Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, November 2000, p. 3040-3048, Vol. 44, No. 11
Pharmazeutische Biologie, Pharmazeutisches
Institut, Eberhard-Karls-Universität Tübingen, 72076 Tübingen, Germany
Received 24 April 2000/Returned for modification 10 July
2000/Accepted 10 August 2000
The biosynthetic gene cluster of the aminocoumarin antibiotic
coumermycin A1 was cloned by screening of a cosmid library
of Streptomyces rishiriensis DSM 40489 with heterologous
probes from a dTDP-glucose 4,6-dehydratase gene, involved in
deoxysugar biosynthesis, and from the aminocoumarin resistance gyrase
gene gyrBr. Sequence analysis of a 30.8-kb
region upstream of gyrBr revealed the presence
of 28 complete open reading frames (ORFs). Fifteen of the identified
ORFs showed, on average, 84% identity to corresponding ORFs in the
biosynthetic gene cluster of novobiocin, another aminocoumarin
antibiotic. Possible functions of 17 ORFs in the biosynthesis of
coumermycin A1 could be assigned by comparison with sequences in GenBank. Experimental proof for the function of the
identified gene cluster was provided by an insertional gene
inactivation experiment, which resulted in an abolishment of
coumermycin A1 production.
Coumermycin A1 is
produced by Streptomyces rishiriensis DSM 40489 (13). Together with novobiocin and clorobiocin (Fig.
1), it belongs to the coumarin
antibiotics. Novobiocin (Albamycin; Pharmacia & Upjohn) is
licensed in the United States as an antibiotic for the treatment of
infections with multiresistant gram-positive bacteria, such as
Staphylococcus epidermidis and Staphylococcus aureus (27, 34, 47).
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of the Coumermycin A1
Biosynthetic Gene Cluster of Streptomyces rishiriensis
DSM 40489
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (16K):
[in a new window]
FIG. 1.
Structures of the coumarin antibiotics
coumermycin A1, novobiocin, and clorobiocin.
Bacterial DNA gyrase is the target of the aminocoumarin antibiotics (25). X-ray crystallographic examinations (8, 20, 45, 48) have demonstrated that the aminocoumarin moiety and the substituted deoxysugar moiety of these compounds are essential for their binding to the gyrase B subunit of bacterial gyrase. The coumermycin A1 molecule (Fig. 1) contains two of these active aminocoumarin-deoxysugar moieties and has been shown to stabilize a dimer form of the 43-kDa fragment of GyrB (1, 10). Therefore, coumermycin A1 is likely to cross-link the two gyrase B subunits of the intact gyrase heterotetramer, which consists of two gyrase A and two gyrase B subunits. Consequently, the affinity of this antibiotic for intact gyrase is extremely high: 50% inhibition of gyrase is achieved by coumermycin A1 at a concentration of only 0.004 µM, compared to 0.1 µM for novobiocin, 1.8 µM for norfloxacin, and 110 µM for nalidixic acid (32). Likewise, coumermycin A1 has been found to exhibit much higher antibacterial activity than novobiocin (36).
In coumermycin A1, a methylpyrrole-2-carboxylic acid unit is attached to the 3-OH of each deoxysugar moiety (Fig. 1). The same pyrrole unit is also contained in clorobiocin (Fig. 1) and has been shown to result in a higher affinity for gyrase than has the carbamoyl group found in the corresponding position of novobiocin (45). In contrast, the prenylated 4-hydroxybenzoate group of novobiocin and clorobiocin, which is absent in coumermycin A1, appears not to be essential for biological activity (2, 11, 18). These features make coumermycin A1 a most interesting starting compound for the development of new aminocoumarin antibiotics, which may serve as anti-infective agents against multiresistant gram-positive bacteria. Recently, the chemical synthesis of a series of new aminocoumarin antibiotics has been published (9, 18, 19, 31, 33).
Combinatorial biosynthesis with the biosynthetic gene clusters for the aminocoumarin antibiotics could provide additional possibilities for the discovery of novel anti-infective agents. The genetic manipulation of the biosynthesis of polyketide and peptide antibiotics has already succeeded in the production of new and even clinically useful "hybrid" antibiotics (4, 14, 16, 26, 28, 39, 42).
Knowledge of the biosynthetic genes for aminocoumarin biosynthesis is a prerequisite for the production of new aminocoumarin antibiotics by combinatorial biosynthesis. Our group has recently reported the identification of the novobiocin biosynthetic gene cluster (41). Molecular biological studies of coumermycin A1 biosynthesis are yet unpublished. We present now the cloning and sequencing of the coumermycin A1 biosynthetic gene cluster from S. rishiriensis DSM 40489 and its functional identification by insertional gene inactivation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, plasmids, and culture conditions.
