characterization of extended-spectrum beta-lactamases in Enterobacteriaceae from patients of two hospitals in Saxony, Germany. J Med Microbiol 56: 241-249 [Abstract] [Full Text]  
• Yazdankhah, S. P., Caugant, D. A. (2004). Neisseria meningitidis: an overview of the carriage state. J Med Microbiol 53: 821-832 [Abstract] [Full Text]  
• Bennett, P. M., Livesey, C. T., Nathwani, D., Reeves, D. S., Saunders, J. R., Wise, R. (2004). An assessment of the risks associated with the use of antibiotic resistance genes in genetically modified plants: report of the Working Party of the British Society for Antimicrobial Chemotherapy. J Antimicrob Chemother 53: 418-431 [Abstract] [Full Text]  
• Vazquez, J. A., Arreaza, L., Block, C., Ehrhard, I., Gray, S. J., Heuberger, S., Hoffmann, S., Kriz, P., Nicolas, P., Olcen, P., Skoczynska, A., Spanjaard, L., Stefanelli, P., Taha, M.-K., Tzanakaki, G. (2003). Interlaboratory Comparison of Agar Dilution and Etest Methods for Determining the MICs of Antibiotics Used in Management of Neisseria meningitidis Infections. Antimicrob. Agents Chemother. 47: 3430-3434 [Abstract] [Full Text]  
• Oliver, A., Weigel, L. M., Rasheed, J. K., McGowan, J. E. Jr., Raney, P., Tenover, F. C. (2002). Mechanisms of Decreased Susceptibility to Cefpodoxime in Escherichia coli. Antimicrob. Agents Chemother. 46: 3829-3836 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bäckman, A. Articles by Olcén, P. Search for Related Content PubMed PubMed Citation Articles by Bäckman, A. Articles by Olcén, P.