Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2000, p. 3196-3198, Vol. 44, No. 11
0066-4804/00/$04.00+0
Resistance to Multiple Fluoroquinolones in a
Clinical Isolate of Streptococcus pyogenes: Identification
of gyrA and parC and Specification of Point
Mutations Associated with Resistance
S. Steve
Yan,1
Melissa L.
Fox,2
Steven M.
Holland,2
Frida
Stock,1
Vee J.
Gill,1 and
Daniel P.
Fedorko1,*
Microbiology Service, CPD, Clinical
Center,1 and the Laboratory of Host Defenses,
National Institute of Allergy and Infectious
Diseases,2 National Institutes of Health,
Bethesda, Maryland 20892-1508
Received 3 March 2000/Returned for modification 9 June
2000/Accepted 17 August 2000
 |
ABSTRACT |
A strain of Streptococcus pyogenes resistant to
multiple fluoroquinolones was isolated from the blood of an
immunocompromised patient. Resistance to fluoroquinolones in S. pyogenes has not been previously studied. Compared to 10 sensitive strains of S. pyogenes, the
fluoroquinolone-resistant clinical isolate of S. pyogenes
presented point mutations in gyrA, predicting that
serine-81 was changed to phenylalanine and that methionine-99 was
changed to leucine, and in parC, predicting that serine-79
was changed to tyrosine. The mechanism of fluoroquinolone resistance in
this isolate of S. pyogenes appears to be analogous to
previously reported mechanisms for Streptococcus
pneumoniae.
| |
TEXT |
Development of penicillin resistance
in Streptococcus pneumoniae has prompted a search for
alternative effective therapy for infections caused by this organism
(4, 12, 13). Newer fluoroquinolones have demonstrated
excellent activity against penicillin-sensitive and
penicillin-resistant S. pneumoniae strains. However, with the increasing use of fluoroquinolones, there have been reports of
emergence of S. pneumoniae isolates with resistance to this class of antibiotics (3, 7, 8, 12, 16). In contrast to
S. pneumoniae, Streptococcus pyogenes remains
uniformly sensitive to penicillin despite intensive exposure to the
agent, and penicillin remains the drug of choice for infections caused
by S. pyogenes (15). For this reason,
susceptibility testing of S. pyogenes isolates is not
routinely performed. Resistance to fluoroquinolones among S. pyogenes isolates has not been reported previously, though slightly increased MICs of sparfloxacin (10) and
ciprofloxacin and levofloxacin (2) have been described
elsewhere. We report here a clinical strain of S. pyogenes
(NIH-R01-GAS) isolated from an immunocompromised patient who had
received repeated antibiotic treatment including levofloxacin for
various infections. This isolate was found to be highly resistant to
several fluoroquinolones, and analysis of gyrA and
parC gene sequences from the isolate indicated that point
mutations along the quinolone resistance-determining regions (QRDRs)
were the probable mechanism for its resistance.
Case history.
The patient was an eighteen-year-old black male
with hyper-immunoglobulin E recurrent infection (Job's syndrome)
diagnosed at age four who has been previously described (6).
He had had multiple recurrent pulmonary and sinus infections requiring
multiple courses of long-term therapy and prophylactic antibiotics. One month prior to admission, he had extensive bilateral inguinal crease
infections. Empiric therapy with levofloxacin, 500 mg orally daily, was initiated. Wound cultures subsequently grew S. pyogenes. One month later, while still on levofloxacin, he
complained of headaches, fever (40.1°C), and purulent drainage from
his right ear and nose. Blood cultures at this time grew S. pyogenes resistant to levofloxacin. He was admitted for 10 days
for intravenous administration of vancomycin, and other antibiotics
were discontinued. An echocardiogram was negative for any vegetations,
and ophthalmic examination revealed no Roth spots. Blood cultures taken
after completion of vancomycin therapy were negative.
