Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2000, p. 3118-3121, Vol. 44, No. 11
Antimicrobial Agents Research Group, Division
of Infection and Immunity, University of Birmingham, Birmingham,
B15 2TT, United Kingdom,1 and Center for
Veterinary Medicine, Food and Drug Administration, Laurel, Maryland
207082
Received 6 April 2000/Returned for modification 25 May
2000/Accepted 9 August 2000
The mechanism of multiple antibiotic resistance in six isolates of
Salmonella enterica serovar Typhimurium recovered from a
patient treated with ciprofloxacin was studied to investigate the role
of efflux in the resistance phenotype. Compared to the patient's
pretherapy isolate (L3), five of six isolates accumulated less
ciprofloxacin, three of six isolates accumulated less chloramphenicol, and all six accumulated less tetracycline. The accumulation of one or
more antibiotics was increased by carbonyl cyanide
m-chlorophenylhydrazone to concentrations similar to those
accumulated by L3 for all isolates except one, in which accumulation of
all three agents remained approximately half that of L3. All isolates
had the published wild-type sequences of marO and
marR. No increased expression of marA,
tolC, or soxS was observed by Northern
blotting; however, three isolates showed increased expression of
acrB, which was confirmed by quantitative competitive
reverse transcription-PCR. However, there were no mutations within
acrR or the promoter region of acrAB in any of
the isolates.
In Escherichia coli,
expression of the multiple antibiotic resistance (MAR) phenotype is
mediated by the decreased expression of the porin OmpF and
overexpression of the acrAB locus encoding the multidrug
efflux pump AcrB, controlled by the marRAB operon, although
it may also involve other efflux systems yet to be identified (1). MarA is a transcriptional activator for
marRAB and binds to the marbox located within the operator
marO. Homologues of MarA, such as SoxS and Rob, have been
shown to bind to the marbox and also regulate expression of the
mar locus (15, 24). The expression of the
E. coli AcrAB efflux system is increased in MAR mutants, and
overexpression of acrAB confers organic-solvent tolerance as
well as MAR (25, 32). The outer membrane protein TolC,
proposed to act as an efflux channel for AcrAB, is essential for the
maintenance of organic-solvent tolerance. Like marRAB, acrAB and tolC are positively regulated by MarA,
SoxS, and Rob (2, 7, 25, 32).
Less is known about the control of MAR in salmonella. Studies have
shown that some MAR mutants of salmonella have reduced expression of
OmpF (14, 26, 27), while other MAR isolates have no porin
changes (10, 11, 26). The marRAB locus in Salmonella enterica serovar Typhimurium has been shown to be
structurally and functionally similar to that in E. coli
(29), and there is close homology between the
soxRS genes of Salmonella serovar Typhimurium and
E. coli (28).
Lacroix et al. constructed an acrB-disrupted mutant of
Salmonella serovar Typhimurium which lost the ability to
grow in the presence of bile salts and chemical detergents and showed
increased susceptibility to antibiotics (16, 17). An
AcrAB-overproducing mutant of Salmonella serovar Typhimurium
with reduced susceptibility to multiple antibiotics compared to its
parent strain has also been described (22). Recently,
mutants of Salmonella serovar Typhimurium with reduced
accumulation of ciprofloxacin have been shown to overexpress AcrA,
suggesting the involvement of the AcrAB efflux pump in multiple drug
resistance (11).
The clinical isolates of Salmonella serovar Typhimurium used
in the present study have been described previously (26,
27). Strain L3 was isolated from a hematoma in a patient prior to
intravenous ciprofloxacin therapy, and 11 quinolone-resistant
posttherapy isolates were obtained from wound drainage fluid over a
period of 19 weeks. Several of the posttherapy strains were
subsequently shown to harbor mutations in gyrA (12,
26) or gyrB (9). No mutations were detected
in parC (unpublished data). Six posttherapy isolates were
MAR and had reduced accumulation of ciprofloxacin and norfloxacin which
did not correlate with lack of OmpF. In the present study, we sought to
further characterize the mechanism of MAR and reduced accumulation in
these isolates and to ascertain the role of efflux in the resistance phenotype.
