Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2000, p. 3101-3106, Vol. 44, No. 11
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Evernimicin (SCH27899) Inhibits a Novel Ribosome Target Site:
Analysis of 23S Ribosomal DNA Mutants
Peter V.
Adrian,1,*
Cara
Mendrick,2
David
Loebenberg,2
Paul
McNicholas,2
Karen J.
Shaw,2
Keith P.
Klugman,1
Roberta S.
Hare,2 and
Todd A.
Black2
Pneumococcal Diseases Research Unit, South
African Institute for Medical Research, University of the
Witwatersrand, and the Medical Research Council, Johannesburg, South
Africa,1 and Schering Plough
Research Institute, Kenilworth, New Jersey2
Received 5 June 2000/Returned for modification 25 July
2000/Accepted 21 August 2000
 |
ABSTRACT |
Spontaneous mutants of susceptible clinical and laboratory isolates
of Streptococcus pneumoniae exhibiting reduced
susceptibility to evernimicin (SCH27899; MIC, 0.5 to 4.0 mg/liter) were
selected on plates containing evernimicin. Four isolates that did not
harbor mutations in rplP (which encodes ribosomal protein
L16) were further analyzed. Whole chromosomal DNA or PCR products of
the 23S ribosomal DNA (rDNA) operons from these mutants could be used
to transform the susceptible S. pneumoniae strain R6 to
resistance at frequencies of 10
5 and 10
4,
respectively, rates 10- to 100-fold lower than that for a single-allele chromosomal marker. The transformants appeared slowly (48 to 72 h)
on selective medium, and primary transformants passaged on nonselective
medium produced single colonies that displayed heterogeneous susceptibilities to evernimicin. A single passage on selective medium
of colonies derived from a single primary transformant homogenized the
resistance phenotype. Sequence analysis of the 23S rDNA and rRNA from
the resistant mutants revealed single, unique mutations in each isolate
at the equivalent Escherichia coli positions 2469 (A
C), 2480 (C
T), 2535 (G
A), and 2536 (G
C). The mutations
map within two different stems of the peptidyltransferase region of
domain V. Because multiple copies of rDNA are present in the
chromosome, gene conversion between mutant and wild-type 23S rDNA
alleles may be necessary for stable resistance. Additionally, none of
the characterized mutants showed cross-resistance to any of a spectrum
of protein synthesis inhibitors, suggesting that the target site of
evernimicin may be unique.
 |
INTRODUCTION |
Everninomicins are a class of
oligosaccharide antibiotics isolated from Micromonospora
carbonaceae (25). One such compound, evernimicin
(SCH27899), has been evaluated as a therapeutic agent (Ziracin)
(6). Evernimicin has been shown to have potent activity against many gram-positive bacteria, including vancomycin-resistant enterococci, methicillin-resistant staphylococci, and
penicillin-resistant pneumococci (9). In fact, there were no
staphylococcal, enterococcal, or pneumococcal isolates that displayed
resistance to evernimicin in either the investigation by Jones and
Barrett (9) or a more recent worldwide survey of clinical
isolates, including isolates known to be resistant to other antibiotics
(R. S. Hare, F. J. Sabatelli, and The Ziracin Susceptibility
Testing Group, Abstr. 38th Intersci. Conf. Antimicrob. Agents
Chemother., Abstr. E-119, p. 204, 1998). The lack of cross-resistance
to evernimicin suggests that the mechanism of action is novel, and
prior selection for resistance to antimicrobial agents currently in
clinical use will not impact the efficacy of evernimicin. Recently, in
Streptococcus pneumoniae, we have shown that mutations in
ribosomal protein L16 (encoded by rplP) cause a reduced
susceptibility to evernimicin and that evernimicin has an inhibitory
effect on in vivo protein synthesis (1). Another study
demonstrated evernimicin-mediated inhibition of protein synthesis in
cell-free assays derived from Escherichia coli and
Staphylococcus aureus (13). Furthermore, radiolabeled evernimicin was found to bind the large ribosomal subunit
at a single, unique high-affinity site (13).
The rrn operon is unique because unlike most chromosomal
genes, which are present in a single copy, rrn operons are
typically present as multiple loci in the genome. Therefore,
rrn operon mutations that confer resistance to protein
synthesis inhibitors are typically recessive or weakly codominant since
the majority of the ribosomes must harbor the mutant allele for normal
growth to occur in the presence of the inhibitor (19).
