Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 2000, p. 3465-3472, Vol. 44, No. 12
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Differential Removal of Thymidine Nucleotide Analogues from
Blocked DNA Chains by Human Immunodeficiency Virus Reverse
Transcriptase in the Presence of Physiological Concentrations of
2'-Deoxynucleoside Triphosphates
Peter R.
Meyer,1
Suzanne E.
Matsuura,1
Raymond F.
Schinazi,2
Antero G.
So,3 and
Walter A.
Scott1,*
Department of Biochemistry and Molecular
Biology1 and Department of
Medicine,3 University of Miami, Miami, Florida,
and Department of Pediatrics, Emory University/Veterans
Affairs Medical Center, Decatur, Georgia2
Received 4 April 2000/Returned for modification 22 June
2000/Accepted 25 August 2000
 |
ABSTRACT |
Removal of 2',3'-didehydro-3'-deoxythymidine-5'-monophosphate
(d4TMP) from a blocked DNA chain can occur through transfer of the
chain-terminating residue to a nucleotide acceptor by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT). ATP-dependent removal of either d4TMP or
3'-azido-3'-deoxythymidine-5'-monophosphate (AZTMP) is
increased in AZT resistant HIV-1 RT (containing D67N/K70R/T215F/K219Q mutations). Removal of d4TMP is strongly inhibited by the next complementary deoxynucleoside triphosphate (50% inhibitory
concentration [IC50] of ~0.5 µM), whereas removal of
AZTMP is much less sensitive to this inhibition (IC50 of
>100 µM). This could explain the lack of cross-resistance by
AZT-resistant HIV-1 to d4T in phenotypic drug susceptibility assays.
 |
TEXT |
Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and other retroviral RTs lack 3'-5'
exonuclease activity (2, 30) but can remove 3'-terminal
chain-terminating residues from blocked DNA chains through a
nucleotide-dependent mechanism leading to production of dinucleoside
polyphosphates (23, 24) or through pyrophosphorolysis
(the reversal of polymerization) (1, 4, 13, 29). We have
recently shown (23) that HIV-1 RT containing the
3'-azido-3'-deoxythymidine (AZT) resistance mutations D67N, K70R,
T215F, and K219Q (67/70/215/219 mutant RT) removes
AZT-5'-monophosphate (AZTMP) from blocked primer-templates through the
nucleotide-dependent mechanism more efficiently than does wild-type
(WT) RT. The mutant enzyme also removes
2',3'-dideoxyadenosine-5'-monophosphate (ddAMP) from
blocked DNA chains more efficiently than does WT RT. Removal of
ddAMP is strongly suppressed by physiological concentrations of
deoxynucleoside triphosphates (dNTPs), whereas removal of AZTMP is much
less sensitive to this inhibition (23).
The chain terminator 2',3'-didehydro-3'-deoxythymidine-5'-triphosphate
(d4TTP) is efficiently incorporated into growing DNA chains by HIV-1 RT
(39). Resistance to d4T can arise in cell culture through a
valine-to-threonine mutation at position 75 (19, 21, 32);
however, this mutation is rarely observed in HIV-1 from d4T-treated
individuals (6, 9, 17, 22, 27, 35). Instead, mutations
associated with AZT resistance, including M41L, D67N, K70R, L210W, and
T215Y/F, are frequently selected (6, 8, 21, 22, 27, 32, 35).
The selection of AZT resistance mutations by d4T in the absence of AZT
is unexpected, since phenotypic assays show little, if any,
cross-resistance between these drugs (20, 22). Nonetheless,
clinical studies have shown that prior exposure to AZT reduces the
efficacy of subsequent treatment with d4T (17), and the
presence of AZT resistance mutations is correlated with reduced
suppression of viral load in response to d4T-containing therapies
(15, 25). These results suggest that the phenotypic assays
do not fully reflect the in vivo sensitivity of HIV-1 replication
to d4T.
In an effort to understand the biochemical basis for the lack of
cross-resistance by AZT-resistant mutants to d4T, we have investigated
the ability of WT and 67/70/215/219 mutant RT to remove d4TMP, AZTMP,
and 3'-deoxythymidine monophosphate (ddTMP) from chain-terminated DNA
primers through either dinucleoside polyphosphate synthesis or pyrophosphorolysis.
Removal of dTMP analogues from blocked primer-templates.
The
removal of chain-terminating nucleotides was assessed by measuring the
formation of unblocked primer from a previously blocked primer-template
(24) (Fig. 1A). These
experiments were carried out in two steps. First,
HIV-1 RT was incubated with the blocked primer-template in the presence
of the appropriate substrate for either ATP- or pyrophosphate
(PPi)-dependent removal of the chain-terminating nucleotide
(rescue step). This was followed by heat inactivation of the RT and
extension of unblocked primer-template by addition of all four dNTPs
and exonuclease-free Klenow fragment of E. coli DNA
polymerase 1 (which, under the conditions used here, does not remove
chain-terminating nucleotides in the absence or presence of ATP or
PPi; Fig. 1B) (extension step). The experiments were
performed in this way in order to avoid inhibition of primer unblocking
by dNTPs (23, 24) and to exclude further unblocking during
the extension reaction.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
Unblocking of chain-terminated primer-templates by WT or
67/70/215/219 mutant RT through either dinucleoside polyphosphate
synthesis or pyrophosphorolysis. (A) Rescue of d4TMP-terminated primer.
d4TMP-terminated 5'-32P-labeled L33 primer-WL50 template (5 nM) was incubated with 200 nM WT (upper panels) or 67/70/215/219 mutant
RT (lower panels) and with no substrate (left panels), 3.2 mM ATP
(middle panels), or 50 µM PPi (right panels) for the
indicated times at 37°C. The RT was inactivated by heat treatment,
and the unblocked primer was extended by incubation with
exonuclease-free Klenow fragment of E. coli DNA polymerase I
and all four dNTPs. Products were fractionated on a 10% denaturing
polyacrylamide gel (24). Positions for unextended primer
(primer) and for products formed after elongation to the end of the template (ext.
primer) are shown at the left of the figure. Lane 1, unextended
primer-template. (B) Effect of incubation in the absence of HIV-1 RT.
The experiment was performed as described in panel A in the absence of
HIV-1 RT (lanes 1 to 4) or with HIV-1 RT (lane 5) with or without added
ATP (3.2 mM) or PPi (50 µM), as indicated in the figure,
for 40 min at 37°C. After heat treatment, unblocked primer was
extended by addition of exonuclease-free Klenow fragment of E. coli DNA polymerase I and all four dNTPs. (C) Rescue of primer
terminated with d4TMP, AZTMP, or ddTMP. Incubations were carried out as
in panel A with primer terminated with either d4TMP, AZTMP, or ddTMP in
the presence of 3.2 mM ATP (left panels) or 50 µM PPi
(right panels) and WT RT ( ) or 67/70/215/219 mutant RT ( ).