The
bacterial strains and plasmids used in this study are listed in Table
1. S. rishiriensis DSM 40489 was cultivated at 28°C and 175 rpm for 2 to 4 days in baffled flasks.
For isolation of chromosomal DNA, the organism was grown in liquid
medium containing 1.0% malt extract, 0.4% yeast extract, 0.4%
glucose, and 1.0 mM CaCl2 (pH 7.3). For preparation of
protoplasts, S. rishiriensis was grown for 44 to 48 h
in CRM medium, containing 10.3% sucrose, 2.0% tryptic soy broth,
1.0% MgCl2 · 6H2O, 1.0% yeast extract, and 0.4% glycine (pH 7.0). Protoplasts were prepared as described by
Steffensky et al. (41) and regenerated on R2YE medium
(12).
|
DNA isolation and manipulation. Standard methods for DNA isolation and manipulation were performed as described by Hopwood et al. (12) and Sambrook et al. (37). DNA fragments were isolated from agarose gels using a QIAEX II gel extraction kit (Qiagen, Hilden, Germany). Isolation of cosmids and plasmids was carried out with ion-exchange columns (Nucleobond AX kits; Macherey-Nagel, Düren, Germany) according to the manufacturer's protocol.
Construction and screening of the cosmid library. Chromosomal DNA of S. rishiriensis DSM 40489 was partially digested with Sau3AI, dephosphorylated, ligated into cosmid vector pOJ446 (which had been digested with HpaI), dephosphorylated, and restricted with BamHI. The ligation products were packaged with Gigapack III XL (Stratagene, Heidelberg, Germany) and transduced into E. coli XL1 Blue MRF'.
A probe containing part of the dTDP-glucose 4,6-dehydratase gene (novT) from the novobiocin producer Streptomyces spheroides was prepared as described previously (41). An additional probe (271 bp) was prepared by PCR from the novobiocin resistance gene (gyrBr) of S. spheroides using primers R1 (GACGGCTCCATCTTCGAGAC) and R2 (CGTCGGCGGCGATGGTGAC). For hybridization experiments, the probes were labeled with digoxigenin high prime DNA labeling and detection start kit II (Roche Molecular Biochemicals, Mannheim, Germany).DNA sequencing and computer-assisted sequence analysis.
Restriction fragments of approximately 300 to 3,000 bp from cosmids
4-2H and 4-7D were subcloned into pBluescript SK(
). Sequencing was
performed by the dideoxynucleotide chain termination method on a LI-COR automatic sequencer (MWG-Biotech AG, Ebersberg, Germany).
Construction of the vector for insertional gene
inactivation.
Vector pZK4, for proB disruption, was
constructed by insertion of neomycin resistance gene aphII
into the sequence of proB as follows. The aphII
gene was obtained as a 0.99-kb EcoRI-HindIII fragment from plasmid pNeo4 (Table 1) and ligated into the same sites
of pZW331 (Table 1), which contained the 5' region of proB, to give plasmid pZW2. The 3' region of proB was obtained as
a 0.96-kb HindIII-XhoI fragment from pZW32
(Table 1) and ligated into the same sites of pZW2, resulting in plasmid
pZW3. A 2.65-kb PstI fragment of pZW3, containing the
disrupted proB gene, was cloned into the same sites of
pBluescript SK(
) to give the inactivation vector pZK4. In pZK4, the
aphII gene fragment had the same orientation as the
proB gene and the orientation opposite that of the
bla resistance gene of the vector.
Transformation of S. rishiriensis DSM 40489. Transformation of S. rishiriensis with pZK4 was carried out by polyethylene glycol-mediated protoplast transformation. Two grams of S. rishiriensis mycelia was incubated in 7 ml of P buffer (12) containing 1 mg of lysozyme per ml for 20 to 40 min at 30°C. For transformation, pZK4 was propagated in E. coli ET12567 (23), and the resulting double-stranded plasmid DNA was denaturated by alkaline treatment (30). The denaturated DNA (10 to 20 µg) was mixed with 200 µl of P buffer containing 109 S. rishiriensis protoplasts (200 µl) and with 500 µl of T buffer (12) containing 25% (wt/vol) polyethylene glycol 1000 (Roth, Karlsruhe, Germany). The resulting suspension was plated on R2YE plates. After 16 to 20 h at 25°C, the plates were overlaid with 3 ml of soft nutrient agar (12) containing neomycin (33.3 µg/ml) for selection of integration mutants.
Determination of the production of coumermycin A1 and other secondary metabolites in S. rishiriensis. Metabolites of S. rishiriensis were analyzed by modifications of the methods of Kawaguchi et al. (13) and Berger and Batcho (5).