Consequently, selectable spontaneous mutations in rrn loci
in organisms with a high copy number of rrn operons are rare
and have not had a clinical impact. Alternative resistance mechanisms,
such as alterations to the ribosomal proteins (5), ribosome
modification or protection (e.g., rRNA methylation
[26]), and drug metabolism or efflux, are more
clinically relevant. In contrast, ribosomal DNA (rDNA) mutations
resulting in resistance to antimicrobial agents occur more frequently
in bacteria that harbor a single rrn operon (e.g., Mycobacterium abscessus, Mycobacterium chelonae
[24], Mycobacterium avium
[14], and Halobacterium halobium
[12]) or two rrn operons (e.g.,
Helicobacter pylori [23] and
Mycobacterium smegmatis [17]). However,
even in organisms with two rrn operons, the mode of action
of the drug can influence whether a heterogeneous rRNA population
confers resistance. Heterogeneous rrn alleles of M. smegmatis conferring erythromycin resistance appear to be a
dominant phenotype (18), whereas heterogeneous
rrn alleles conferring aminoglycoside resistance appear as a
recessive phenotype (17). In a strain of
Staphylococcus aureus that harbored an additional
rplP allele on a plasmid, mutations to L16 which conferred evernimicin resistance were recessive (unpublished data).
In this paper, we report the isolation and characterization of rDNA
mutations in S. pneumoniae that confer reduced
susceptibility to evernimicin. The locations of the mutations within
the 23S rRNA have not been found to confer resistance to other protein synthesis inhibitors. If the positions of the mutations in the rRNA are
considered to be potential points of contact with evernimicin or
specific modifiers of the ribosomal structure required to interact with
evernimicin, then the sites of interaction between evernimicin and the
50S ribosomal subunit appear to be unique. Identification of the unique
sites of interaction may help to clarify the detailed mechanism of
action of evernimicin.
 |
MATERIALS AND METHODS |
Bacterial strains.
S. pneumoniae ATCC 49619 and
clinical isolate SP#3 (1) were used in the
spontaneous-mutant selection experiments. A nonencapsulated laboratory
strain of S. pneumoniae R6 was used for transformation experiments.
Selection of spontaneous mutants exhibiting resistance to
evernimicin.
S. pneumoniae ATCC 49619 and clinical isolate
SP#3 were grown to the mid-exponential phase of growth in Todd-Hewitt
broth, pelleted, and resuspended at a concentration of approximately 1012 CFU/ml. Aliquots (0.1 ml) were plated on
Mueller-Hinton agar (MHA) supplemented with 5% sheep blood and 0.125, 0.25, or 0.5 µg of evernimicin/ml. Spontaneous mutants appeared after
incubating the plates at 37°C for 72 h in an atmosphere of 5%
CO2. MICs for evernimicin were determined by E-test (AB
Biodisk, Solna, Sweden) on MHA supplemented with 5% sheep blood as
recommended by the manufacturer. Plates were incubated for 24 h,
as described above and MICs were determined according to the
manufacturer's guidelines.
DNA extraction.
Whole chromosomal DNA from S. pneumoniae strains was prepared by detergent lysis followed by
phenol-chloroform extraction as described previously (3).
The DNA was further purified by treatment with RNase followed by
precipitation with 0.6 volumes of 20% polyethylene glycol 6000-2.5 M NaCl.
PCR amplification.
rDNA was amplified with an Expand Long
Template PCR system (Boehringer Mannheim, Mannheim, Germany) in 50-µl
reaction volumes containing 3 U of DNA polymerase mix, 1× polymerase
buffer no. 1, 350 µM each deoxynucleoside triphosphate, 300 nM each
primer, and 50 ng of template DNA. PCR conditions were 93°C for
60 s followed by 25 cycles of 92°C for 2 s, 55°C for
30 s, and 68°C for 195 s. For each of the last 15 cycles,
the 68°C extension time was extended by 12 s. The primer
sequences for the universal amplification of DNA operons (Table
1) are based on the preliminary sequence of S. pneumoniae obtained from The Institute for Genomic
Research website at http://www.tigr.org.
Transformation.
S. pneumoniae R6 was grown to an
optical density at 650 nm of 0.08 in Todd-Hewitt broth (Difco
Laboratories, Detroit, Mich.) supplemented with 5% horse serum.
Aliquots were stored at
70°C with 10% glycerol for use in
transformation experiments. Transformations were performed by
incubating thawed cells (1 ml) with competence-stimulating peptide (1 µg/ml) (8) and donor DNA (1 µg/ml) at 30°C for 30 min.