Radioactivity in products of >34 nucleotides (rescued primers) was
quantitated by phosphorimaging and expressed as percentage of total
radioactivity in the lane. The data were fitted to a hyperbola using
Sigmaplot 4.0 (solid lines).
|
|
WT or mutant HIV-1 RT was incubated with d4TMP-terminated,
5'-
32P-labeled L33 primer-WL50 template in the absence or
presence
of either 3.2 mM ATP or 50 µM PP
i at 37°C for
the times indicated
in Fig.
1A. L33 and WL50 are synthetic
oligodeoxynucleotides with
the following sequences: chain-terminated
L33, 5'-CTACTAGTTTTCTCCATCTAGACGATACCAGAAT
AN-3';
and WL50,
3'-GATGATCAAAAGAGGT AGATCTGCTATGGTCTTACTTCTGGAGTCGTGAG-5'.
T
AN
refers to the chain-terminating 3'-deoxythymidylate analogues
d4TMP,
AZTMP, and
ddTMP.
The HIV-1 RTs used in these experiments were derived from the
expression vector pKRT2, containing RT coding sequences from
human
T-cell leukemia virus type III BH10 (
7), to which an
N-terminal polyhistidine tail had been added (
24). The
enzymes
were purified as previously described (
24) and were
predominantly
homodimeric. The 67/70/215/219 mutant RT contained the
mutations
in both
subunits.
In the absence of incubation with HIV-1 RT (Fig.
1A, lanes 2, 7, and
12, upper and lower panels, and Fig.
1B, lanes 2 to 4),
a small portion
of the primer could be extended, possibly due
to incomplete chain
termination. If the first incubation was performed
in the absence of
ATP or PP
i, a minimal increase in the amount
of unblocked
primer was observed even after extended incubation
(lanes 2 to 6 in the
upper panel and lanes 2 to 5 in the lower
one). In the presence of ATP,
however, there was a time-dependent
increase in the amount of
extendible primer (lanes 7 to 11). ATP-dependent
rescue of
d4TMP-terminated primer was much more efficient with
67/70/215/219
mutant RT than with WT RT. On the other hand, when
PP
i was
used as a substrate for the rescue reaction, there was
little
difference between the mutant and WT RTs. The dependence
on the
addition of ATP or PP
i suggests that the primer rescue
could not be accounted for by contaminating exonuclease activity.
To
obtain a sensitive measure of exonuclease present in each enzyme
preparation, 3'-labeled [
32P]ddAMP-terminated
primer-template was incubated with a 40-fold
excess of RT. For both WT
and mutant enzymes a similar amount
of the label (ca. 4 to 5%) was
released as [
32P]ddAMP after 1 h of incubation at
37°C.
The results from experiments such as the one presented in Fig.
1A were
quantitated using a Molecular Dynamics PhosphorImager,
and the
percentage of primer rescued was plotted versus time (Fig.
1C). The
ATP-dependent removal of d4TMP was greatly increased
in the
67/70/215/219 mutant RT compared to WT RT (upper left panel),
whereas
removal through pyrophosphorolysis was slightly decreased
in the
67/70/215/219 mutant RT (upper right panel). We also determined
the
ability of WT and 67/70/215/219 mutant RT to remove AZTMP
(middle
panels) or ddTMP (lower panels) through either ATP-dependent
rescue
(left panels) or pyrophosphorolysis (right panels). The
rate of the
ATP-dependent reaction catalyzed by the 67/70/215/219
mutant RT was
much greater than that catalyzed by WT RT for the
removal of each of
the three chain-terminating thymidylate analogues,
whereas
PP
i-dependent removal occurred at a slightly increased
rate
with WT
RT.
Inhibition of primer rescue by the dNTP complementary to the next
position on the template.
We have previously shown that formation
of a stable dead-end complex (DEC) in the presence of micromolar
concentrations of the dNTP complementary to the next nucleotide
position on the template can be detected by an electrophoretic mobility
shift assay (38). The DEC may be equivalent to the catalytic
complex recently described by Huang et al. (14). We have
also shown that removal of chain-terminating residues by RT is
inhibited by micromolar concentrations of the next complementary dNTP,
leading us to suggest that DEC formation and inhibition of primer
rescue may be related events (24). Figure
2 shows a comparison of the concentration
of dGTP, the dNTP complementary to the next nucleotide position on the
template, required for inhibition of ATP-dependent primer rescue (Fig.
2A), inhibition of PPi-dependent primer rescue (Fig. 2B),
and for DEC formation (Fig. 2C), with primer-templates terminated with
each of the three dTMP analogues.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Ability of the dNTP complementary to the next nucleotide
position on the template to inhibit primer rescue and to induce a
stable complex with chain-terminated primer-template and 67/70/215/219
mutant RT. (A and B) Inhibition of primer rescue by dGTP. Rescue by
67/70/215/219 mutant RT of primer-templates terminated with d4TMP
( ), ddTMP ( ), or AZTMP ( ) using either ATP (A) or
PPi (B) as a substrate was performed as described in the
legend to Fig. 1, in the presence of the indicated concentrations of
dGTP. The results were quantitated by phosphorimaging, and the percent
inhibition was plotted versus dGTP concentration and fitted to
hyperbolas (solid lines) using Sigmaplot 4.0. (C) Formation of DEC with
67/70/215/219 mutant RT, chain-terminated primer-templates, and dGTP.
DEC formation was carried out in the absence of ATP or PPi
and was monitored by gel mobility shift assay as described previously
(23, 38). The percent DEC formation was plotted as a
function of dGTP concentration. The primer-templates are identified as
in panel A. Partial sequences of the WL50 template and L33 primer
terminated with a dTMP analogue (TAN) are shown.
|
|
Excess 67/70/215/219 mutant RT was incubated with chain-terminated,
5'-
32P-labeled L33 primer-WL50 template and 3.2 mM ATP
(Fig.
2A) or
50 µM PP
i (Fig.
2B) in the presence of
various concentrations
of dGTP to determine the 50% inhibitory
concentrations (IC
50s)
for dGTP inhibition of each rescue
activity (Table
1). Removal
of either
d4TMP or ddTMP was strongly suppressed by dGTP
(IC
50s
of ~0.4 to 0.8 µM and of ~2 µM,
respectively). In contrast, both
ATP-dependent removal and
PP
i-dependent removal of AZTMP were
much less
sensitive to the presence of dGTP (IC
50s of >100
µM),
in agreement with previous results (
23).