Bacterial strains and susceptibility to antibiotics, dyes,
detergents, and organic solvents.
Salmonella serovar
Typhimurium L3 was isolated from a patient prior to a course of
ciprofloxacin. Six posttherapy strains were MAR and exhibited reduced
accumulation of quinolones, and in addition, L5 possessed a mutation in
gyrA (Ala119 Antibiotic accumulation.
The accumulation of ciprofloxacin,
[3H]chloramphenicol, and [3H]tetracycline
by all isolates, with and without the presence of 100 µM carbonyl
cyanide m-chlorophenylhydrazone (CCCP), was measured as
described previously (5, 18).
DNA isolation, PCR, and DNA sequencing.
Genomic DNA was
prepared using cetyltrimethylammonium bromide (CTAB)-chloroform
extraction (6). The marR and marO
regions were amplified from genomic DNA using primers derived from the Salmonella serovar Typhimurium marRAB sequence
(29) as described previously (12). A
1,536-nucleotide acrB gene fragment was amplified using the
primers derived from the partial sequence of Salmonella serovar Typhimurium LX1054 acrB (17). Gene
fragments of acrR and the putative promoter region of
acrAB were amplified by PCR using primers derived from the
sequences of E. coli acrRAB (20). DNA sequencing
was performed by MWG-Biotech AG (Ebersberg, Germany).
Northern blot analysis for acrB, tolC,
marA, and soxS.
For Northern blot analysis of
marA and soxS, total RNA was extracted with an
RNeasy Midi kit (Qiagen). The probes for marA and
soxS were prepared by PCR, [32P]dCTP labeled
with the High Prime DNA labeling kit (Boehringer Mannheim Corporation),
and hybridized to the RNA in ULTRAhyb ultrasensitive hybridization
solution (Ambion) according to the manufacturer's protocol. Northern
blotting of acrB (1,067 nucleotides; analogous to
nucleotides 3550 to 4616 of E. coli acrAB) and
tolC was performed with RNA extracted with TRIZOL (Life
Technologies Ltd.) and as described in the Gene Images kit (Amersham
Pharmacia Biotech). Probes for acrB and tolC were
prepared by PCR and labeled with fluorescein using the Gene Images kit.
Sample-to-sample RNA uniformity was determined by examining 16S rRNA
expression in parallel. DNA sequencing of all probes confirmed their identities.
QCRT-PCR of acrB.
Differential expression of
acrB mRNA was compared by quantitative competitive reverse
transcription-PCR (QCRT-PCR) as described by Freeman et al.
(8). An 894-bp internal competitor DNA standard for
acrB was generated by PCR amplification of genomic DNA using primer STACRB1 (CGAGAACGTCGAACGTGTTA) and the 40-mer reverse
primer ACRBi (TCACACGACCGCGATCGATAGCCGAACAACTGATTACGTG).
Total RNA was extracted with TRIZOL reagent. Reverse
transcriptase PCR was performed on the RNA template to generate cDNA of
acrB. Competitor DNA was added at concentrations from 0.01 to 2 pg to replicate tubes containing identical aliquots of cDNA. PCR
was performed on the competitor DNA-cDNA mixture using primers STACRB1
and ACRBR1 (TCACACGACCGCGATCGATA). The two products were
separated by polyacrylamide gel electrophoresis, the gel was silver
stained (31), and the bands were quantified by densitometry.
The concentration of competitor DNA at which both bands were of equal
density was taken to be the concentration of the target cDNA.
SSCP analysis of acrR and the putative promoter
region of acrAB.
Genomic DNA was prepared using
CTAB-chloroform extraction (6), and acrR and the
putative acrAB promoter region were amplified by PCR using
three pairs of primers based on the acrRAB sequence from
E. coli (20). The PCR amplimers were analyzed by
single-strand conformational polymorphism (SSCP) as described
previously (31).
Nucleotide sequence accession numbers.