The cells were allowed to recover for 60 min at 37°C in the transformation medium before being plated on MHA supplemented with 5%
sheep blood and the appropriate antibiotic. Transformation frequencies
are expressed as ratios of the number of transformants obtained on
selective medium to the number of colonies obtained without selection.
For positive controls with chromosomal DNA, strains harboring mutations
in rpsL and rplP, which confer resistance to
streptomycin and evernimicin, respectively, were used. For transformation experiments using isolated rDNA operons, an erythromycin resistance-conferring allele (A2058G at the equivalent E. coli 23S rDNA position) was constructed by the megaprimer method
of site-directed mutagenesis (20) with primers F1, R1, and
E1 (Table 1). The presence of the mutation in erythromycin-resistant
transformants was verified by DNA sequencing.
DNA sequencing and analysis.
Sequencing reactions were
performed by cycle sequencing with a Big Dye termination kit
(Perkin-Elmer Applied Biosystems, Branchburg, N.J.) according to the
manufacturer's recommendations. The reaction products were separated
on an ABI PRISM 310 (Perkin-Elmer Applied Biosystems) automated
sequencer. Double-stranded sequencing was performed on the DNA from
resistant mutants and their isogenic parent strains. Sequencher
software (Gene Codes Corp., Ann Arbor, Mich.) was used for sequence
comparisons and alignments.
rRNA sequencing.
Cells were grown in 200 ml of brain heart
infusion broth (Difco) to an optical density at 600 nm of 0.1. Cells
were harvested, resuspended in 1 ml H2O with 0.1% Triton
X-100, and incubated for 15 min at room temperature, and then their RNA
was extracted sequentially with H2O-saturated phenol
(acidic), phenol-chloroform, and chloroform. The RNA was precipitated
and sequenced by a primer extension method, as described previously
(21), with a primer (5' GGTCCTCTCGTACTAGGAGCAG 3')
which is complementary to the E. coli 23S rRNA
-sarcine loop (E. coli position 2660).
 |
RESULTS |
Selection for evernimicin resistance.
At evernimicin
concentrations of 0.125, 0.25, and 0.5 µg/ml, colonies became visible
on plates only after 72 h of incubation. The frequency at which
colonies appeared was ~5.3 × 10
9 for both
S. pneumoniae ATCC 49619 and clinical isolate SP#3. The MIC
of evernimicin for susceptible strains ATCC 49619, SP#3, and R6 was
0.03 µg/ml.
Transformation with rplP.
Eight spontaneously resistant
isolates obtained from each parental strain were propagated with
selection for evernimicin resistance (0.125 µg/ml) for further
analysis. As a means of discriminating between mutations in
rplP and other loci, PCR products encompassing rplP and 1 kb of flanking sequence from each strain were
amplified and used to transform the evernimicin-sensitive recipient
strain R6. None of the PCR products from the ATCC 49619-derived mutants conferred resistance to evernimicin. PCR products from two of the
SP#3-derived mutants transformed R6 to evernimicin resistance at a
frequency of 10
3. The transformants were selected on
medium containing 0.125 µg of evernimicin/ml, and colonies were
visible after 24 h. DNA sequence analysis of the two transforming
PCR products revealed two new mutations in rplP: a
GCT-to-CAT change resulted in an Ala49-to-His substitution, and an
ATC-to-ATG change resulted in an Ile49-to-Met substitution. The
evernimicin MICs for the transformants were 0.75 and 0.19 µg/ml, respectively.
Non-rplP alleles.
For each parental strain, two
spontaneously resistant isolates that did not contain selectable
mutations in rplP were analyzed further. Chromosomal DNA
from the four non-rplP isolates was used to transform R6 and
select for evernimicin resistance; the rate of transformation to
evernimicin resistance was approximately 10
5 (Table
2). This rate is markedly different from
those obtained in previous transformation experiments using
rplP and rpsL controls (in which transformation
efficiencies were approximately 10
3). In addition, unlike
the rpsL and rplP resistance markers, for which
transformants arose within 24 h, the time periods required for the
appearance of colonies when using chromosomal DNA from the four
non-rplP isolates were 48 and 72 h on media containing 0.06 and 0.125 µg of evernimicin/ml, respectively (Table 2). Thus,
the primary transformants mimicked the slow growth rate of the
spontaneously derived isolates. However, when either the spontaneous
isolates or the primary transformants were replated (either with or
without 0.125 µg of evernimicin/ml), they grew within 24 h;
despite the initial slow growth rate on the primary selection medium,
the growth rate of these strains on selective or nonselective medium
was now normal.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Frequency of transformation of S. pneumoniae
R6 to evernimicin resistance with whole chromosomal DNA from four
selected spontaneous mutants and their parent strains at different
drug concentrations
|
|
rDNA transformation.