Bacterial cultures (100 ml) in coumermycin production medium (see above) were adjusted to pH 5 by the addition of formic acid and centrifuged. The pellet was extracted with 50 ml of a mixture of acetone and 1,4-dioxane (10:1) at room temperature for 2 h with stirring. After filtration, the supernatant was evaporated, and the residue was dissolved in 20 ml of 1 N ammonium hydroxide (pH 9). The solution was washed twice with an equal volume of ethyl acetate. The aqueous phase was adjusted to pH 5 by the addition of formic acid and extracted twice with an equal volume of ethyl acetate. The ethyl acetate phase was evaporated, and the residue was dissolved in 0.5 ml of 4 N ammonium hydroxide in methanol. Six microliters of this solution was applied to a thin-layer chromatography (TLC) plate (Silica Gel 60 F254; E. Merck AG, Darmstadt, Germany). The plate was developed with dichloromethane-methanol-formic acid (45:2:1). Spots were visualized by spraying with 10% fresh ferric chloride-potassium ferricyanide (5 g each in 100 ml of water).Nucleotide sequence accession number. The nucleotide sequence reported in this study is available in the GenBank database under accession no. AF235050.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the coumermycin A1 biosynthetic gene cluster. We have previously cloned the novobiocin biosynthetic gene cluster from S. spheroides NCIB 11891 by screening of a cosmid library of the producer with a probe for a dTDP-glucose 4,6-dehydratase gene, which is involved in the biosynthesis of the deoxysugar moiety of the antibiotic (41). Since coumermycin A1 contains the same deoxysugar moiety, we subjected genomic DNA of the coumermycin producer, S. rishiriensis DSM 40489, to Southern hybridization with the same probe. A single hybridizing band was detected. Likewise, hybridization with a probe from the novobiocin resistance gene gyrBr, encoding a non-novobiocin-sensitive gyrase B subunit (44), resulted in a single hybridizing band. Therefore, a cosmid library of the coumermycin producer was established in vector pOJ446 and screened with both probes.
The hybridizing cosmids were mapped by conventional restriction mapping as well as by hybridization of partial digests of the cosmids to pOJ446 vector sequences flanking the cosmid insert (35). In total, four different but overlapping cosmids which extended over a continuous 89-kb region of the S. rishiriensis DSM 40489 chromosome were identified.Sequencing of the cosmids and identification of ORFs.
From a
core region of 30.8 kb, both strands were sequenced. This sequencing
revealed the presence of 28 complete open reading frames (ORFs)
upstream of the aminocoumarin resistance gene
gyrBr (Fig. 2).
The cluster showed striking similarity to the novobiocin biosynthetic
gene cluster: 15 of the identified ORFs were found to have, on average,
84% identity to corresponding ORFs of the novobiocin cluster at the
amino acid level (Table 2), and all of
these ORFs were arranged in both clusters in identical order (Fig. 2).
Table 2 shows the homologies found between the genes of the
coumermycin A1 and novobiocin clusters, as well
as homologies to other GenBank entries.
|
|
2,3-dehydrogenation of an activated
derivative of proline. The small ORFs proC and
pltL (encoding 89 and 88 amino acids, respectively) show
similarity to genes for acyl carrier proteins (ACP). Since coumermycin A1 contains two
pyrrole-2-carboxylic acid moieties similar to the one found in
pyoluteorin, it appears likely that the genes proA,
proB, and proC are involved in the biosynthesis of these moieties, as tentatively depicted in Fig. 2. cumJ,
immediately upstream of proA, shares homology with
dpsC, which encodes an enzyme with acyltransferase activity
(3). Therefore, cumJ was tentatively assigned to
the transfer of the postulated activated pyrrole-2-carboxylic acid
moieties to the 3-OH of the deoxysugar moieties (Fig.
3).
|
Insertional inactivation of the proB gene in S. rishiriensis. The striking similarity between the gene cluster identified in this study and the previously identified gene cluster for novobiocin biosynthesis made it very likely that we had indeed cloned the coumermycin biosynthetic gene cluster. Functional proof for this hypothesis was provided by an insertional gene inactivation experiment. The gene proB, located in the central region of the cluster and possibly involved in pyrrole biosynthesis (see above), was chosen for this experiment.