All isolates of S. pyogenes (ATCC 700294, 12384, and 12344;
the fluoroquinolone-resistant blood isolate; and seven
fluoroquinolone-sensitive clinical isolates from a community hospital)
were initially grown on 5% sheep blood plates (Remel, Lenexa, Kans.)
in the presence of 5% CO2 at 35°C. The original isolate
from the patient's wound cultures was unavailable for further
investigation. Antimicrobial susceptibility was determined by a frozen
microdilution MicroStrep panel (Dade Behring, Inc., West Sacramento,
Calif.), the Etest (AB Biodisk, Solna, Sweden), or the Kirby-Bauer (KB)
disk (Becton Dickinson, Cockeysville, Md.) diffusion methods following
manufacturers' or NCCLS recommendations (5). Interpretation
of susceptibility was made according to NCCLS standards whenever
available (5). Quality control for all methods of
susceptibility testing was performed using S. pneumoniae
strain ATCC 49619, and results were within acceptable limits.
Mutational alterations in the QRDRs of
gyrA and
parC of NIH-R01-GAS were investigated by PCR using
Ready-To-Go PCR Beads (Pharmacia
Biotech, Piscataway, N.J.) with
chromosomal DNA as template and
subsequent DNA sequencing
(Perkin-Elmer, Applied Biosystems, Foster
City, Calif.). For
amplification of a 614-bp fragment of
gyrA containing the
QRDR, a pair of primers (5' GCAAGATCGAAATTTAATTGACGTC,
nucleotides 3 to 27, and 5' ACTCTCTTGTTGTACAGTCTGG,
nucleotides
595 to 616) was used. For the amplification of the
QRDR of
parC of
S. pyogenes, primers 5'
ATGTCAAACATTCAAAACATGTCC, nucleotides
1 to 24, and 5'
AGCCTGCGGAAATACCAGAAG, nucleotides 500 to 520,
were used to
amplify a 520-bp
fragment.
The levofloxacin-resistant isolate NIH-R01-GAS was sensitive to other
antibiotics in the MicroStrep panel (azithromycin, ceftriaxone,
chloramphenicol, clindamycin, penicillin, tetracycline, and vancomycin)
according to NCCLS criteria (
5). Susceptibility testing by
Etest, however, demonstrated that the NIH-R01-GAS isolate was
resistant
to trovafloxacin, levofloxacin, and grepafloxacin as
defined by NCCLS
criteria (
5) (Table
1). High
MICs of ciprofloxacin,
sparfloxacin, and norfloxacin were also found,
and there were
no zones of inhibition around the KB disks for
enrofloxacin, lomefloxacin,
and ofloxacin (Table
1). A MIC of 1.0 µg/ml suggested that the
isolate was sensitive to clinafloxacin. Low
MICs (
2.0 µg/ml)
and/or large KB disk zone sizes (
19 mm) for all
fluoroquinolones
tested, indicative of sensitivity, were found for the
three ATCC
strains and the seven additional clinical isolates that were
tested.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Fluoroquinolone susceptibilities of the ATCC strain and
clinical isolate of S. pyogenes determined by disk diffusion
and Etest
|
|
The
gyrA and
parC genes of
S. pneumoniae, encoding DNA gyrase A and topoisomerase IV subunit C,
respectively, have been well
characterized elsewhere (
1,
9,
11). The genome of
S. pyogenes ATCC 700294 is
currently being sequenced at the University of
Oklahoma
(
Streptococcus pyogenes Genome Project). For defining
gyrA in
S. pyogenes, the nucleic acid sequences
of
gyrA (
1)
and
parC (
11)
from
S. pneumoniae were used to search the
Streptococcus pyogenes Genome Project Database. Based on
homology with the counterpart
gyrA genes of
S. pneumoniae,
Staphylococcus aureus, and
Escherichia coli, the putative open reading frame of
gyrA of
S. pyogenes was
defined as a gene of
2,487 bp, encoding a protein of 829 residues.
The putative promoter of
gyrA of
S. pyogenes has a striking similarity
to
that of
gyrA of
S. pneumoniae (
1).