We next determined if the uncharacterized
isolates had alterations in the rrn operon sequence. In
S. pneumoniae there are four rrn operons
(4). The rrn operons from the four resistant strains were amplified with universal primers F1 and R1 (Table 1), and
the 5,221-bp amplicons were used to transform S. pneumoniae R6. In all four cases, after 48 to 72 h, evernimicin-resistant colonies arose at a frequency of 10
4 to 10
5
(Table 3). In a control experiment,
S. pneumoniae R6 was transformed with an rrn
operon that carried a mutation conferring erythromycin resistance
(nucleotide 2058 was changed from A to G) (Table
4). The rate of transformation of
S. pneumoniae R6 to erythromycin resistance mimicked that
for evernimicin resistance in that transformation rates of
10
4 to 10
5 occurred with prolonged
incubation (48 to 72 h) at drug concentrations lying between the
MIC and the minimum bactericidal concentration. Similar to the
transformation experiments with chromosomal DNA, both the
evernimicin-resistant and the erythromycin-resistant primary
transformants exhibited a slow initial growth phase on selective medium
followed by a normal growth rate after a second passage on medium (with
or without the selective drug). To further localize the resistance
allele, two smaller overlapping PCR products of 2,388 and 3,123 bp were
generated; one (obtained using primer pair F1-R2 [Table 1]) consisted
of the 16S rDNA and part of the 5' end of the 23S rDNA, pair, and the
other (obtained using primer pair F2-R1) consisted of the 23S and 5S
rDNA. Evernimicin-resistant transformants were obtained only with the
F2-R1 PCR products, implying that the mutations are located in either
the 5S or 23S rDNA.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Frequency of transformation of S. pneumoniae
R6 to evernimicin resistance with rDNA operons from four selected
spontaneous mutants and their parent strains at different
drug concentrations
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Frequency of transformation of S. pneumoniae
R6 to erythromycin resistance with a 23S rDNA allele containing an
A2058G substitution at the equivalent E. coli position
|
|
Characterization of rDNA mutations by DNA and RNA sequencing.
The universal 23S rDNA PCR products from the four spontaneous mutants
detailed above and the ATCC 49619 and SP#3 parent strains were
sequenced. Compared to the parental strains, the four spontaneous mutants each exhibited a single nucleotide change at the following equivalent E. coli positions: 2469 (A
C), 2480 (C
T), 2535 (G
A), and 2536 (G
C) (Table
5; Fig. 1).
These mutations are located on two different stems in domain V of the
23S rRNA that are proximal to the peptidyltransferase loop. Distinct
single-nucleotide peaks in the sequencing chromatograms of the mutant
and parent strains suggested that the intragenomic populations of 23S
rDNA alleles were homogeneous. Sequence analysis of the 23S rDNA in the
R6 isolates that were transformed with the 23S rDNA PCR products confirmed the presence of identical mutations in the
evernimicin-resistant transformants. rRNAs from these
evernimicin-resistant transformants were extracted and sequenced to
confirm that the mutant rrn alleles were homogeneous. The
mutant 23S rRNA represented >90% of the sequence band for all four
mutants strains.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Peptidyltransferase region of domain V of the 23S rRNA
(E. coli numbering). The residues that when mutated confer
resistance (R) to protein synthesis inhibitors are circled. Mutations
that confer resistance to evernimicin are indicated
(SCH27899R). Residues which are protected (P) from
modification by bound drug are boxed (26). Residues
protected by tRNA bound in the A and P sites are labeled with the
symbols and , respectively (15). M, macrolides; L,
lincosamides; S, streptogramin B; Cam, chloramphenicol; Ery,
erythromycin.
|
|
MICs of evernimicin for 23S rDNA mutants.