An inactivation vector, pZK4, was constructed in which the structural gene proB was disrupted by insertion of a neomycin resistance gene (aphII, 0.99 kb; Fig. 4). The gene was introduced into S. rishiriensis by homologous recombination. After selection for the neomycin-resistant phenotype, mutant strains were analyzed by Southern hybridization. Two mutant strains, ZW20 and ZW21, which showed the desired gene replacement resulting from a double crossover, were identified (Fig. 4).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The coumarin antibiotics (Fig. 1) are closely related to each other in their chemical structure. The biosynthetic gene cluster of novobiocin, the best-known member of this group, has recently been identified (41). Coumermycin A1 is of special pharmaceutical interest due to its pronounced antibacterial activity and its extremely high affinity for bacterial gyrase (32, 36).
In the present study, we have cloned and sequenced the biosynthetic gene cluster of coumermycin A1 from S. rishiriensis DSM 40489. The cluster showed striking similarity to the novobiocin biosynthetic gene cluster (Fig. 2). In both clusters, nearly all of the ORFs are oriented in the same direction. At the 3' end of each cluster, a gene encoding a coumarin-resistant gyrase B subunit is located. This gene has been described previously as the principal novobiocin resistance gene in the novobiocin producer S. spheroides (44), and expression of the gyrBr resistance gene from the coumermycin cluster in Streptomyces lividans showed that it also conferred resistance to both novobiocin and coumermycin A1 (E. Schmutz, unpublished data).
Immediately upstream of the resistance gene, both clusters contained five highly homologous genes in identical order (cumUVWXY and novSTUVW). Based upon their homology to known genes of deoxysugar biosynthesis, we previously assigned these genes to the first five steps required for the biosynthesis of the deoxysugar moiety of novobiocin (Fig. 1 and 3), and functional proof for this hypothesis was provided by an inactivation experiment with novT (41). Coumermycin A1 contains the same deoxysugar moiety as novobiocin, and in the coumermycin A1 biosynthetic gene cluster, exactly the same deoxysugar biosynthetic genes were found. This finding provides additional support to our functional assignment of these genes (Fig. 3).
One of the last steps of novobiocin biosynthesis is the O methylation of the 4-OH of the deoxysugar moiety, and we have putatively assigned the gene novP to this reaction. The same O-methylation reaction is required in coumermycin A1 biosynthesis; indeed, a gene homologous to novP, i.e., cumN, was found at the corresponding position of the coumermycin cluster. The gene novO, immediately upstream of novP, had been assigned to the C-methylation reaction at position 8 of the coumarin ring of novobiocin, and this assignment is now supported by the presence of a highly homologous gene, cumM, likely to carry out the same reaction in coumermycin biosynthesis.
Attachment of the deoxysugar to the 7-OH of the aminocoumarin ring requires very similar glycosyltransferases in novobiocin and coumermycin biosyntheses; indeed, two very similar glycosyltransferase genes, novM and cumH, are found at the same relative positions of both clusters.
In novobiocin (Fig. 1), the aminocoumarin ring and the substituted benzoate ring are linked by an amide bond. Recently, the gene novL has been functionally identified, by overexpression and purification, as encoding the amide synthetase responsible for both adenylation of the substituted benzoyl moiety and its transfer to the amino group (40). In the structure of coumermycin, two corresponding amide bonds are present, linking the two aminocoumarin rings to a central 3-methylpyrrole-2,4-dicarboxylic acid moiety. The gene cumG shows high homology to novL and is located at the same relative position of the gene cluster. It is most probably involved in the formation of these amide bonds. It cannot be decided at present, however, whether CumG catalyzes the adenylation and transferase reactions for the formation of both amide bonds in the coumermycin molecule or whether additional gene products are involved in these reactions.
The gene cumC displays distinct homology to peptide synthetase genes, and its deduced amino acid sequence shows the presence of the typical conserved motifs of peptide synthetases described by Marahiel et al. (24), including the 4-phosphopantetheinyl attachment site required for covalent binding of the acyl substrate in the form of a thioester (data not shown). cumC is very similar to novH, which is located at the same relative position of the novobiocin cluster. We have recently proven that novH is not involved in the formation of the amide bond between the aminocoumarin ring and the substituted benzoate ring of novobiocin, and we have speculated that NovH may catalyze the activation of tyrosine, or a derivative thereof, during the biosynthesis of one of the two aromatic rings of novobiocin (40). The presence of a very similar gene in the cluster for coumermycin, which contains the aminocoumarin gene but not the substituted benzoate ring, suggests that novH and the corresponding cumC may be involved in the biosynthesis of the aminocoumarin ring found in both antibiotics.
Immediately downstream of cumC is found the gene
cumD, which shows homology to genes for cytochrome P-450
enzymes: the very recently described NikQ catalyzes the
-hydroxylation of histidine during nikkomycin biosynthesis
(17), and the product of ORF20 of the chloroeremomycin
biosynthetic gene cluster (46) may be involved in the
-hydroxylation of tyrosine (17). The biosynthesis of the
aminocoumarin moieties of novobiocin and
coumermycin, which are derived from tyrosine (15,
21), requires the introduction of an oxygen at the
-position
of tyrosine. The cytochrome P-450 enzyme CumD and the corresponding
enzyme NovI of the novobiocin cluster are likely candidates for the
catalysis of this reaction.