Figure
2C shows DEC formation with primer-template terminated with each
of the three dTMP analogues. Excess 67/70/215/219
mutant RT was
incubated with 5'-
32P-labeled, chain-terminated L33
primer-WL50 template in the presence
of the indicated concentrations of
dGTP for 15 min at 37°C. The
samples were fractionated by
electrophoresis through a nondenaturing
polyacrylamide gel, and DEC was
identified by its slower electrophoretic
mobility (
23,
38).
Free primer-template and DEC were quantitated
by phosphorimaging, and
the percent DEC was plotted versus dGTP
concentration (Fig.
2C) to
obtain the
Kd,app, the dGTP
concentration
required for formation of 50% DEC (Table
1).
Kd,app for AZTMP-terminated
primer-template was 30 to 100-fold higher than for either ddTMP-
or
d4TMP-terminated primer-template. The amount of dGTP needed
for
inhibition of primer rescue and for DEC formation were similar,
consistent with a model in which the removal reaction cannot occur
while HIV-1 RT and primer-template are trapped as DEC (
23).
To determine whether dNTP inhibition of primer rescue was influenced by
template sequence, the experiments in Fig.
2A were
repeated with a
template in which dC at the first downstream position
from the primer
terminus was replaced with dG. With this template,
removal of the dTMP
analogues was inhibited by dCTP (IC
50s of
1.7 ± 0.1 µM for d4TMP-terminated primer, 5.5 ± 0.5 µM for
ddTMP-terminated
primer, and 790 ± 190 µM for AZTMP-terminated
primer) and was
insensitive to dATP, dGTP, and dTTP (IC
50s
of >1,000 µM) (data
not shown). These results demonstrate that the
specificity for
dNTP inhibition of primer rescue is determined by the
next nucleotide
position on the
template.
Primer extension in the presence of chain-terminating
nucleotides.
The 67/70/215/219 mutant RT was incubated with
5'-32P-labeled D25 primer annealed to D70 template, all
four dNTPs, and d4TTP, AZTTP, or no chain terminator, in the absence or
presence of 3.2 mM ATP (Fig. 3). The
concentration of chain terminator was adjusted to maintain a fixed
ratio to dTTP in each reaction mixture (d4TTP/dTTP = 4:1 and
AZTTP/dTTP = 2:1). The ratios of dTTP analogue to dTTP were chosen
to give similar patterns of termination products in a size range
suitable for gel analysis.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension by 67/70/215/219 mutant RT in the
presence of d4TTP or AZTTP or in the absence of chain terminator. (A)
5'-32 P-labeled D25 primer-D70 template (5 nM) was
incubated for 30 min at 37°C with 200 nM 67/70/215/219 mutant RT, the
indicated concentrations of all four dNTPs, and d4TTP (d4TTP/dTTP = 4:1) (upper panel); AZTTP (AZTTP/dTTP = 2:1) (middle panel), or
no chain-terminating nucleotide (lower panel), in the absence ( ATP)
or presence (+ATP) of 3.2 mM ATP. The products were fractionated on a
10% denaturing polyacrylamide gel. The primer lengths are indicated in
nucleotides. Lane 1, untreated primer-template. (B) The results in
panel A were quantitated by phosphorimaging, and the 31-mer
chain-terminated product formed in the presence of ATP plus d4TTP plus
dNTPs ( ) or ATP plus AZTTP plus dNTPs ( ), expressed as a
percentage of the total radioactivity in the lane, was plotted versus
the dNTP concentration.
|
|
The sequences of the 25-mer DNA primer (D25) and 70-mer DNA template
(D70) were as follows: D25, 5'-GTTTCTGATCTGGTGTGAAAAGTCC-3';
and D70,
3'-CAAAGAC TAGACCACACTTTTCAGGGGTGGAGTTGTCTACAAC AGAGTCGAGGAGATAAAAACAAGATAC-5'.
In the presence of dNTPs and d4TTP, the 25-mer DNA primer was extended
and terminated at the expected T incorporation sites
(Fig.
3A, upper
panel). The primer extension products observed
in this experiment were
due to chain termination rather than enzyme
pausing since the formation
of these products depended on the
presence of chain-terminating
nucleotide analogues (Fig.
3A, compare
the upper and lower panels).
When 3.2 mM ATP was included in the
reaction mixture, longer products
were observed (59 to 70 bases
in length), while the shorter species,
such as the 31-mer product
corresponding to the first termination site,
were depleted (Fig.
3A, upper panel, compare lanes 2 and 8). This is
consistent with
ATP-dependent rescue of DNA chains initially terminated
with d4TMP
and further extension by RT. At higher dNTP concentrations,
the
ATP-dependent formation of longer extension products was
diminished
and the shorter species were less depleted (Fig.
3A,
upper panel,
and Fig.
3B), as expected from the inhibition of d4TMP
removal
by the next complementary
dNTP.
A parallel experiment with AZTTP is shown in the middle panel of Fig.
3A. When AZTTP was present in the reaction mixture,
ATP-dependent
rescue also led to an increase in longer products
and a decrease in the
31-mer product as we have previously reported
(
23) (Fig.
3A,
middle panel, compare lanes 2 and 8). In contrast
with the results with
d4TMP-terminated primer, the rescue of the
31-nucleotide AZTMP
termination product was not inhibited at higher
dNTP concentrations
(Fig.
3B).
dNTP inhibition of primer rescue was further investigated by
purification of the mixture of d4TMP (Fig.
4A, upper panel) or
AZTMP (Fig.
4A, lower
panel) termination products and further
incubation with RT in absence
of ATP or in the presence of ATP
without added dNTPs or with each of
the four dNTPs individually.
Following the incubation in which
ATP-dependent rescue of chain-terminated
primer could occur (rescue
step), the RT was heat inactivated,
and the rescued products were
extended with exonuclease-free Klenow
fragment of DNA polymerase
I (extension step). Individual chain
termination products were
quantitated by phosphorimaging (Fig.
4B). Rescue of chains terminated
at position 31 was not observed
when ATP was omitted during the rescue
step (Fig.
4A, lanes 1
to 4); however, the products were rescued when
ATP was present
(Fig.
4A, lanes 5 to 7, and 4B). Addition of both
dCTP and ATP
during the rescue step resulted in almost complete
inhibition
of rescue of the d4TMP-terminated 31-nucleotide products but
no
detectable inhibition of rescue of the corresponding
AZTMP-terminated
product (Fig.
4A, lanes 11 to 13, and 4B). Addition of
dATP, dGTP,
or dTTP during the rescue step resulted in no inhibition of
rescue
of either d4TMP- or AZTMP-terminated 31-mers (Fig.