Extended putative
10
(TATGGTATAAT) (
1) and
35
(CTGATAA) regions were identified
upstream of the start
codon ATG. The deduced amino acid sequence
of the gyrase subunit A of
S. pyogenes demonstrated 79% identity
with GyrA of
S. pneumoniae (
1). However, identity was 88% when
the
first 400 amino acids in the N-terminal region were compared
based on
the genes from these two species (data not shown). The
open reading
frame of
parC of
S. pyogenes is a gene of 2,460 bp
encoding a protein of 820 residues. The deduced amino acid sequence
of subunit C of topoisomerase IV had 82% identity among the first
620 residues between
S. pyogenes and
S. pneumoniae
(data not
shown).
A phylogenetic protein tree was constructed based on amino acid
sequences available from GenBank using an unbalanced method
provided by
the computer program MegAlign (DNAStar, Inc. Madison,
Wis.). Both GyrA
and ParC of
S. pyogenes were most closely related
to those
of
S. pneumoniae (Fig.
1).
Based on the available data,
gyrase A of
S. pyogenes is next
most closely related to those
of
S. aureus and
Bacillus subtilis; ParC is next most closely
related to that
of
Streptococcus mitis. These data are in agreement
with but
expand the data from the phylogenetic comparisons of
these two genes
reported by Balas et al. (
1).
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Protein tree for the full-length gyrase A and ParC
subunit of topoisomerase IV of several bacterial species. The protein
sequences are from GenBank. The phylogenetic distance was determined
using the unbalanced method provided by the computer program MegAlign.
Lengths of branches correspond to sequence divergence. The scale
underneath the tree represents the actual number of amino acid
substitutions.
|
|
All 10 fluoroquinolone-sensitive ATCC and clinical isolates
demonstrated identical amino acid sequences for the QRDRs of both
gyrA and
parC (data not shown). In contrast,
mutations were identified
in both
gyrA and
parC
in the isolate NIH-R01-GAS. Specifically,
two point mutations within
the QRDR were identified in
gyrA, with
codon TCT (Ser-81,
location designation for
S. pyogenes ATCC 700294)
being
replaced by TTT (Phe) and ATG (Met-99) being replaced by
CTG (Leu).
Only a single point mutation was found in the QRDR
of
parC,
in which TAC (Tyr) replaced the codon TCC (Ser-79). Resistance
to
fluoroquinolones usually results from mutations in the QRDRs
of either
gyrA or
parC, or both genes, particularly at the
highly
conserved residues Ser-83 and Asp-87 (positions refer to those
of
E. coli) (
14,
18). Munoz and De La Campa
(
11) demonstrated
that most ciprofloxacin-resistant
S. pneumoniae strains in their
study had alterations at Ser-79
(analogous to Ser-83 of
E. coli or Ser-81 of
S. pyogenes), and the amino acid replacing the serine
residue was
either phenylalanine or tyrosine. This observation
has also been
reported by other investigators studying fluoroquinolone
resistance in
S. pneumoniae (
9,
12). Therefore, the
quinolone-resistant
isolate of
S. pyogenes has developed
mutational alterations of
key topoisomerases analogous to those
reported for quinolone resistance
of
S. pneumoniae.
Quinolone resistance in
S. pneumoniae arises through
mutations of
parC (and/or
parE) before changes in
gyrA occur, suggesting
that topoisomerase IV is the primary
target for the fluoroquinolones
in this organism (
8,
12). In
the quinolone-resistant isolate
of
S. pyogenes in this
study, mutations were identified in both
gyrA and
parC, which may explain its high level of resistance
to
fluoroquinolones. Because the resistant strain in the current
study
presented mutations at both sites at the time of isolation,
we cannot
determine the sequence of genetic transition from quinolone
sensitive
to resistant for these two target genes. The resistant
isolate in this
study demonstrated no sensitivity to all available
fluoroquinolones
tested, except to clinafloxacin. The superior
activity of clinafloxacin
has also been previously observed for
S. pneumoniae (
9,
13). Clinafloxacin is a novel C-8-substituted
fluoroquinolone and
is highly active against
S. pneumoniae (
17).