The ring oxygen of the aminocoumarin moiety of
novobiocin has been shown to be derived from the carboxy group of
tyrosine, rather than from molecular oxygen (7), suggesting
the formation of the aminocoumarin ring by a unique
oxidative cyclization mechanism rather than by
ortho-hydroxylation of tyrosine followed by simple lactonization. The formation of the aminocoumarin ring
may therefore require the oxidation of a (hypothetical)
-hydroxytyrosine derivative to a
-ketotyrosine derivative and
subsequent oxidative cyclization. CumE (and the corresponding NovJ)
show homology to 3-ketoacyl-(ACP) reductase and may catalyze the first
of the two oxidation steps. The adjacent CumF (and the corresponding
NovK) share homology to redox enzymes and may catalyze the oxidative
cyclization step.
The genes for the biosynthesis of the characteristic
aminocoumarin ring of the aminocoumarin
antibiotics must be present in both the novobiocin and the
coumermycin clusters, and a comparison of both clusters is
therefore an obvious method for identifying possible candidate genes
for the biosynthesis of this moiety. This comparison leads to the
suggestion that the gene products of cumCDEF corresponding
to those of novHIJK may catalyze the formation of the
aminocoumarin ring in a reaction sequence such as that
shown in Fig. 3, i.e., activation of tyrosine and covalent binding in
the form of a thioester,
-hydroxylation, oxidation to a
-ketoacyl
intermediate, and oxidative cyclization. Further experiments are now in
progress to provide functional proof for this hypothesis and to
identify whether the C-methylation reaction catalyzed presumably by
CumM (Fig. 3) occurs before or after coumarin ring formation. It is
noteworthy that in the chloroeremomycin cluster, a gene with homology
to a peptide synthetase gene, ORF19, is situated immediately upstream
of the P-450 gene ORF20, suggesting that
-hydroxylation may require
prior activation of tyrosine in the biosynthesis of chloroeremomycin as
well. Likewise,
-hydroxylation of free histidine could not be
demonstrated after heterologous expression of the P-450 enzyme NikQ
mentioned above, and the involvement of an additional enzyme was
postulated (17).
NovN has been suggested to catalyze the transfer of the carbamoyl group to the deoxysugar moiety of novobiocin (Fig. 1). Coumermycin does not contain this carbamoyl group, and no gene with similarity to novN is found in the coumermycin cluster. However, at the same relative position is found the gene cumJ, which shows homology to acyltransferase genes and which may catalyze the transfer of the pyrrole-2-carboxylic acid moieties to the deoxysugar moieties of coumermycin A1. Immediately downstream of cumJ are found the genes proA, proB, and proC, which share homology with genes supposedly involved in the conversion of proline to pyrrole-2-carboxylic acid in the biosynthesis of pyoluteorin in P. fluorescens Pf-5 (29). These genes may be tentatively assigned to the biosynthesis of the pyrrole-2-carboxylic acid moieties of coumermycin A1 (Fig. 3). The incorporation of proline into coumermycin A1 has been demonstrated previously (38). Further experiments are now in progress to elucidate the exact mechanism of the biosynthesis of these pyrrole rings.
For several other genes in the coumermycin cluster, so far no function can be suggested, e.g., for cumOPQRT. Some of these genes may be involved in the formation of the central 3-methylpyrrole-2,4-dicarboxylic acid unit of coumermycin.
| |
ACKNOWLEDGMENTS |
|---|
We thank C. R. Hutchinson for providing plasmid pWHM249, A. Bechthold for supplying the cosmid vector pOJ446, W. Wohlleben for providing the strain E. coli ET12567, and A. Mühlenweg for preparing the hybridization probe for gyrB. W. Wohlleben, A. Bechthold, and coworkers provided important technical advice for this project.
This work was supported by a grant from the Deutsche Forschungsgemeinschaft (to L. Heide and S.-M. Li).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Pharmazeutische Biologie, Pharmazeutisches Institut, Eberhard-Karls-Universität Tübingen, Auf der Morgenstelle 8, 72076 Tübingen, Germany. Phone: 49-7071-29-72460. Fax: 49-7071-29-5250. E-mail: heide{at}uni-tuebingen.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ali, J. A., A. P. Jackson, A. J. Howells, and A. Maxwell. 1993. The 43-kilodalton N-terminal fragment of the DNA gyrase B protein hydrolyzes ATP and binds coumarin drugs. Biochemistry 32:2717-2724[CrossRef][Medline]. |
| 2. | Althaus, I. W., L. Dolak, and F. Reusser. 1988. Coumarins as inhibitors of bacterial DNA gyrase. J. Antibiot. 41:373-376[Medline]. |
| 3. |
Bao, W.,
P. J. Sheldon, and C. R. Hutchinson.
1999.