4A, lanes 8
to 10 and 14 to 19, and 4B). Examination of the template sequence
(bottom of Fig.
4A) shows that the nucleotide following the position
31 termination site is dG. Therefore, a primer-template terminated
at
position 31 would form DEC with dCTP resulting in dCTP-specific
inhibition of rescue of this termination product, as was observed.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of dNTPs on ATP-dependent removal of chain
terminators in multiple sequence contexts. (A)
5'-32P-labeled D25 primer-D70 template was incubated for 30 min at 37°C with excess 67/70/215/219 mutant RT, 1 µM
concentrations of all four dNTPs, and either d4TTP (2 µM) or AZTTP (1 µM). The resulting mixtures of chain-terminated products were
extracted with phenol-chloroform, followed by ethanol precipitation.
Excess 67/70/215/219 RT (200 nM) was incubated with either
d4TMP-terminated products (5 nM) (upper panel) or AZTMP-terminated
products (5 nM) (lower panel) in the absence or presence of 3.2 mM ATP
and in the presence or absence of 50 µM of the indicated dNTP for the
indicated times at 37°C. After heat inactivation of the HIV-1 RT (5 min at 90°C), unblocked primers were extended by the addition of
exonuclease-free Klenow fragment of E. coli DNA polymerase I
and 100 µM concentrations of each of the four dNTPs and the
incubation at 37°C for 30 min. Product lengths are indicated in
nucleotides. A partial sequence of the D70 template is shown. (B)
Inhibition of ATP-dependent primer rescue by dNTPs. The results shown
in panel A were quantitated by phosphorimaging. The amounts of
radioactivity in the 31-mer products (left panels), the 39-mer products
(middle panels), and the 41-mer products (right panels) terminated with
either d4TMP (upper panels) or AZTMP (lower panels) were normalized to
the total radioactivity in each lane. The percent ATP-dependent rescue
was calculated by the formula: 100 100(a/b),
where a and b are the normalized radioactivity in
the band of interest in the presence or absence of ATP, respectively,
and plotted versus time. The data (indicated by the symbols shown at
the bottom of the figure) were fitted to hyperbolas (solid lines) using
Sigmaplot 4.0.
|
|
Similar analysis of termination products at position 39 showed that
rescue of d4TMP termination products was inhibited specifically
when
dGTP was present during the rescue step, whereas AZTMP termination
products were only slightly inhibited (Fig.
4B, middle panels).
The
template nucleotide following the position 39 termination
site is dC.
Rescue of d4TMP termination products at position 41
was specifically
inhibited by dTTP, whereas the AZTMP termination
products at this
site were not inhibited (Fig.
4B, right panels).
The template
nucleotide following the position 41 termination
site is dA. In
summary, ATP-dependent rescue of d4TMP termination
products was
specifically inhibited by the dNTP complementary
to the next position
on the template in each of these three sequence
contexts, and rescue of
AZTMP termination products was much less
sensitive to this inhibition
in each
case.
From these results we predict that the removal of d4TMP in vivo will
depend on the intracellular levels of dNTPs (low dNTP
pools allow
rescue to occur, while high dNTP pools will greatly
suppress it),
whereas removal of AZTMP will be much less sensitive
to physiological
concentrations of
dNTPs.
Conclusions.
We have shown that the 67/70/215/219 mutant RT
has increased ability, compared to WT RT, to remove d4TMP, AZTMP, and
ddTMP from blocked DNA primer-templates through transfer of the chain terminator to a nucleotide acceptor. We have previously shown that
mutant RT also has increased ability to remove ddAMP from a primer
terminus (23), and we have preliminary results that ddGMP
and ddCMP removal activities are also increased in the mutant enzyme
(P. R. Meyer et al., unpublished results). In contrast, we did not
observe an increase in the transfer of chain terminator to
pyrophosphate by the mutant RT. The removal of d4TMP or ddTMP was
inhibited by micromolar or submicromolar concentrations of the
next complementary dNTP, whereas removal of AZTMP was
>50-fold less sensitive to this inhibition.
The removal of chain terminators in vivo will, presumably, be
controlled by the concentrations of nucleotide acceptors for
the
transfer reaction as well as the levels of dNTPs, which are
inhibitory.
ATP is present at millimolar concentrations in lymphocytes
(
37), making it the most likely acceptor substrate for the
removal
reaction. Estimates of dNTP concentrations depend on
assumptions
about cell volume (
3,
5,
11,
33,
36) and range
from
0.14 to 5.6 µM in resting lymphocytes (
10,
11,
31,
37),
2.4 to 26 µM in mitogen-stimulated lymphocytes (
10,
11), and
15 to 170 µM in CEM lymphoblasts (
31,
37).
These values suggest
that removal of AZTMP residues can occur in cells
at most stages
of activation, since the IC
50 for dNTP
inhibition is >100 µM,
but that removal of d4TMP will be inhibited
except in cells that
are relatively quiescent. However, even in
activated lymphocytes,
where the d4T is a much better inhibitor than in
resting cells
due to a higher d4TTP/dTTP ratio (
34), d4TMP
that has been incorporated
might be removed by HIV-1 RT during
subsequent periods of reduced
cell activation. The physiological
importance of removal of d4TMP
is difficult to evaluate since dNTP
pools may differ between cell
types and dNTP concentrations may be
unevenly distributed within
a cell. Nonetheless, the finding that
mutations that increase
the removal reaction are selected during d4T
therapy suggests
that removal of d4TMP from growing DNA chains is
physiologically
relevant.
From the results of phenotypic drug susceptibility assays it has been
concluded that AZT-resistant HIV-1 is not cross-resistant
to d4T
(
20,
22). However, this conclusion fails to account
for the
selection of AZT resistance mutations during d4T monotherapy
(
6,
8,
21,
22,
27,
32,
35) or why treatment regimens
containing d4T
are less effective in patients harboring AZT-resistant
virus (
15,
17,
25). An explanation may lie in the fact that
the most
commonly used phenotypic drug susceptibility assays use
either
mitogen-stimulated peripheral blood lymphocytes (
16,
21,
22)
or transformed human cell lines (
12,
18,
20,
26,
28) to
optimize virus replication. In these systems the
intracellular dNTP
pools are elevated. The phenotypic assays show
that the 67/70/215/219
mutant HIV-1 is sensitive to d4T but resistant
to AZT; however, we
predict that the 67/70/215/219 mutant HIV-1
would be cross-resistant to
d4T under conditions where the dNTP
pools are
low.
In patients harboring AZT-resistant virus, infected cells may go
through periods when they are not continuously stimulated
to divide and
the dNTP pools may be reduced. Under these conditions
the AZT resistant
RT will have an increased ability to remove
d4TMP compared to WT RT.