Pan
and Fisher have demonstrated that, in
S. pneumoniae, neither
gyrA nor
parC quinolone-resistance-conferring
mutants alone confer
increased resistance to clinafloxacin
(
13). Laboratory experiments
have shown that four
consecutive mutational steps are required
to induce significant
resistance to clinafloxacin, while only
two steps are required to
achieve the same level of resistance
for ciprofloxacin and three steps
are required for sparfloxacin
resistance (
13). Compared to
other tested quinolones, the mutations
identified in the
gyrA and
parC genes of the resistant clinical
isolate of
S. pyogenes had less effect on the activity of
clinafloxacin,
suggesting a potential clinical advantage for
clinafloxacin.
Nucleotide sequence accession number.
The DNA sequences
obtained from this study were submitted to GenBank under accession no.
AF220945, AF220946, AF222013, and AF223159.
| |
ACKNOWLEDGMENTS |
We thank Michael L. Pendrak for his assistance in the construction
of the phylogenetic tree of gyrase A and ParC proteins and Julie E. Niemela and Jodie M. Keary for assistance in nucleotide sequencing.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Microbiology
Service, CPD, Clinical Center, National Institutes of Health, Building 10, Rm. 2C385, Bethesda, MD 20892-1508. Phone: (301) 496-4433. Fax:
(301) 402-1886. E-mail: dfedorko{at}mail.cc.nih.gov.
| |
REFERENCES |
| 1.
|
Balas, D.,
E. Fernandez-Moreira, and A. G. De La Campa.
1998.
Molecular characterization of the gene encoding the DNA gyrase A subunit of Streptococcus pneumoniae.
J. Bacteriol.
180:2854-2861[Abstract/Free Full Text].
|
| 2.
|
Blondeau, J. M.
1999.
A review of the comparative in-vitro activities of 12 antimicrobial agents, with a focus on five new respiratory quinolones.
J. Antimicrob. Chemother.
43(Suppl. B):1-11[Free Full Text].
|
| 3.
|
Chen, D. K.,
A. McGeer,
J. C. de Azavedo,
E. E. Low, and the Canadian Bacterial Surveillance Network.
1999.
Decreased susceptibility of Streptococcus pneumoniae to fluoroquinolones in Canada. Canadian Bacterial Surveillance Network.
N. Engl. J. Med.
341:233-239[Abstract/Free Full Text].
|
| 4.
|
Drlica, K.
1999.
Mechanism of fluoroquinolone action.
Curr. Opin. Microbiol.
2:504-508[CrossRef][Medline].
|
| 5.
|
Ferraro, M. J.,
W. A. Craig,
M. N. Dudley,
G. Eliopoulos,
D. W. Hecht,
J. Hindler,
L. B. Reller,
A. T. Sheldon,
J. M. Swenson,
F. C. Tenover,
R. T. Testa,
M. P. Weinstein, and M. A. Wikler.
2000.
NCCLS (ed.), Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically., Approved standard, 5th ed. M7-A5 and M100-S10
NCCLS, Wayne, Pa.
|
| 6.
|
Grimbacher, B.,
S. Holland,
J. Gallin,
F. Greenberg,
S. Hill,
H. Malech,
J. Miller,
A. O'Connell, and J. Puck.
1999.
Hyper-IgE syndrome with recurrent infections an autosomal dominant multisystem disorder.
N. Engl. J. Med.
340:692-702[Abstract/Free Full Text].
|
| 7.
|
Ho, P. L.,
T. L. Que,
D. N. Tsang,
T. K. Ng,
K. H. Chow, and W. H. Seto.
1999.
Emergence of fluoroquinolone resistance among multiply resistant strains of Streptococcus pneumoniae in Hong Kong.
Antimicrob. Agents Chemother.
43:1310-1313[Abstract/Free Full Text].
|
| 8.
|
Janoir, C.,
V. Zeller,
M. D. Kitzis,
N. J. Moreau, and L. Gutmann.
1996.
High-level fluoroquinolone resistance in Streptococcus pneumoniae requires mutations in parC and gyrA.
Antimicrob. Agents Chemother.
40:2760-2764[Abstract].
|
| 9.
|
Jorgensen, J. H.,
L. M. Weigel,
M. J. Ferraro,
J. M. Swenson, and F. C. Tenover.
1999.
Activities of newer fluoroquinolones against Streptococcus pneumoniae clinical isolates including those with mutations in the gyrA, parC, and parE loci.