Purification and properties of the Streptomyces peucetius DpsC -ketoacyl:acyl carrier protein synthase III that specifies the propionate-starter unit for type II polyketide biosynthesis.
Biochemistry
38:9752-9757[CrossRef][Medline].
|
| 4. | Bentley, R., and J. W. Bennett. 1999. Constructing polyketides: from collie to combinatorial biosynthesis. Annu. Rev. Microbiol. 53:411-446[CrossRef][Medline]. |
| 5. | Berger, J., and A. D. Batcho. 1978. Coumarin-glycoside antibiotics. J. Chromatogr. 15:101-158. |
| 6. | Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. Nagaraja Rao, and B. E. Schoner. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49[CrossRef][Medline]. |
| 7. | Bunton, C. A., G. W. Kenner, M. J. T. Robinson, and B. R. Webster. 1963. Experiments related to the biosynthesis of novobiocin and other coumarins. Tetrahedron 19:1001-1010[CrossRef]. |
| 8. | Celia, H., L. Hoermann, P. Schultz, L. Lebeau, V. Mallouh, D. B. Wigley, J. C. Wang, C. Mioskowski, and P. Oudet. 1994. Three-dimensional model of Escherichia coli gyrase B subunit crystallized in two-dimensions on novobiocin-linked phospholipid films. J. Mol. Biol. 236:618-628[CrossRef][Medline]. |
| 9. | Ferroud, D., J. Collard, M. Klich, C. Dupuis-Hamelin, P. Mauvais, P. Lassaigne, A. Bonnefoy, and B. Musicki. 1999. Synthesis and biological evaluation of coumarincarboxylic acids as inhibitors of gyrase B. L-Rhamnose as an effective substitute for L-noviose. Bioorg. Med. Chem. Lett. 9:2881-2886[CrossRef][Medline]. |
| 10. | Gormley, N. A., G. Orphanides, A. Meyer, P. M. Cullis, and A. Maxwell. 1996. The interaction of coumarin antibiotics with fragments of the DNA gyrase B protein. Biochemistry 35:5083-5092[CrossRef][Medline]. |
| 11. |
Hooper, D. C.,
J. S. Wolfson,
G. L. McHugh,
M. B. Winters, and M. N. Swartz.
1982.
Effects of novobiocin, coumermycin A1, clorobiocin, and their analogs on Escherichia coli DNA gyrase and bacterial growth.
Antimicrob. Agents Chemother.
22:662-671 |
| 12. |
Hopwood, D. A.,
M. J. Bibb,
K. F. Chater,
T. Kieser,
C. J. Bruton,
H. M. Kieser,
D. J. Lydiate,
C. P. Smith,
J. M. Ward, and H. Schrempf.
1985.
Genetic manipulation of Streptomyces a laboratory manual.
The John Innes Foundation, Norwich, England.
|
| 13. | Kawaguchi, H., H. Tsukiura, M. Okanishi, T. Miyaki, T. Ohmori, K. Fujisawa, and H. Koshiyama. 1965. Studies on coumermycin, a new antibiotic. I. Production, isolation and characterization of coumermycin A1. J. Antibiot. Ser. A 18:1-10. |
| 14. | Khosla, C. 1998. Combinatorial biosynthesis of "unnatural" natural products, p. 401-417. In E. M. Gordon, and J. F. Kerwin (ed.), Combinatorial chemistry and molecular diversity in drug discovery. Wiley-Liss, Inc., New York, N.Y. |
| 15. | Kominek, L. A., and O. K. Sebek. 1974. Biosynthesis of novobiocin and related coumarin antibiotics. Dev. Ind. Microbiol. 15:60-69. |
| 16. | Konz, D., and M. A. Marahiel. 1999. How do peptide synthetases generate structural diversity? Chem. Biol. 6:R39-R48[CrossRef][Medline]. |
| 17. | Lauer, B., R. Russwurm, and C. Bormann. 2000. Molecular characterization of two genes from Streptomyces tendae Tü901 required for the formation of the 4-formyl-4-imidazolin-2-one-containing nucleoside moiety of the peptidyl nucleoside antibiotic nikkomycin. Eur. J. Biochem. 267:1698-1706[Medline]. |