The DNA sequences
from wild-type Salmonella serovar Typhimurium NCTC 74 were
submitted to GenBank under accession numbers U78314
(acrB-like gene) and AF209869 to AF209870 (acrR and the putative promoter region of acrAB).
All six posttherapy isolates were less susceptible to nalidixic
acid, ciprofloxacin, and other antibiotics than the pretherapy isolate,
L3. L6, L10, L12, and L15 were also more resistant to dyes and
detergents (Table 1). L5 was as
susceptible to dyes and detergents as L3, while L18 was fourfold more
resistant to acriflavine only (Table 1). Isolates L6, L10, and L12 were
hexane tolerant. For all strains, the MIC of ciprofloxacin was
unaltered by the presence of 100 µM CCCP, and none of the strains
grew in the presence of cyclohexane.
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Evidence for an Efflux Pump Mediating Multiple
Antibiotic Resistance in Salmonella enterica Serovar
Typhimurium
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
Glu) and L18 possessed a mutation in
gyrB (Ser463Tyr) which contributed to quinolone
resistance (9, 12, 26, 27). The remaining isolates had no
mutations in gyrA or gyrB. Salmonella serovar Typhimurium NCTC 74 (L19) was obtained from the Public Health Laboratory Service (Colindale, United Kingdom), and
Salmonella serovar Typhimurium T39 (parent strain;
spontaneous streptomycin-resistant mutant) and LX1054 (acrB
mutant) were supplied by F. Lacroix (16). Susceptibility to
antimicrobial agents, detergents, and dyes and tolerance to hexane and
cyclohexane were determined as described previously (4, 13,
32).
RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
TABLE 1.
Susceptibilities of Salmonella serovar
Typhimurium isolates to antibiotics, detergents, and dyes
Isolates L5, L6, L10, L12, and L15 accumulated approximately two- to
fourfold less ciprofloxacin than L3 (Table
2). In the presence of CCCP, the
concentrations of ciprofloxacin accumulated by L5, L6, and L10
increased to that accumulated by L3. The concentration of ciprofloxacin
accumulated by L15 was almost doubled in the presence of CCCP, but it
remained less than half that observed in L3. CCCP had no effect upon
ciprofloxacin accumulation for isolates L12 and L18. L6, L12, and L15
accumulated approximately three-quarters and L10 accumulated one-third
the concentration of chloramphenicol accumulated by L3. The
concentrations of chloramphenicol accumulated by all isolates except
L12 were increased in the presence of CCCP (Table 2). All six
posttherapy isolates accumulated approximately two- to fourfold less
tetracycline than L3 (Table 2). In the presence of CCCP, the
accumulation of tetracycline by L5, L6, L15, and L18 was increased to
concentrations similar to that accumulated by L3. Although the
concentrations of tetracycline accumulated by L10 and L12 approximately
doubled in the presence of CCCP, they still remained less than half
that of L3.
|
Northern blot analysis indicated that none of the clinical strains
overexpressed marA, soxS, or tolC;
tolC was expressed at low levels. The posttherapy isolates
L5, L10, and L18 showed consistently higher transcript levels of
acrB than the pretherapy isolate, L3 (Fig.
1). No acrB transcripts were
detected in the acrB mutant LX1054. QCRT-PCR demonstrated
that L10 expressed four times and L5 and L18 expressed two and a half
times more acrB mRNA than L3. SSCP analysis of the entire
acrR gene and the putative promoter region of
acrAB identified mutations within these regions in control strains of E. coli (data not shown); however, all
posttherapy isolates of Salmonella serovar Typhimurium
showed patterns identical to those of the pretherapy isolate, L3, and
the control, L19. The SSCP data were corroborated by DNA sequencing,
which confirmed that there were no mutations within the region.
|
Recent work has suggested that the AcrAB efflux pump of E. coli plays a major role in MAR, as fluoroquinolone resistance was lost on inactivation of the acrAB locus in strains with mutations in gyrA (23). The same may not be true for salmonella, as CCCP (which should inactivate AcrB) made no difference in susceptibility to ciprofloxacin for any of the isolates in the present study, including both isolates with gyrase mutations (L5 gyrA and L18 gyrB; data not shown).