Antimicrob. Agents Chemother.
43:329-334[Abstract/Free Full Text].
|
| 10.
|
Louie, A.,
A. L. Baltch,
W. J. Ritz, and R. P. Smith.
1991.
In vitro activity of sparfloxacin and six reference antibiotics against gram-positive bacteria.
Chemotherapy
37:275-282[Medline].
|
| 11.
|
Munoz, R., and A. G. De La Campa.
1996.
ParC subunit of DNA topoisomerase IV of Streptococcus pneumoniae is a primary target of fluoroquinolones and cooperates with DNA gyrase A subunit in forming resistance phenotype.
Antimicrob. Agents Chemother.
40:2252-2257[Abstract].
|
| 12.
|
Pan, X. S.,
J. Ambler,
S. Mehtar, and L. M. Fisher.
1996.
Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
40:2321-2326[Abstract].
|
| 13.
|
Pan, X. S., and L. M. Fisher.
1998.
DNA gyrase and topoisomerase IV are dual targets of clinafloxacin action in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:2810-2816[Abstract/Free Full Text].
|
| 14.
|
Pan, X. S., and L. M. Fisher.
1997.
Targeting of DNA gyrase in Streptococcus pneumoniae by sparfloxacin: selective targeting of gyrase or topoisomerase IV by quinolones.
Antimicrob. Agents Chemother.
41:471-474[Abstract].
|
| 15.
|
Stevens, D. L.
1992.
Invasive group A streptococcus infections.
Clin. Infect. Dis.
14:2-11[Medline].
|
| 16.
|
Tankovic, J.,
B. Perichon,
J. Duval, and P. Courvalin.
1996.
Contribution of mutations in gyrA and parC genes to fluoroquinolone resistance of mutants of Streptococcus pneumoniae obtained in vivo and in vitro.
Antimicrob. Agents Chemother.
40:2505-2510[Abstract].
|
| 17.
|
Waites, K.,
E. Brookings,
S. Nix,
A. Robinson,
B. Gray, and E. Swiatlo.
1998.
Comparative in vitro activities of four new fluoroquinolones against Streptococcus pneumoniae determined by Etest.
Int. J. Antimicrob. Agents
9:215-218[CrossRef][Medline].
|
| 18.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272[Abstract/Free Full Text].
|
Antimicrobial Agents and Chemotherapy, November 2000, p. 3196-3198, Vol. 44, No. 11
0066-4804/00/$04.00+0
This article has been cited by other articles:
-
Malhotra-Kumar, S., Van Heirstraeten, L., Lammens, C., Chapelle, S., Goossens, H.
(2009). Emergence of high-level fluoroquinolone resistance in emm6 Streptococcus pyogenes and in vitro resistance selection with ciprofloxacin, levofloxacin and moxifloxacin. J Antimicrob Chemother
63: 886-894
[Abstract]
[Full Text]
-
Wajima, T., Murayama, S. Y., Sunaoshi, K., Nakayama, E., Sunakawa, K., Ubukata, K.
(2008). Distribution of emm type and antibiotic susceptibility of group A streptococci causing invasive and noninvasive disease. J Med Microbiol
57: 1383-1388
[Abstract]
[Full Text]
-
Wu, H.-M., Janapatla, R. P., Ho, Y.-R., Hung, K.-H., Wu, C.-W., Yan, J.-J., Wu, J.-J.
(2008). Emergence of Fluoroquinolone Resistance in Group B Streptococcal Isolates in Taiwan. Antimicrob. Agents Chemother.
52: 1888-1890
[Abstract]
[Full Text]
-
Billal, D. S., Fedorko, D. P., Yan, S. S., Hotomi, M., Fujihara, K., Nelson, N., Yamanaka, N.
(2007). In vitro induction and selection of fluoroquinolone-resistant mutants of Streptococcus pyogenes strains with multiple emm types. J Antimicrob Chemother
59: 28-34
[Abstract]
[Full Text]
-
Pletz, M. W. R., McGee, L., Van Beneden, C. A., Petit, S., Bardsley, M., Barlow, M., Klugman, K. P.