This would give the AZT-resistant HIV-1
a replicative advantage over WT
virus, and the AZT resistance
mutations would be selected. Our
results suggest that phenotypic
assays for HIV drug susceptibility may
need to be reevaluated,
taking into account the selective effects of
dNTP pools on the
sensitivities of WT and mutant viruses to nucleoside
analogues.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grants AI-39973 (W.A.S.) and
DK-26206 (A.G.S.) and by the Department of Veteran Affairs (R.F.S.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, University of Miami School of
Medicine, P.O. Box 016129, Miami, FL 33101-6129. Phone: (305) 243-6359. Fax: (305) 243-3342. E-mail: wscott{at}miami.edu.
 |
REFERENCES |
| 1.
|
Arion, D.,
N. Kaushik,
S. McCormick,
G. Borkow, and M. A. Parniak.
1998.
Phenotypic mechanism of HIV-1 resistance to 3'-azido-3'-deoxythymidine (AZT): increased polymerization processivity and enhanced sensitivity to pyrophosphate of the mutant viral reverse transcriptase.
Biochemistry
37:15908-15917[CrossRef][Medline].
|
| 2.
|
Battula, N., and L. A. Loeb.
1976.
On the fidelity of DNA replication: lack of exodeoxyribonuclease activity and error-correction function in avian myeloblastosis virus DNA polymerase.
J. Biol. Chem.
251:982-986[Abstract/Free Full Text].
|
| 3.
|
Braylan, R. C.,
B. J. Fowlkes,
E. S. Jaffe,
S. K. Sanders,
C. W. Berard, and C. J. Herman.
1978.
Cell volumes and DNA distributions of normal and neoplastic human lymphoid cells.
Cancer
41:201-209[CrossRef][Medline].
|
| 4.
|
Carroll, S. S,
J. Geib,
D. B. Olsen,
M. Stahlhut,
J. A. Shafer, and L. C. Kuo.
1994.
Sensitivity of HIV-1 reverse transcriptase and its mutants to inhibition by azidothymidine triphosphate.
Biochemistry
33:2113-2120[CrossRef][Medline].
|
| 5.
|
Chapman, E. H.,
A. S. Kurec, and F. R. Davey.
1981.
Cell volumes of normal and malignant mononuclear cells.
J. Clin. Pathol.
34:1083-1090[Abstract/Free Full Text].
|
| 6.
|
Coakley, E. P.,
J. M. Gillis, and S. M. Hammer.
2000.
Phenotypic and genotypic resistance patterns of HIV-1 isolates derived from individuals treated with didanosine and stavudine.
AIDS
14:F9-F15[CrossRef][Medline].
|
| 7.
|
D'Aquila, R. T., and W. C. Summers.
1989.
HIV-1 reverse transcriptase/ribonuclease H: high-level expression in Escherichia coli from a plasmid constructed using the polymerase chain reaction.
J. Acquir. Immune Defic. Syndr.
2:579-587.
|
| 8.
|
de Mendoza, C.,
V. Soriano,
C. Briones,
O. Gallego,
P. Barreiro,
A. Alvarez, and J. Gonzalez-Lahoz.
2000.
Emergence of zidovudine resistance in HIV-infected patients receiving stavudine.
J. Acquir. Immune Defic. Syndr.
23:279-281.
|
| 9.
|
Deminie, C. A.,
C. M. Bechtold,
K. Riccardi,
R. E. Rose,
H. Samanta,
P.-F. Lin, and R. J. Colonno.
1998.
Clinical HIV-1 isolates remain sensitive to stavudine following prolonged therapy.
AIDS
12:110-112[Medline].
|
| 10.
|
Gao, W.-Y.,
R. Agbaria,
J. S. Driscoll, and H. Mitsuya.
1994.
Divergent anti-human immunodeficiency virus activity and anabolic phosphorylation of 2',3'-dideoxynucleoside analogs in resting and activated human cells.
J. Biol. Chem.
269:12633-12638[Abstract/Free Full Text].
|
| 11.
|
Gao, W.-Y.,
A. Cara,
R. C. Gallo, and F. Lori.
1993.
Low levels of deoxynucleotides in peripheral blood lymphocytes: a strategy to inhibit human immunodeficiency virus type 1 replication.
Proc. Natl. Acad. Sci. USA
90:8925-8928[Abstract/Free Full Text].
|
| 12.
|
Hertogs, K.,
M.-P. de Bethune,
V. Miller,
T. Ivens,
P. Schel,
A. Van Cauwenberge,
C. Van Den Eynde,
V. Van Gerwen,
H. Azijn,
M. Van Houtte,
F. Peeters,
S. Staszewski,
M. Conant,
S. Bloor,
S. Kemp,
B. Larder, and R. Pauwels.
1998.
A rapid method for simultaneous detection of phenotypic resistance to inhibitors of protease and reverse transcriptase in recombinant human immunodeficiency virus type 1 isolates from patients treated with antiretroviral drugs.
Antimicrob. Agents Chemother.
42:269-276[Abstract/Free Full Text].
|
| 13.
|
Hsieh, J.-C.,
S. Zinnen, and P. Modrich.
1993.
Kinetic mechanism of the DNA-dependent DNA polymerase activity of human immunodeficiency virus reverse transcriptase.
J. Biol. Chem.
268:24607-24613[Abstract/Free Full Text].
|
| 14.
|
Huang, H.,
R. Chopra,
G. L. Verdine, and S. C. Harrison.
1998.
Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance.
Science
282:1669-1675[Abstract/Free Full Text].
|
| 15.
|
Izopet, J.,
A. Bicart-See,
C. Pasquier,
K. Sandres,
E. Bonnet,
B. Marchou,
J. Puel, and P. Massip.
1999.
Mutations conferring resistance to zidovudine diminish the antiviral effect of stavudine plus didanosine.
J. Med. Virol.
59:507-511[CrossRef][Medline].
|
| 16.
|
Japour, A. J.,
D. L. Mayers,
V. A. Johnson,
D. R. Kuritzkes,
L. A. Beckett,
J.-M. Arduino,
J. Lane,
R. J. Black,
P. S. Reichelderfer,
R. T. D'Aquila, and C. S. Crumpacker.
1993.
Standardized peripheral blood mononuclear cell culture assay for determination of drug susceptibilities of clinical human immunodeficiency virus type 1 isolates.
Antimicrob. Agents Chemother.
37:1095-1101[Abstract/Free Full Text].
|
| 17.
|
Katlama, C.,
M.-A. Valantin,
S. Matheron,
A. Coutellier,
V. Calvez,
D. Descamps,
C. Longuet,
M. Bonmarchand,
R. Tubiana,
M. De Sa,
R. Lancar,
H. Agut,
F. Brun-Vezinet, and D. Costagliola.
1998.