| 18. | Laurin, P., D. Ferroud, M. Klich, C. Dupuis-Hamelin, P. Mauvais, P. Lassaigne, A. Bonnefoy, and B. Musicki. 1999. Synthesis and in vitro evaluation of novel highly potent coumarin inhibitors of gyrase B. Bioorg. Med. Chem. Lett. 9:2079-2084[CrossRef][Medline]. |
| 19. | Laurin, P., D. Ferroud, L. Schio, M. Klich, C. Dupuis-Hamelin, P. Mauvais, P. Lassaigne, A. Bonnefoy, and B. Musicki. 1999. Structure-activity relationship in two series of aminoalkyl substituted coumarin inhibitors of gyrase B. Bioorg. Med. Chem. Lett. 9:2875-2880[CrossRef][Medline]. |
| 20. | Lewis, R. J., O. M. P. Singh, C. V. Smith, T. Skarzynski, A. Maxwell, A. J. Wonacott, and D. B. Wigley. 1996. The nature of inhibition of DNA gyrase by the coumarins and the cyclothialidines revealed by X-ray crystallography. EMBO J. 15:1412-1420[Medline]. |
| 21. | Li, S.-M., S. Hennig, and L. Heide. 1998. Biosynthesis of the dimethylallyl moiety of novobiocin via a non-mevalonate pathway. Tetrahedron Lett. 39:2717-2720[CrossRef]. |
| 22. | Lomovskaya, N., L. Fonstein, X. Ruan, D. Stassi, L. Katz, and C. R. Hutchinson. 1997. Gene disruption and replacement in the rapamycin-producing Streptomyces hygroscopicus strain ATCC 29253. Microbiology 143:875-883[Medline]. |
| 23. | MacNeil, D. J., K. M. Gewain, C. L. Ruby, G. Dezeny, P. H. Gibbons, and T. MacNeil. 1992. Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111:61-68[CrossRef][Medline]. |
| 24. | Marahiel, M. A., T. Stachelhaus, and H. D. Mootz. 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem. Rev. 97:2651-2673[CrossRef][Medline]. |
| 25. | Maxwell, A. 1997. DNA gyrase as a drug target. Trends Microbiol. 5:102-109[CrossRef][Medline]. |
| 26. |
McDaniel, R.,
A. Thamchaipenet,
C. Gustafsson,
H. Fu,
M. Betlach,
M. Betlach, and G. Ashley.
1999.
Multiple genetic modifications of the erythromycin polyketide synthase to produce a library of novel "unnatural" natural products.
Proc. Natl. Acad. Sci. USA
96:1846-1851 |
| 27. | Montecalvo, M. A., H. Horowitz, G. P. Wormser, K. Seiter, and C. A. Carbonaro. 1995. Effect of novobiocin-containing antimicrobial regimens on infection and colonization with vancomycin-resistant Enterococcus faecium. Antimicrob. Agents Chemother. 39:794[Medline]. |
| 28. | Mootz, H. D., and M. A. Marahiel. 1999. Design and application of multimodular peptide synthetases. Curr. Opin. Biotechnol. 10:341-348[CrossRef][Medline]. |
| 29. |
Nowak-Thompson, B.,
N. Chaney,
J. S. Wing,
S. J. Gould, and J. E. Loper.
1999.
Characterization of the pyoluteorin biosynthetic gene cluster of Pseudomonas fluorescens Pf-5.
J. Bacteriol.
181:2166-2174 |
| 30. |
Oh, S.-H., and K. F. Chater.
1997.
Denaturation of circular or linear DNA facilitates targeted integrative transformation of Streptomyces coelicolor A3(2): possible relevance to other organisms.
J. Bacteriol.
179:122-127 |
| 31. | Peixoto, C., P. Laurin, M. Klich, C. Dupuis-Hamelin, P. Mauvais, P. Lassaigne, A. Bonnefoy, and B. Musicki. 2000. Synthesis of isothiochroman 2,2-dioxide and 1,2-benzooxathiin 2,2-dioxide gyrase B inhibitors. Tetrahedron Lett. 41:1741-1745[CrossRef]. |
| 32. |
Peng, H., and K. J. Marians.
1993.
Escherichia coli topoisomerase IV: purification, characterization, subunit structure, and subunit interactions.