The primary
transformants, after initial selection on medium containing
evernimicin, yielded two different phenotypes with respect to
evernimicin resistance, depending on whether they were next passaged on
selective or nonselective medium. Those passaged on selective medium
produced homogeneous populations of evernimicin-resistant organisms,
such that the MICs for the collection of transformants obtained for
each specific mutation were consistent. After this second round of
growth, the MIC remained consistent irrespective of further exposure to
the drug. The second phenotypic class arose from primary transformants
passaged on nonselective medium. These transformants produced a
heterogeneous phenotype with respect to the evernimicin MIC. This was
evident on the evernimicin E-tests, which showed uniform growth in the
zone of a predicted sensitive strain but showed a concentration
gradient of satellite colonies extending from evernimicin sensitive to
the maximum MIC obtained for transformants that been maintained on
selective medium. The evernimicin MICs for the original spontaneous
mutant and the corresponding 23S rDNA transformants are shown in Table
5. The 23S rDNA mutants were tested alongside the original parental
strains for any changes in sensitivity to other antimicrobial agents.
No change in MIC was observed with any of the following antimicrobial
agents: ampicillin, benzylpenicillin, chloramphenicol, clarithromycin,
ciprofloxacin, clindamycin, erythromycin, fusidic acid, gentamicin,
lincomycin, rifampin, spectinomycin, streptomycin, Synercid,
tetracycline, or vancomycin.
 |
DISCUSSION |
The identification of rDNA mutations that confer resistance to
evernimicin allows further speculation about the precise mechanism of
action of the drug. Experiments with cross-linkable oligonucleotide probes complimentary to 23S rRNA nucleotides 2475 to 2483 identified interactions between this region of domain V and ribosomal protein L16
(16). The identification of mutations conferring resistance to evernimicin that occur in L16 (1) and positions around
the 2465-to-2485 stem of the 23S rRNA (Fig. 1) strengthen the postulate that these two ribosomal components are structurally and functionally linked. Anticodon stem-loop analogues bound to the A site of the ribosome have been shown to interact with the 2465-to-2485 stem of
domain V (10), suggesting that this loop forms part of the A
site of the ribosome. This finding is congruent with the proposed function of L16, which is not essential for peptidyltransferase activity (11) or GTP-mediated tRNA hydrolysis
(22) but appears to be involved in the fixation of the
aminoacyl stem of the tRNA to the ribosome at its A site
(11). Therefore, it is possible that evernimicin inhibits
protein synthesis by interfering with the binding or positioning of the
3' end of the tRNA in the A site of the ribosome. This mechanism is not
refuted by the presence of point mutations on the 23S rRNA stem at
positions 2535 and 2536 that also confer resistance to evernimicin,
since the function of this stem and its point of interaction with other
domains in the ribosome are not clearly defined. It is possible that
this rRNA region also forms part of the A site and thus results in resistance to evernimicin in a manner similar to the position 2469 and
2480 mutations. Alternatively, the residues of this stem may not
interact at all with evernimicin but rather cause distortions elsewhere
in the ribosome which prevent the binding of evernimicin in the A site
of the ribosome.
A summary of rRNA footprints and mutations which confer resistance to
protein synthesis inhibitors that act at the peptidyltransferase center
is shown in Fig. 1. The consistent equivalence of nucleotides protected
by drug binding and implicated in drug resistance suggests that the
evernimicin resistance-conferring mutations are likely to pinpoint the
site of drug interaction with the 23S rRNA. The unique locations of
mutations which confer evernimicin resistance, compared to those for
other peptidyltransferase inhibitors, imply that evernimicin has unique
mechanistic properties. This observation appears to be confirmed by the
lack of cross-resistance associated with evernimicin-resistant mutants
and other inhibitors of protein synthesis.
Isolation of selectable spontaneous rrn mutations is
primarily limited to organisms with one or two rrn alleles.
However, experimental models using either plasmid-borne rrn
alleles overexpressing a mutant rrn that dominates the
sensitive phenotype (12, 19) or engineered strains with
reduced numbers of chromosomal rrn operons (2,
17) have been used to examine the effect of rrn mutations on translation and antibiotic resistance. The emergence of
S. pneumoniae strains that maintain homogeneous
rrn alleles conferring resistance to evernimicin may be a
result of high-frequency intragenomic allelic exchange or gene
conversion. Genetic exchange between rRNA alleles has been observed to
occur at a frequency of 6 × 10
5 in E. coli (7). In M. smegmatis,
recA-mediated gene conversion between
aminoglycoside-resistant and -sensitive rRNA alleles has been shown to
occur at a frequency of 10
4 (17). S. pneumoniae is known to achieve very high rates of homologous
recombination following transformation, and therefore intragenomic gene
conversion frequencies may also be relatively high in this bacterium.