Efficacy and tolerability of stavudine plus lamivudine in treatment-naive and treatment-experienced patients with HIV-1 infection.
Ann. Intern. Med.
129:525-531[Abstract/Free Full Text].
|
| 18.
|
Kellam, P., and B. A. Larder.
1994.
Recombinant virus assay: a rapid, phenotypic assay for assessment of drug susceptibility of human immunodeficiency virus type 1 isolates.
Antimicrob. Agents Chemother.
38:23-30[Abstract/Free Full Text].
|
| 19.
|
Lacey, S. F., and B. A. Larder.
1994.
Novel mutation (V75T) in human immunodeficiency virus type 1 reverse transcriptase confers resistance to 2',3'-didehydro-2',3'-dideoxythymidine in cell culture.
Antimicrob. Agents Chemother.
38:1428-1432[Abstract/Free Full Text].
|
| 20.
|
Larder, B. A.,
B. Chesebro, and D. D. Richman.
1990.
Susceptibilities of zidovudine-susceptible and -resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay.
Antimicrob. Agents Chemother.
34:436-441[Abstract/Free Full Text].
|
| 21.
|
Lin, P.-F.,
C. J. Gonzalez,
B. Griffith,
G. Friedland,
V. Calvez,
F. Ferchal,
R. F. Schinazi,
D. H. Shepp,
A. B. Ashraf,
M. Wainberg,
V. Soriano,
J. W. Mellors, and R. J. Colonno.
1999.
Stavudine resistance: an update on susceptibility following prolonged therapy.
Antiviral Ther.
4:21-28[Medline].
|
| 22.
|
Lin, P.-F.,
H. Samanta,
R. E. Rose,
A. K. Patick,
J. Trimble,
C. M. Bechtold,
D. R. Revie,
N. C. Khan,
M. E. Federici,
H. Li,
A. Lee,
R. E. Anderson, and R. J. Colonno.
1994.
Genotypic and phenotypic analysis of human immunodeficiency virus type 1 isolates from patients on prolonged stavudine therapy.
J. Infect Dis.
170:1157-1164[Medline].
|
| 23.
|
Meyer, P. R.,
S. E. Matsuura,
A. M. Mian,
A. G. So, and W. A. Scott.
1999.
A mechanism of AZT resistance: an increase in nucleotide-dependent primer unblocking by mutant HIV-1 reverse transcriptase.
Mol. Cell
4:35-43[CrossRef][Medline].
|
| 24.
|
Meyer, P. R.,
S. E. Matsuura,
A. G. So, and W. A. Scott.
1998.
Unblocking of chain-terminated primer by HIV-1 reverse transcriptase through a nucleotide-dependent mechanism.
Proc. Natl. Acad. Sci. USA
95:13471-13476[Abstract/Free Full Text].
|
| 25.
|
Montaner, J. S. G.,
T. Mo,
J. M. Raboud,
S. Rae,
C. S. Alexander,
C. Zala,
D. Rouleau, and P. R. Harrigan.
2000.
Human immunodeficiency virus-infected persons with mutations conferring resistance to zidovudine show reduced virologic responses to hydroxyurea and stavudine-lamivudine.
J. Infect. Dis.
181:729-732[CrossRef][Medline].
|
| 26.
|
Parkin, N. T.,
Y. S. Lie,
N. Hellmann,
M. Markowitz,
S. Bonhoeffer,
D. D. Ho, and C. J. Petropoulos.
1999.
Phenotypic changes in drug susceptibility associated with the failure of human immunodeficiency virus type 1 (HIV-1) triple combination therapy.
J. Infect. Dis.
180:865-870[CrossRef][Medline].
|
| 27.
|
Pellegrin, I.,
J. Izopet,
J. Reynes,
M. Denayrolles,
B. Montes,
J.-L. Pellegrin,
P. Massip,
J. Puel,
H. Fleury, and M. Segondy.
1999.
Emergence of zidovudine and multidrug-resistance mutations in the HIV-1 reverse transcriptase gene in therapy-naive patients receiving stavudine plus didanosine combination therapy.
AIDS
13:1705-1709[CrossRef][Medline].
|
| 28.
|
Petropoulos, C. J.,
N. T. Parkin,
K. L. Limoli,
Y. S. Lie,
T. Wrin,
W. Huang,
H. Tian,
D. Smith,
G. A. Winslow,
D. J. Capon, and J. M. Whitcomb.
2000.
A novel phenotypic drug susceptibility assay for human immunodeficiency virus type 1.
Antimicrob. Agents Chemother.
44:920-928[Abstract/Free Full Text].
|
| 29.
|
Reardon, J. E.
1993.
Human immunodeficiency virus reverse transcriptase. A kinetic analysis of RNA-dependent and DNA-dependent DNA polymerization.
J. Biol. Chem.
268:8743-8751[Abstract/Free Full Text].
|
| 30.
|
Roberts, J. D.,
K. Bebenek, and T. A. Kunkel.
1988.
The accuracy of reverse transcriptase from HIV-1.
Science
242:1171-1173[Abstract/Free Full Text].
|
| 31.
|
Roy, B.,
C. Beuneu,
P. Roux,
H. Buc,
G. Lemaire, and M. Lepoivre.
1999.
Simultaneous determination of pyrimidine or purine deoxyribonucleoside triphosphates using a polymerase assay.
Anal. Biochem.
269:403-409[CrossRef][Medline].
|
| 32.
|
Schinazi, R. F.,
B. A. Larder, and J. W. Mellors.
2000.
Mutations in retroviral genes associated with drug resistance: 2000-2001 update.
Int. Antiviral News
8:65-91.
|
| 33.
|
Segel, G. B.,
G. R. Cokelet, and M. A. Lichtman.
1981.
The measurement of lymphocyte volume: importance of reference particle deformability and counting solution tonicity.
Blood
57:894-899[Abstract/Free Full Text].
|
| 34.
|
Shirasaka, T.,
S. Chokekijchai,
A. Yamada,
G. Gosselin,
J.-L. Imbach, and H. Mitsuya.
1995.
Comparative analysis of anti-human immunodeficiency virus type 1 activities of dideoxynucleoside analogs in resting and activated peripheral blood mononuclear cells.
Antimicrob. Agents Chemother.
39:2555-2559[Abstract].
|
| 35.
|
Soriano, V.,
U. Dietrich,
N. Villalba,
A. Immelmann,
A. Gil-Aguado,
S. Echevarria,
B. Clotet,
I. Ocana,
J. M. Santamaria,
E. Bouza,
V. Barona,
J. M. Gatell, and J. Gonzalez-Lahoz.
1997.