J. Biol. Chem.
268:24481-24490 |
| 33. | Periers, A.-M., P. Laurin, D. Ferroud, J.-L. Haesslein, M. Klich, C. Dupuis-Hamelin, P. Mauvais, P. Lassaigne, A. Bonnefoy, and B. Musicki. 2000. Coumarin inhibitors of gyrase B with N-propargyloxy-carbamate as an effective pyrrole bioisostere. Bioorg. Med. Chem. Lett. 10:161-165[CrossRef][Medline]. |
| 34. | Raad, I. I., R. Y. Hachem, D. Abi-Said, K. V. I. Rolston, E. Whimbey, A. C. Buzaid, and S. Legha. 1998. A prospective crossover randomized trial of novobiocin and rifampin prophylaxis for the prevention of intravascular catheter infections in cancer patients treated with interleukin-2. Cancer 82:403-411[CrossRef][Medline]. |
| 35. |
Redenbach, M.,
K. Ikeda,
M. Yamasaki, and H. Kinashi.
1998.
Cloning and physical mapping of the EcoRI fragments of the giant linear plasmid SCP1.
J. Bacteriol.
180:2796-2799 |
| 36. | Ryan, M. J. 1979. Novobiocin and coumermycin A1, p. 214-234. In F. E. Hahn (ed.), Antibiotics, vol. V, part 1. Mechanism of action of antibacterial agents. Springer-Verlag, Berlin, Germany. |
| 37. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 38. | Scannell, J., and Y. L. Kong. 1970. Biosynthesis of coumermycin A1: incorporation of L-proline into the pyrrole groups. Antimicrob. Agents Chemother. 1969:139-143. |
| 39. | Schneider, A., T. Stachelhaus, and M. A. Marahiel. 1998. Targeted alteration of the substrate specificity of peptide synthetase by rational module swapping. Mol. Gen. Genet. 257:308-318[CrossRef][Medline]. |
| 40. |
Steffensky, M.,
S.-M. Li, and L. Heide.
2000.
Cloning, overexpression, and purification of novobiocic acid synthetase from Streptomyces spheroides NCIMB 11891.
J. Biol. Chem.
275:21754-21760 |
| 41. |
Steffensky, M.,
A. Mühlenweg,
Z.-X. Wang,
S.-M. Li, and L. Heide.
2000.
Identification of the novobiocin biosynthetic gene cluster of Streptomyces spheroides NCIB 11891.
Antimicrob. Agents Chemother.
44:1214-1222 |
| 42. |
Symmank, H.,
W. Saenger, and F. Bernhard.
1999.
Analysis of engineered multifunctional peptide synthetases.
J. Biol. Chem.
274:21581-21588 |
| 43. | Tercero, J. A., R. A. Lacalle, and A. Jimenez. 1993. The pur8 gene from the pur cluster of Streptomyces alboniger encodes a highly hydrophobic polypeptide which confers resistance to puromycin. Eur. J. Biochem. 218:963-971[Medline]. |
| 44. | Thiara, A. S., and E. Cundliffe. 1993. Expression and analysis of two gyrB genes from the novobiocin producer, Streptomyces sphaeroides. Mol. Microbiol. 8:495-506[CrossRef][Medline]. |
| 45. | Tsai, F. T. F., O. M. P. Singh, T. Skarzynski, A. J. Wonacott, S. Weston, A. Tucker, R. A. Pauptit, A. L. Breeze, J. P. Poyser, R. O'Brien, J. E. Ladbury, and D. B. Wigley. 1997. The high-resolution crystal structure of a 24-kDa gyrase B fragment from E. coli complexed with one of the most potent coumarin inhibitors, clorobiocin. Proteins 28:41-52[CrossRef][Medline]. |
| 46. | Van Wageningen, A. M., P. N. Kirkpatrick, D. H. Williams, B. R. Harris, J. K. Kershaw, N. J. Lennard, M. Jones, S. J. M. Jones, and P. J. Solenberg. 1998. Sequencing and analysis of genes involved in the biosynthesis of a vancomycin group antibiotic. Chem. Biol. 5:155-162[CrossRef][Medline]. |
| 47. |
Walsh, T. J.,
H. C. Standiford,
A. C. Reboli,
J. F. John,
M. E. Mulligan,
B. S. Ribner,
J. Z. Montgomerie,
M. B. Goetz,
C. G. Mayhall,
D. Rimland,
D. A. Stevens,
S. L. Hansen,
G. C. Gerard, and R. J. Ragual.
1993.
Randomized double-blinded trial of rifampin with either novobiocin or trimethoprim-sulfamethoxazole against methicillin-resistant Staphylococcus aureus colonization: prevention of antimicrobial resistance and effect of host factors on outcome.
Antimicrob. Agents Chemother.
37:1334-1342 |
| 48. | Wigley, D. B., G. J. Davies, E. J. Dodson, A. Maxwell, and G. Dodson. 1991. Crystal structure of an N-terminal fragment of the DNA gyrase B protein. Nature 351:624-629[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clin. Vaccine Immunol. | Clin. Microbiol. Rev. |
|---|---|
| J. Clin. Microbiol. | ALL ASM JOURNALS |