The spontaneous mutants were selected after a long incubation period
(72 h) in medium with drug concentrations of two to eight times the
MIC. It is conceivable that under these conditions sufficient growth
and genetic recombination occur to allow recombinant conversion of
susceptible rrn alleles to alleles conferring resistance.
Once two copies of the resistance-conferring rrn allele are
established, cell growth is likely to increase in parallel with the
rate of conversion of other rrn alleles. Under continued
selective pressure, a homogeneous condition is likely to develop, and
rrn-mediated resistance becomes stable. The removal of
selective pressure before allele conversion is complete is likely to
explain the heterogeneous evernimicin resistance phenotype found in
each transformed colony after the initial selective pressure. An
extended period of selective pressure at drug concentrations lying
between the MIC and the minimum bactericidal concentration appears to
be crucial for the isolation of stable evernimicin-resistant S. pneumoniae mutants that are homogeneous at the rrn
alleles. Similarly, the erythromycin-resistant transformation controls
also required a prolonged recovery time and could not be selected on
medium with >2.0 µg of erythromycin/ml, despite the fact that
strains homogeneous for the resistant rrn allele exhibited
erythromycin MICs of >256 µg/ml.
Although higher transformation frequencies might be expected for a
multicopy target site (in this case, rrn alleles), the lower
rate of transformation to evernimicin resistance may result from a
higher rate of reversion of the single modified rrn allele mediated by recombination with one of the three susceptible alleles. The slow emergence of resistant rrn mutants is most likely
due to a combination of both the time taken to convert a sufficient proportion of the rrn alleles to confer a resistance
phenotype and the time it takes for the cell to replace
drug-susceptible ribosomes with resistant variants. Cells that were
transformed with PCR products of rrn alleles arose more
quickly than those transformed with whole chromosomal DNA, which may
reflect a higher initial rate of direct conversion of susceptible
alleles by the transforming DNA.
 |
ACKNOWLEDGMENTS |
We thank Liqun Xiong and Alexander Mankin for performing the 23S
rRNA sequencing.
 |
FOOTNOTES |
*
Corresponding author. Present address: Laboratory of
Pediatrics, Erasmus University Rotterdam, Posbus 1738, 3000 DR
Rotterdam, The Netherlands. Phone: 31-10-4087951. Fax: 31-10-4089486. E-mail: adrian{at}kgk.fgg.eur.nl.
 |
REFERENCES |
| 1.
|
Adrian, P. V.,
T. A. Black,
W. Zhao,
K. J. Shaw,
R. S. Hare, and K. P. Klugman.
2000.
Mutations in ribosomal protein L16 conferring reduced susceptibility to evernimicin (SCH27899): implications for mechanism of action.
Antimicrob. Agents Chemother.
44:732-738[Abstract/Free Full Text].
|
| 2.
|
Asai, T.,
C. Condon,
J. Voulgaris,
D. Zaporojets,
B. Shen,
M. Al-Omar,
C. Squires, and C. L. Squires.
1999.
Construction and initial characterization of Escherichia coli strains with few or no intact chromosomal rRNA operons.
J. Bacteriol.
181:3803-3809[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1995.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 4.
|
Bacot, C. M., and R. H. Reeves.
1991.
Novel tRNA gene organization in the 16S-23S intergenic spacer of the Streptococcus pneumoniae rRNA gene cluster.
J. Bacteriol.
173:4234-4236[Abstract/Free Full Text].
|
| 5.
|
Chittum, H. S., and W. S. Champney.
1994.
Ribosomal protein gene sequence changes in erythromycin-resistant mutants of Escherichia coli.
J. Bacteriol.
176:6192-6198[Abstract/Free Full Text].
|
| 6.
|
Ganguly, A. K.,
V. M. Girijavallabhan,
G. H. Miller, and O. Z. Sarre.
1982.
Chemical modification of everninomicin.
J. Antibiot.
35:561-570[Medline].
|
| 7.
|
Harvey, S., and C. W. Hill.
1990.
Exchange of spacer regions between rRNA operons in Escherichia coli.
Genetics
125:683-690[Abstract].
|
| 8.
|
Havarstein, L. S.,
G. Coomaraswamy, and D. A. Morrison.
1995.
An unmodified heptadecapeptide induces competence for genetic transformation in Streptococcus pneumoniae.