Lack of emergence of genotypic resistance to stavudine after 2 years of monotherapy.
AIDS
11:696-697[Medline].
|
| 36.
|
Steen, H. B., and V. Nielsen.
1979.
Lymphocyte blastogenesis studied by volume spectroscopy.
Scand. J. Immunol.
10:135-143[CrossRef][Medline].
|
| 37.
|
Terai, C., and D. A. Carson.
1991.
Pyrimidine nucleotide and nucleic acid synthesis in human monocytes and macrophages.
Exp. Cell Res.
193:375-381[CrossRef][Medline].
|
| 38.
|
Tong, W.,
C.-D. Lu,
S. K. Sharma,
S. Matsuura,
A. G. So, and W. A. Scott.
1997.
Nucleotide-induced stable complex formation by HIV-1 reverse transcriptase.
Biochemistry
36:5749-5757[CrossRef][Medline].
|
| 39.
|
Vaccaro, J. A.,
K. M. Parnell,
S. A. Terezakis, and K. S. Anderson.
2000.
Mechanism of inhibition of the human immunodeficiency virus type 1 reverse transcriptase by d4TTP: an equivalent incorporation efficiency relative to the natural substrate dTTP.
Antimicrob. Agents Chemother.
44:217-221[Abstract/Free Full Text].
|
Antimicrobial Agents and Chemotherapy, December 2000, p. 3465-3472, Vol. 44, No. 12
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Matamoros, T., Nevot, M., Martinez, M. A., Menendez-Arias, L.
(2009). Thymidine Analogue Resistance Suppression by V75I of HIV-1 Reverse Transcriptase: EFFECTS OF SUBSTITUTING VALINE 75 ON STAVUDINE EXCISION AND DISCRIMINATION. J. Biol. Chem.
284: 32792-32802
[Abstract]
[Full Text]
-
Ehteshami, M., Beilhartz, G. L., Scarth, B. J., Tchesnokov, E. P., McCormick, S., Wynhoven, B., Harrigan, P. R., Gotte, M.
(2008). Connection Domain Mutations N348I and A360V in HIV-1 Reverse Transcriptase Enhance Resistance to 3'-Azido-3'-deoxythymidine through Both RNase H-dependent and -independent Mechanisms. J. Biol. Chem.
283: 22222-22232
[Abstract]
[Full Text]
-
Delviks-Frankenberry, K. A., Nikolenko, G. N., Boyer, P. L., Hughes, S. H., Coffin, J. M., Jere, A., Pathak, V. K.
(2008). HIV-1 reverse transcriptase connection subdomain mutations reduce template RNA degradation and enhance AZT excision. Proc. Natl. Acad. Sci. USA
105: 10943-10948
[Abstract]
[Full Text]
-
Hartl, M. J., Kretzschmar, B., Frohn, A., Nowrouzi, A., Rethwilm, A., Wohrl, B. M.
(2008). AZT resistance of simian foamy virus reverse transcriptase is based on the excision of AZTMP in the presence of ATP. Nucleic Acids Res
36: 1009-1016
[Abstract]
[Full Text]
-
Basavapathruni, A., Anderson, K. S.
(2007). Reverse transcription of the HIV-1 pandemic. FASEB J.
21: 3795-3808
[Abstract]
[Full Text]
-
Deval, J., Powdrill, M. H., D'Abramo, C. M., Cellai, L., Gotte, M.
(2007). Pyrophosphorolytic Excision of Nonobligate Chain Terminators by Hepatitis C Virus NS5B Polymerase. Antimicrob. Agents Chemother.
51: 2920-2928
[Abstract]
[Full Text]
-
Lennerstrand, J., Chu, C. K., Schinazi, R. F.
(2007). Biochemical Studies on the Mechanism of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Resistance to 1-({beta}-D-Dioxolane)Thymine Triphosphate. Antimicrob. Agents Chemother.
51: 2078-2084
[Abstract]
[Full Text]
-
Perez-Bercoff, D., Wurtzer, S., Compain, S., Benech, H., Clavel, F.
(2007). Human Immunodeficiency Virus Type 1: Resistance to Nucleoside Analogues and Replicative Capacity in Primary Human Macrophages. J. Virol.
81: 4540-4550
[Abstract]
[Full Text]
-
Purohit, V., Roques, B. P., Kim, B., Bambara, R. A.
(2007). Mechanisms That Prevent Template Inactivation by HIV-1 Reverse Transcriptase RNase H Cleavages. J. Biol. Chem.
282: 12598-12609
[Abstract]
[Full Text]
-
Svicher, V., Sing, T., Santoro, M. M., Forbici, F., Rodriguez-Barrios, F., Bertoli, A., Beerenwinkel, N., Bellocchi, M. C., Gago, F., d'Arminio Monforte, A., Antinori, A., Lengauer, T., Ceccherini-Silberstein, F., Perno, C. F.
(2006). Involvement of Novel Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutations in the Regulation of Resistance to Nucleoside Inhibitors. J. Virol.
80: 7186-7198
[Abstract]
[Full Text]
-
Wurtzer, S., Compain, S., Benech, H., Hance, A. J., Clavel, F.
(2005). Effect of Cell Cycle Arrest on the Activity of Nucleoside Analogues against Human Immunodeficiency Virus Type 1. J. Virol.
79: 14815-14821
[Abstract]
[Full Text]
-
Sluis-Cremer, N., Arion, D., Parikh, U., Koontz, D., Schinazi, R. F., Mellors, J. W., Parniak, M. A.
(2005). The 3'-Azido Group Is Not the Primary Determinant of 3'-Azido-3'-deoxythymidine (AZT) Responsible for the Excision Phenotype of AZT-resistant HIV-1. J. Biol. Chem.
280: 29047-29052
[Abstract]
[Full Text]
-
Smith, A. J., Meyer, P. R., Asthana, D., Ashman, M. R., Scott, W. A.
(2005). Intracellular Substrates for the Primer-Unblocking Reaction by Human Immunodeficiency Virus Type 1 Reverse Transcriptase: Detection and Quantitation in Extracts from Quiescent- and Activated-Lymphocyte Subpopulations. Antimicrob. Agents Chemother.
49: 1761-1769
[Abstract]
[Full Text]
-
Meyer, P. R., Smith, A. J., Matsuura, S. E., Scott, W. A.
(2004). Effects of Primer-Template Sequence on ATP-dependent Removal of Chain-terminating Nucleotide Analogues by HIV-1 Reverse Transcriptase. J. Biol. Chem.