(2006). Fluoroquinolone Resistance in Invasive Streptococcus pyogenes Isolates Due to Spontaneous Mutation and Horizontal Gene Transfer. Antimicrob. Agents Chemother.
50: 943-948
[Abstract]
[Full Text]
-
Powis, J., McGeer, A., Duncan, C., Goren, R., de Azavedo, J. C. S., Bast, D. J., Pong-Porter, S., Mazzulli, T., Green, K., Willey, B., Low, D. E.
(2005). Prevalence and Characterization of Invasive Isolates of Streptococcus pyogenes with Reduced Susceptibility to Fluoroquinolones. Antimicrob. Agents Chemother.
49: 2130-2132
[Abstract]
[Full Text]
-
Alonso, R., Mateo, E., Galimand, M., Garaizar, J., Courvalin, P., Cisterna, R.
(2005). Clonal Spread of Pediatric Isolates of Ciprofloxacin-Resistant, emm Type 6 Streptococcus pyogenes. J. Clin. Microbiol.
43: 2492-2493
[Abstract]
[Full Text]
-
Malhotra-Kumar, S., Lammens, C., Chapelle, S., Mallentjer, C., Weyler, J., Goossens, H.
(2005). Clonal spread of fluoroquinolone non-susceptible Streptococcus pyogenes. J Antimicrob Chemother
55: 320-325
[Abstract]
[Full Text]
-
Ikebe, T., Hirasawa, K., Suzuki, R., Isobe, J., Tanaka, D., Katsukawa, C., Kawahara, R., Tomita, M., Ogata, K., Endoh, M., Okuno, R., Watanabe, H., the Working Group for Group A Streptococci in Japa,
(2005). Antimicrobial Susceptibility Survey of Streptococcus pyogenes Isolated in Japan from Patients with Severe Invasive Group A Streptococcal Infections. Antimicrob. Agents Chemother.
49: 788-790
[Abstract]
[Full Text]
-
Alberti, S., Cortes, G., Garcia-Rey, C., Rubio, C., Baquero, F., Garcia-Rodriguez, J. A., Bouza, E., Aguilar, L., the Spanish Surveillance Group for Respiratory Pat,
(2005). Streptococcus pyogenes Pharyngeal Isolates with Reduced Susceptibility to Ciprofloxacin in Spain: Mechanisms of Resistance and Clonal Diversity. Antimicrob. Agents Chemother.
49: 418-420
[Abstract]
[Full Text]
-
Kawamura, Y., Fujiwara, H., Mishima, N., Tanaka, Y., Tanimoto, A., Ikawa, S., Itoh, Y., Ezaki, T.
(2003). First Streptococcus agalactiae Isolates Highly Resistant to Quinolones, with Point Mutations in gyrA and parC. Antimicrob. Agents Chemother.
47: 3605-3609
[Abstract]
[Full Text]
-
Singer, M. E., Harding, I., Jacobs, M. R., Jaffe, D. H.
(2003). Impact of antimicrobial resistance on health outcomes in the out-patient treatment of adult community-acquired pneumonia: a probability model. J Antimicrob Chemother
51: 1269-1282
[Abstract]
[Full Text]
-
Jones, H. E., Brenwald, N. P., Owen, K. A., Gill, M. J.
(2003). A multidrug efflux phenotype mutant of Streptococcus pyogenes. J Antimicrob Chemother
51: 707-710
[Abstract]
[Full Text]
-
Alonso, R., Galimand, M., Courvalin, P.
(2002). parC Mutation Conferring Ciprofloxacin Resistance in Streptococcus pyogenes BM4513. Antimicrob. Agents Chemother.
46: 3686-3687
[Full Text]
-
Schmitz, F.-J., Boos, M., Mayer, S., Kohrer, K., Scheuring, S., C. Fluit, A.
(2002). In Vitro Activities of Novel Des-Fluoro(6) Quinolone BMS-284756 against Mutants of Streptococcus pneumoniae, Streptococcus pyogenes, and Staphylococcus aureus Selected with Different Quinolones. Antimicrob. Agents Chemother.
46: 934-935
[Full Text]
Top
Abstract
Text