To confirm that MAR in the isolates L5, L10, and L18 is mediated by AcrB efflux, we propose to inactivate acrB in these strains and examine whether the phenotype is reversed by disruption of the gene. This work is currently under way. It is unlikely that sequencing of the acrAB gene cluster in these isolates would reveal any mutations, as changes in this gene have been shown to increase susceptibility in Salmonella serovar Typhimurium (17, 22). As SSCP analysis and DNA sequencing of acrR and the promoter region of acrAB failed to show any differences between the MAR isolates and the pretherapy parent strain, any mutation mediating resistance is more likely to be found in a regulatory gene. The data presented here also suggest that marOR, soxS, and tolC are not overexpressed. However, in E. coli, TolC has been shown to be essential for the function of the AcrB efflux pump (7) and for the maintenance of organic-solvent tolerance (2). It may be that the low level of TolC was sufficient to act as an outer membrane channel for AcrAB; however, an alternative explanation for the data is that another pump which affects the expression of acrB may be involved in multiple antibiotic resistance in Salmonella serovar Typhimurium and may explain the apparent lack of involvement of TolC in the resistance phenotype of these isolates. Only three of the six strains in the present study exhibited any degree of organic-solvent tolerance (L6, L10, and L12 to hexane only), which may be consistent with the lack of increased expression of tolC in these isolates. It would be interesting to examine whether the expression of Rob is increased in these isolates, as it is known that this protein affects the function of the AcrAB efflux pump in E. coli (3, 30). Unfortunately, despite employing a variety of strategies, PCR amplification of rob using primers based on the DNA sequence of E. coli rob failed to amplify its homologue from chromosomal or plasmid DNA preparations from any of the control or clinical isolates of Salmonella serovar Typhimurium (unpublished data).
The accumulation of ciprofloxacin by L15 and tetracycline by L12 was increased by CCCP but remained well below the concentrations accumulated by L3. Similarly, reduced accumulation of ciprofloxacin and chloramphenicol by L12 was unaffected by CCCP. This suggests that accumulation was reduced in these two strains by an additional mechanism resistant to CCCP inhibition. Previous work has shown that reduced outer membrane permeability did not contribute to resistance in L12 and L15 (26). It is probable that another efflux pump with a substrate profile similar to that of AcrB but which is resistant to inhibition by CCCP, perhaps similar to EmrAB of E. coli, is contributing to resistance in L12 and L15 (21). The use of other efflux inhibitors may help elucidate the nature of other putative efflux pumps in salmonella. It is evident that isolates with quite different phenotypes arose in this patient, and it is likely that individual isolates may possess a complex mixture of multiple mutations.
The regulation of AcrB-mediated efflux in Salmonella serovar Typhimurium remains to be established and may differ from that described for E. coli (1). Ma et al. (19) found increased transcription of acrAB in E. coli strains which lacked acrR when exposed to general stress conditions. They concluded that acrR is a secondary modulator of acrRAB expression and suggested that up-regulation under general stress conditions is controlled by an unidentified regulator, possibly a homologue of the known global regulator MarA, SoxS, or Rob. It is feasible that this alternative regulatory mechanism, independent of mar-sox-rob, may be responsible for the control of AcrB expression in Salmonella serovar Typhimurium, and this requires further investigation. When the sequencing of the Salmonella serovar Typhimurium LT2 genome is completed (33), identification of homologues of the known regulators of the mar regulon of E. coli will help to elucidate the regulation of efflux-mediated fluoroquinolone resistance in Salmonella serovar Typhimurium.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Julie Sherwood, Craig Munday, Nirinder Singh, and Mark Webber for technical assistance.
This study was supported in part by grants from the Leverhulme Trust (number F94AT) (K.G.) and USDA-CSREES-NRICGP (number 9635208) (D.G.W.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Antimicrobial Agents Research Group, Division of Infection and Immunity, University of Birmingham, Birmingham, B15 2TT, United Kingdom. Phone: 0121-414-6969. Fax: 0121-414-6966. E-mail: l.j.v.piddock{at}bham.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
| 1. | Alekshun, M. N., and S. B. Levy. 1997. Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrob. Agents Chemother. 41:2067-2075[Medline]. |
| 2. |
Aono, R.,
N. Tsukagoshi, and M. Yamamoto.
1998.
Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12.
J. Bacteriol.
180:938-944 |
| 3. |
Ariza, R. R.,
A. Li,
N. Ringstad, and B. Demple.
1995.
Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein.
J. Bacteriol.
177:1655-1661 |
| 4. | Asako, H., H. Nakajima, K. Kobayshi, M. Kobayshi, and R. Aono. 1997. Organic solvent tolerance and antibiotic resistance increased by overexpression of marA in Escherichia coli. Appl. Environ. Microbiol. 63:1428-1433[Abstract]. |
| 5. |
Asuquo, A. E., and L. J. V. Piddock.
1993.
Accumulation and killing kinetics of fifteen quinolones for Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa.
J. Antimicrob. Chemother.
31:865-880 |
| 6. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1995. Current protocols in molecular biology. John Wiley and Sons, New York, N.Y. |
| 7. |
Fralick, J. A.
1996.
Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli.
J. Bacteriol.
178:5803-5805 |
| 8. | Freeman, W. M., S. J. Walker, and K. E. Vrana. 1999. Quantitative RT-PCR: pitfalls and potential. BioTechniques 26:112-125[Medline]. |
| 9. | Gensberg, K., Y. F. Jin, and L. J. V. Piddock. 1995. A novel gyrB mutation in a fluoroquinolone-resistant clinical isolate of Salmonella typhimurium. FEMS Microbiol. Lett. 132:57-60[CrossRef][Medline]. |
| 10. |
Gibb, A. P.,
C. S. Lewis, and O. J. Garden.
1991.
Development of quinolone resistance and multiple antibiotic resistance in Salmonella bovismorbificans in a pancreatic abscess.
J. Antimicrob. Chemother.
28:318-321 |
| 11. |
Giraud, E.,
A. Cloeckaert,
D. Kerboeuf, and E. Chaslus-Dancla.
2000.
Evidence for active efflux as the primary mechanism of resistance to ciprofloxacin in Salmonella enterica serovar Typhimurium.
Antimicrob. Agents Chemother.
44:1223-1228 |
| 12. | Griggs, D. J., K. Gensberg, and L. J. V. Piddock. 1996. Mutations in gyrA gene of quinolone-resistant salmonella serotypes isolated from humans and animals. Antimicrob. Agents Chemother. 40:1009-1013[Abstract]. |
| 13. |
Griggs, D. J.,
M. C. Hall,
Y. F. Jin, and L. J. V. Piddock.
1994.
Quinolone resistance in veterinary isolates of salmonella.
J. Antimicrob. Chemother.
33:1173-1189 |
| 14. |
Howard, A. J.,
T. D. Joseph,
L. L. Bloodworth,
J. A. Frost,
H. Chart, and B. Rowe.
1990.
The emergence of ciprofloxacin resistance in Salmonella typhimurium.
J. Antimicrob. Chemother.
26:296-298 |
| 15. |
Jair, K. W.,
X. Yu,
K. Skarstad,
B. Thony,
N. Fujita,
A. Ishihama, and R. E. Wolf, Jr.
1996.
Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication.
J. Bacteriol.
178:2507-2513 |
| 16. | Lacroix, F. J. C., C. Avoyne, C. Pinault, M. Y. Popoff, and P. Pardon. 1995. Salmonella typhimurium TnphoA mutants with increased sensitivity to biological and chemical detergents. Res. Microbiol. 146:659-670[Medline]. |
| 17. | Lacroix, F. J. C., A. Cloeckaert, O. Grepinet, C. Pinault, M. Y. Popoff, H. Waxin, and P. Pardon. 1996. Salmonella typhimurium acrB-like gene: identification and role in resistance to biliary salts and detergents and in murine infection. FEMS Microbiol. Lett. 135:161-167[CrossRef][Medline]. |
| 18. |
Li, X. Z.,
D. M. Livermore, and H. Nikaido.
1994.