Proc. Natl. Acad. Sci. USA
92:11140-11144[Abstract/Free Full Text].
|
| 9.
|
Jones, R. N., and M. S. Barrett.
1995.
Antimicrobial activity of everninomicin (evernimicin), an oligosaccharide antimicrobial with a potent Gram-positive spectrum.
Clin. Microb. Infect.
1:35-43[Medline].
|
| 10.
|
Joseph, S.,
B. Weiser, and H. F. Noller.
1997.
Mapping the inside of the ribosome with an RNA helical ruler.
Science
278:1093-1098[Abstract/Free Full Text].
|
| 11.
|
Maimets, T.,
J. Remme, and R. Villems.
1984.
Ribosomal protein L16 binds to the 3'-end of transfer RNA.
FEBS Lett.
166:53-56[CrossRef][Medline].
|
| 12.
|
Mankin, A. S.,
I. M. Zyrianova,
V. K. Kagramanova, and R. A. Garrett.
1992.
Introducing mutations into the single-copy chromosomal 23S rRNA gene of the archaeon Halobacterium halobium by using an rRNA operon-based transformation system.
Proc. Natl. Acad. Sci. USA
89:6535-6539[Abstract/Free Full Text].
|
| 13.
|
McNicholas, P. M.,
D. J. Najarian,
P. A. Mann,
D. Hesk,
R. S. Hare,
K. J. Shaw, and T. A. Black.
2000.
Evernimicin binds exclusively to the 50S ribosomal subunit and inhibits translation in cell-free systems derived from both gram-positive and gram-negative bacteria.
Antimicrob. Agents Chemother.
44:1121-1126[Abstract/Free Full Text].
|
| 14.
|
Meier, A.,
P. Kirschner,
B. Springer,
V. A. Steingrube,
B. A. Brown,
R. J. Wallace, Jr., and E. C. Böttger.
1994.
Identification of mutations in 23S rRNA gene of clarithromycin-resistant Mycobacterium intracellulare.
Antimicrob. Agents Chemother.
38:381-384[Abstract/Free Full Text].
|
| 15.
|
Moazed, D., and H. F. Noller.
1989.
Interaction of tRNA with 23S rRNA in the ribosomal A, P, and E sites.
Cell
57:585-597[CrossRef][Medline].
|
| 16.
|
Muralikrishna, P., and B. S. Cooperman.
1995.
Ribosomal components neighboring the 2475 loop in Escherichia coli 50S subunits.
Biochemistry
34:115-121[CrossRef][Medline].
|
| 17.
|
Prammananan, T.,
P. Sander,
B. Springer, and E. C. Böttger.
1999.
RecA-mediated gene conversion and aminoglycoside resistance in strains heterozygous for rRNA.
Antimicrob. Agents Chemother.
43:447-453[Abstract/Free Full Text].
|
| 18.
|
Sander, P.,
T. Prammananan,
A. Meier,
K. Frischkorn, and E. C. Böttger.
1997.
The role of RNAs in macrolide resistance.
Mol. Microbiol.
26:469-480[CrossRef][Medline].
|
| 19.
|
Sigmund, C. D., and E. A. Morgan.
1982.
Erythromycin resistance due to a mutation in a ribosomal RNA operon of Escherichia coli.
Proc. Natl. Acad. Sci. USA
79:5602-5606[Abstract/Free Full Text].
|
| 20.
|
Smith, A. M., and K. P. Klugman.
1997.
"Megaprimer" method of PCR-based mutagenesis: the concentration of megaprimer is a critical factor.
BioTechniques
22:438-442[Medline].
|
| 21.
|
Stern, S.,
D. Moazed, and H. F. Noller.
1988.
Structural analysis of RNA using chemical and enzymatic probing monitored by primer extension.
Methods Enzymol.
164:481-489[Medline].
|
| 22.
|
Tate, W. P.,
H. Schulze, and K. H. Nierhaus.
1983.
The importance of the Escherichia coli ribosomal protein L16 for the reconstitution of the peptidyl-tRNA hydrolysis activity of peptide chain termination.
J. Biol. Chem.
258:12810-12815[Abstract/Free Full Text].
|
| 23.
|
Versalovic, J.,
D. Shortridge,
K. Kibler,
M. V. Griffy,
J. Beyer,
R. K. Flamm,
S. K. Tanaka,
D. Y. Graham, and M. F. Go.
1996.
Mutations in 23S rRNA are associated with clarithromycin resistance in Helicobacter pylori.