279: 45389-45398
[Abstract]
[Full Text]
-
Matamoros, T., Franco, S., Vazquez-Alvarez, B. M., Mas, A., Martinez, M. A., Menendez-Arias, L.
(2004). Molecular Determinants of Multi-nucleoside Analogue Resistance in HIV-1 Reverse Transcriptases Containing a Dipeptide Insertion in the Fingers Subdomain: EFFECT OF MUTATIONS D67N AND T215Y ON REMOVAL OF THYMIDINE NUCLEOTIDE ANALOGUES FROM BLOCKED DNA PRIMERS. J. Biol. Chem.
279: 24569-24577
[Abstract]
[Full Text]
-
White, K. L., Chen, J. M., Margot, N. A., Wrin, T., Petropoulos, C. J., Naeger, L. K., Swaminathan, S., Miller, M. D.
(2004). Molecular Mechanisms of Tenofovir Resistance Conferred by Human Immunodeficiency Virus Type 1 Reverse Transcriptase Containing a Diserine Insertion after Residue 69 and Multiple Thymidine Analog-Associated Mutations. Antimicrob. Agents Chemother.
48: 992-1003
[Abstract]
[Full Text]
-
Odriozola, L., Cruchaga, C., Andreola, M., Dolle, V., Nguyen, C. H., Tarrago-Litvak, L., Perez-Mediavilla, A., Martinez-Irujo, J. J.
(2003). Non-nucleoside Inhibitors of HIV-1 Reverse Transcriptase Inhibit Phosphorolysis and Resensitize the 3'-Azido-3'-deoxythymidine (AZT)-resistant Polymerase to AZT-5'-triphosphate. J. Biol. Chem.
278: 42710-42716
[Abstract]
[Full Text]
-
Meyer, P. R., Matsuura, S. E., Zonarich, D., Chopra, R. R., Pendarvis, E., Bazmi, H. Z., Mellors, J. W., Scott, W. A.
(2003). Relationship between 3'-Azido-3'-Deoxythymidine Resistance and Primer Unblocking Activity in Foscarnet-Resistant Mutants of Human Immunodeficiency Virus Type 1 Reverse Transcriptase. J. Virol.
77: 6127-6137
[Abstract]
[Full Text]
-
Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Reid, P., Nidtha, S., Weinstock, H., Kaplan, J. E., Heneine, W.
(2003). A Novel Genetic Pathway of Human Immunodeficiency Virus Type 1 Resistance to Stavudine Mediated by the K65R Mutation. J. Virol.
77: 5685-5693
[Abstract]
[Full Text]
-
Meyer, P. R., Lennerstrand, J., Matsuura, S. E., Larder, B. A., Scott, W. A.
(2003). Effects of Dipeptide Insertions between Codons 69 and 70 of Human Immunodeficiency Virus Type 1 Reverse Transcriptase on Primer Unblocking, Deoxynucleoside Triphosphate Inhibition, and DNA Chain Elongation. J. Virol.
77: 3871-3877
[Abstract]
[Full Text]
-
McColl, D. J., Miller, M. D.
(2003). The use of tenofovir disoproxil fumarate for the treatment of nucleoside-resistant HIV-1. J Antimicrob Chemother
51: 219-223
[Full Text]
-
Ray, A. S., Basavapathruni, A., Anderson, K. S.
(2002). Mechanistic Studies to Understand the Progressive Development of Resistance in Human Immunodeficiency Virus Type 1 Reverse Transcriptase to Abacavir. J. Biol. Chem.
277: 40479-40490
[Abstract]
[Full Text]
-
Boyer, P. L., Sarafianos, S. G., Arnold, E., Hughes, S. H.
(2002). Nucleoside Analog Resistance Caused by Insertions in the Fingers of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Involves ATP-Mediated Excision. J. Virol.
76: 9143-9151
[Abstract]
[Full Text]
-
Naeger, L. K., Margot, N. A., Miller, M. D.
(2002). ATP-Dependent Removal of Nucleoside Reverse Transcriptase Inhibitors by Human Immunodeficiency Virus Type 1 Reverse Transcriptase. Antimicrob. Agents Chemother.
46: 2179-2184
[Abstract]
[Full Text]
-
Rigourd, M., Ehresmann, C., Parniak, M. A., Ehresmann, B., Marquet, R.
(2002). Primer Unblocking and Rescue of DNA Synthesis by Azidothymidine (AZT)-resistant HIV-1 Reverse Transcriptase. COMPARISON BETWEEN INITIATION AND ELONGATION OF REVERSE TRANSCRIPTION AND BETWEEN (-) AND (+) STRAND DNA SYNTHESIS. J. Biol. Chem.
277: 18611-18618
[Abstract]
[Full Text]
-
Meyer, P. R., Matsuura, S. E., Tolun, A. A., Pfeifer, I., So, A. G., Mellors, J. W., Scott, W. A.
(2002). Effects of Specific Zidovudine Resistance Mutations and Substrate Structure on Nucleotide-Dependent Primer Unblocking by Human Immunodeficiency Virus Type 1 Reverse Transcriptase. Antimicrob. Agents Chemother.
46: 1540-1545
[Abstract]
[Full Text]
-
Shafer, R. W.
(2002). Genotypic Testing for Human Immunodeficiency Virus Type 1 Drug Resistance. Clin. Microbiol. Rev.
15: 247-277
[Abstract]
[Full Text]
-
Boyer, P. L., Sarafianos, S. G., Arnold, E., Hughes, S. H.
(2002). The M184V Mutation Reduces the Selective Excision of Zidovudine 5'-Monophosphate (AZTMP) by the Reverse Transcriptase of Human Immunodeficiency Virus Type 1. J. Virol.
76: 3248-3256
[Abstract]
[Full Text]
-
Selmi, B., Boretto, J., Sarfati, S. R., Guerreiro, C., Canard, B.
(2001). Mechanism-based Suppression of Dideoxynucleotide Resistance by K65R Human Immunodeficiency Virus Reverse Transcriptase Using an alpha -Boranophosphate Nucleoside Analogue. J. Biol. Chem.
276: 48466-48472
[Abstract]
[Full Text]
-
Lennerstrand, J., Stammers, D. K., Larder, B. A.
(2001). Biochemical Mechanism of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Resistance to Stavudine. Antimicrob. Agents Chemother.
45: 2144-2146
[Abstract]
[Full Text]
-
Isel, C., Ehresmann, C., Walter, P., Ehresmann, B., Marquet, R.
(2001). The Emergence of Different Resistance Mechanisms toward Nucleoside Inhibitors Is Explained by the Properties of the Wild Type HIV-1 Reverse Transcriptase. J. Biol. Chem.
276: 48725-48732
[Abstract]
[Full Text]