Role of efflux pump(s) in intrinsic resistance of Pseudomonas aeruginosa: resistance to tetracycline, chloramphenicol, and norfloxacin.
Antimicrob. Agents Chemother.
38:1732-1741 |
| 19. | Ma, D., M. Alberti, C. Lynch, H. Nikaido, and J. E. Hearst. 1996. The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals. Mol. Microbiol. 19:101-112[CrossRef][Medline]. |
| 20. |
Ma, D.,
D. N. Cook,
M. Alberti,
N. G. Pon,
H. Nikaido, and J. E. Hearst.
1993.
Molecular cloning and characterization of acrA and acrE genes of Escherichia coli.
J. Bacteriol.
175:6299-6313 |
| 21. |
Nikaido, H.
1996.
Multidrug efflux pumps of gram-negative bacteria.
J. Bacteriol.
178:5853-5859 |
| 22. |
Nikaido, H.,
M. Basina,
V. Nguyen, and E. Y. Rosenburg.
1998.
Multidrug efflux pump AcrAB of Salmonella typhimurium excretes only those beta-lactam antibiotics containing lipophilic side chains.
J. Bacteriol.
180:4686-4692 |
| 23. |
Oethinger, M.,
W. V. Kern,
A. S. Jellen-Ritter,
L. M. McMurry, and S. B. Levy.
2000.
Ineffectiveness of topoisomerase mutations in mediating clinically significant fluoroquinolone resistance in Escherichia coli in the absence of the AcrAB efflux pump.
Antimicrob. Agents Chemother.
44:10-13 |
| 24. |
Oethinger, M.,
I. Podglajen,
W. V. Kern, and S. B. Levy.
1998.
Overexpression of the marA or soxS regulatory gene in clinical topoisomerase mutants of Escherichia coli.
Antimicrob. Agents Chemother.
42:2089-2094 |
| 25. |
Okusu, H.,
D. Ma, and H. Nikaido.
1996.
AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple antibiotic resistance (Mar) mutants.
J. Bacteriol.
178:306-308 |
| 26. |
Piddock, L. J. V.,
D. J. Griggs,
M. C. Hall, and Y. F. Jin.
1993.
Ciprofloxacin resistance in clinical isolates of Salmonella typhimurium obtained from two patients.
Antimicrob. Agents Chemother.
37:662-666 |
| 27. | Piddock, L. J. V., K. Whale, and R. Wise. 1990. Quinolone resistance in salmonella: clinical experience. Lancet 335:1459[Medline]. |
| 28. |
Pomposiello, P. J., and B. Demple.
2000.
Identification of SoxS-regulated genes in Salmonella enterica serovar Typhimurium.
J. Bacteriol.
182:23-29 |
| 29. |
Sulavik, M. C.,
M. Dazer, and P. F. Miller.
1997.
The Salmonella typhimurium mar locus: molecular and genetic analyses and assessment of its role in virulence.
J. Bacteriol.
179:1857-1866 |
| 30. | Tanaka, T., T. Horii, K. Shibayama, K. Sato, S. Ohsuka, Y. Arakawa, K. I. Yamaki, K. Takagi, and M. Ohta. 1997. RobA-induced multiple antibiotic resistance largely depends on activation of the AcrAB efflux. Microbiol. Immunol. 41:697-702[Medline]. |
| 31. | Wain, J., N. T. T. Hoa, N. T. Chinh, H. Vinh, M. J. Everett, T. S. Diep, N. P. Day, T. Solomon, N. J. White, L. J. V. Piddock, and C. M. Parry. 1997. Quinolone-resistant Salmonella typhi in Vietnam: molecular basis of resistance and clinical response to treatment. Clin. Infect. Dis. 25:1404-1410[Medline]. |
| 32. |
White, D. G.,
J. D. Goldman,
B. Demple, and S. B. Levy.
1997.
Role of the acrAB locus in organic solvent tolerance mediated by overexpression of marA, soxS, or robA in Escherichia coli.