Antimicrob. Agents Chemother.
40:477-480[Abstract].
|
| 24.
|
Wallace, R. J., Jr.,
A. Meier,
B. A. Brown,
Y. Zhang,
P. Sander,
G. O. Onyi, and E. C. Böttger.
1996.
Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus.
Antimicrob. Agents Chemother.
40:1676-1681[Abstract].
|
| 25.
|
Weinstein, M. J.,
G. H. Wagman,
E. M. Oden,
G. M. Luedemann,
P. Sloane,
A. Murawski, and J. Marquez.
1966.
Purification and biological studies of everninomicin B, p. 821-827.
. Antimicrob. Agents Chemother. 1965.
|
| 26.
|
Weisblum, B.
1995.
Erythromycin resistance by ribosome modification.
Antimicrob. Agents Chemother.
39:577-585[Medline].
|
Antimicrobial Agents and Chemotherapy, November 2000, p. 3101-3106, Vol. 44, No. 11
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yassin, A., Mankin, A. S.
(2007). Potential New Antibiotic Sites in the Ribosome Revealed by Deleterious Mutations in RNA of the Large Ribosomal Subunit. J. Biol. Chem.
282: 24329-24342
[Abstract]
[Full Text]
-
Wolter, N., Smith, A. M., Farrell, D. J., Klugman, K. P.
(2006). Heterogeneous Macrolide Resistance and Gene Conversion in the Pneumococcus. Antimicrob. Agents Chemother.
50: 359-361
[Abstract]
[Full Text]
-
Yassin, A., Fredrick, K., Mankin, A. S.
(2005). Deleterious mutations in small subunit ribosomal RNA identify functional sites and potential targets for antibiotics. Proc. Natl. Acad. Sci. USA
102: 16620-16625
[Abstract]
[Full Text]
-
Petsaris, O., Miszczak, F., Gicquel-Bruneau, M., Perrin-Guyomard, A., Humbert, F., Sanders, P., Leclercq, R.
(2005). Combined Antimicrobial Resistance in Enterococcus faecium Isolated from Chickens. Appl. Environ. Microbiol.
71: 2796-2799
[Abstract]
[Full Text]
-
Lobritz, M., Hutton-Thomas, R., Marshall, S., Rice, L. B.
(2003). Recombination Proficiency Influences Frequency and Locus of Mutational Resistance to Linezolid in Enterococcus faecalis. Antimicrob. Agents Chemother.
47: 3318-3320
[Abstract]
[Full Text]
-
Butaye, P., Devriese, L. A., Haesebrouck, F.
(2003). Antimicrobial Growth Promoters Used in Animal Feed: Effects of Less Well Known Antibiotics on Gram-Positive Bacteria. Clin. Microbiol. Rev.
16: 175-188
[Abstract]
[Full Text]
-
Kofoed, C. B., Vester, B.
(2002). Interaction of Avilamycin with Ribosomes and Resistance Caused by Mutations in 23S rRNA. Antimicrob. Agents Chemother.
46: 3339-3342
[Abstract]
[Full Text]
-
Zarazaga, M., Tenorio, C., Del Campo, R., Ruiz-Larrea, F., Torres, C.
(2002). Mutations in Ribosomal Protein L16 and in 23S rRNA in Enterococcus Strains for Which Evernimicin MICs Differ. Antimicrob. Agents Chemother.
46: 3657-3659
[Abstract]
[Full Text]
-
Belova, L., Tenson, T., Xiong, L., McNicholas, P. M., Mankin, A. S.
(2001). A novel site of antibiotic action in the ribosome: Interaction of evernimicin with the large ribosomal subunit. Proc. Natl. Acad. Sci. USA
10.1073/pnas.071527498v1
[Abstract]
[Full Text]
-
McNicholas, P. M., Mann, P. A., Najarian, D. J., Miesel, L., Hare, R. S., Black, T. A.
(2001). Effects of Mutations in Ribosomal Protein L16 on Susceptibility and Accumulation of Evernimicin. Antimicrob. Agents Chemother.
45: 79-83
[Abstract]
[Full Text]
-
Belova, L., Tenson, T., Xiong, L., McNicholas, P. M., Mankin, A. S.
(2001). A novel site of antibiotic action in the ribosome: Interaction of evernimicin with the large ribosomal subunit. Proc. Natl. Acad. Sci. USA
98: 3726-3731
[Abstract]
[Full Text]