J. Bacteriol.
179:6122-6126 |
| 33. | Wong, R. M., K. K. Wong, N. R. Benson, and M. McClelland. 1999. Sample sequencing of a Salmonella typhimurium LT2 lambda library: comparison to the Escherichia coli K12 genome. FEMS Microbiol. Lett. 173:411-423[CrossRef][Medline]. |
Antimicrobial Agents and Chemotherapy, November 2000, p. 3118-3121, Vol. 44, No. 11
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Blair, J. M. A., La Ragione, R. M., Woodward, M. J., Piddock, L. J. V.
(2009). Periplasmic adaptor protein AcrA has a distinct role in the antibiotic resistance and virulence of Salmonella enterica serovar Typhimurium. J Antimicrob Chemother
64: 965-972
[Abstract] [Full Text] -
Webber, M. A., Bailey, A. M., Blair, J. M. A., Morgan, E., Stevens, M. P., Hinton, J. C. D., Ivens, A., Wain, J., Piddock, L. J. V.
(2009). The Global Consequence of Disruption of the AcrAB-TolC Efflux Pump in Salmonella enterica Includes Reduced Expression of SPI-1 and Other Attributes Required To Infect the Host. J. Bacteriol.
191: 4276-4285
[Abstract] [Full Text] -
Ricci, V., Piddock, L. J. V.
(2009). Ciprofloxacin selects for multidrug resistance in Salmonella enterica serovar Typhimurium mediated by at least two different pathways. J Antimicrob Chemother
63: 909-916
[Abstract] [Full Text] -
Villagra, N. A., Hidalgo, A. A., Santiviago, C. A., Saavedra, C. P., Mora, G. C.
(2008). SmvA, and not AcrB, is the major efflux pump for acriflavine and related compounds in Salmonella enterica serovar Typhimurium. J Antimicrob Chemother
62: 1273-1276
[Abstract] [Full Text] -
Garvey, M. I., Piddock, L. J. V.
(2008). The Efflux Pump Inhibitor Reserpine Selects Multidrug-Resistant Streptococcus pneumoniae Strains That Overexpress the ABC Transporters PatA and PatB. Antimicrob. Agents Chemother.
52: 1677-1685
[Abstract] [Full Text] -
Akiba, M., Nakaoka, Y., Kida, M., Ishioka, Y., Sameshima, T., Yoshii, N., Nakazawa, M., Uchida, I., Terakado, N.
(2007). Changes in antimicrobial susceptibility in a population of Salmonella enterica serovar Dublin isolated from cattle in Japan from 1976 to 2005. J Antimicrob Chemother
60: 1235-1242
[Abstract] [Full Text] -
Karatzas, K. A. G., Webber, M. A., Jorgensen, F., Woodward, M. J., Piddock, L. J. V., Humphrey, T. J.
(2007). Prolonged treatment of Salmonella enterica serovar Typhimurium with commercial disinfectants selects for multiple antibiotic resistance, increased efflux and reduced invasiveness. J Antimicrob Chemother
60: 947-955
[Abstract] [Full Text] -
Chen, S., Cui, S., McDermott, P. F., Zhao, S., White, D. G., Paulsen, I., Meng, J.
(2007). Contribution of Target Gene Mutations and Efflux to Decreased Susceptibility of Salmonella enterica Serovar Typhimurium to Fluoroquinolones and Other Antimicrobials. Antimicrob. Agents Chemother.
51: 535-542
[Abstract] [Full Text] -
Coldham, N. G., Randall, L. P., Piddock, L. J. V., Woodward, M. J.
(2006). Effect of fluoroquinolone exposure on the proteome of Salmonella enterica serovar Typhimurium. J Antimicrob Chemother
58: 1145-1153
[Abstract] [Full Text] -
Piddock, L. J. V.
(2006). Clinically Relevant Chromosomally Encoded Multidrug Resistance Efflux Pumps in Bacteria. Clin. Microbiol. Rev.
19: 382-402
[Abstract] [Full Text] -
Ricci, V., Tzakas, P., Buckley, A., Coldham, N. C., Piddock, L. J. V.
(2006). Ciprofloxacin-Resistant Salmonella enterica Serovar Typhimurium Strains Are Difficult To Select in the Absence of AcrB and TolC. Antimicrob. Agents Chemother.
50: 38-42
[Abstract] [Full Text] -
Randall, L. P., Eaves, D. J., Cooles, S. W., Ricci, V., Buckley, A., Woodward, M. J., Piddock, L. J. V.
(2005). Fluoroquinolone treatment of experimental Salmonella enterica serovar Typhimurium DT104 infections in chickens selects for both gyrA mutations and changes in efflux pump gene expression. J Antimicrob Chemother
56: 297-306
[Abstract] [Full Text] -
Olliver, A., Valle, M., Chaslus-Dancla, E., Cloeckaert, A.
(2005). Overexpression of the Multidrug Efflux Operon acrEF by Insertional Activation with IS1 or IS10 Elements in Salmonella enterica Serovar Typhimurium DT204 acrB Mutants Selected with Fluoroquinolones. Antimicrob. Agents Chemother.
49: 289-301
[Abstract] [Full Text] -
Eaves, D. J., Ricci, V., Piddock, L. J. V.
(2004). Expression of acrB, acrF, acrD, marA, and soxS in Salmonella enterica Serovar Typhimurium: Role in Multiple Antibiotic Resistance. Antimicrob. Agents Chemother.
48: 1145-1150
[Abstract] [Full Text] -
Prouty, A. M., Brodsky, I. E., Falkow, S., Gunn, J. S.
(2004). Bile-salt-mediated induction of antimicrobial and bile resistance in Salmonella typhimurium. Microbiology
150: 775-783
[Abstract] [Full Text] -
van der Straaten, T., Zulianello, L., van Diepen, A., Granger, D. L., Janssen, R., van Dissel, J. T.
(2004). Salmonella enterica Serovar Typhimurium RamA, Intracellular Oxidative Stress Response, and Bacterial Virulence. Infect. Immun.
72: 996-1003
[Abstract] [Full Text] -
Delsol, A. A., Woodward, M. J., Roe, J. M.
(2004). Effect of a 5 day enrofloxacin treatment on Salmonella enterica serotype Typhimurium DT104 in the pig. J Antimicrob Chemother
53: 396-398
[Abstract] [Full Text] -
Schneiders, T., Amyes, S. G. B., Levy, S. B.
(2003). Role of AcrR and RamA in Fluoroquinolone Resistance in Clinical Klebsiella pneumoniae Isolates from Singapore. Antimicrob. Agents Chemother.
47: 2831-2837
[Abstract] [Full Text] -
Visalli, M. A., Murphy, E., Projan, S. J., Bradford, P. A.
(2003). AcrAB Multidrug Efflux Pump Is Associated with Reduced Levels of Susceptibility to Tigecycline (GAR-936) in Proteus mirabilis. Antimicrob. Agents Chemother.
47: 665-669
[Abstract] [Full Text] -
Hirose, K., Hashimoto, A., Tamura, K., Kawamura, Y., Ezaki, T., Sagara, H., Watanabe, H.
(2002). DNA Sequence Analysis of DNA Gyrase and DNA Topoisomerase IV Quinolone Resistance-Determining Regions of Salmonella enterica Serovar Typhi and Serovar Paratyphi A. Antimicrob. Agents Chemother.
46: 3249-3252
[Abstract] [Full Text] -
Raherison, S., Gonzalez, P., Renaudin, H., Charron, A., Bebear, C., Bebear, C. M.
(2002). Evidence of Active Efflux in Resistance to Ciprofloxacin and to Ethidium Bromide by Mycoplasma hominis. Antimicrob. Agents Chemother.
46: 672-679
[Abstract] [Full Text] -
RANDALL, L. P., COOLES, S. W., SAYERS, A. R., WOODWARD, M. J.
(2001). Association between cyclohexane resistance in Salmonella of different serovars and increased resistance to multiple antibiotics, disinfectants and dyes. J Med Microbiol
50: 919-924
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»