INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Helicobacter pylori is an important human pathogen that is estimated to infect 50% of the world's population (7, 31). H. pylori infection in humans is associated with the development of numerous gastric pathologies, including gastritis, gastric ulcers, and gastric cancers. Once H. pylori is established in the gastric submucosa, infected individuals usually carry it for life unless treated.

Although many H. pylori strains are quite susceptible to most antibiotics in vitro, treatment of H. pylori-infected individuals has proven difficult (7, 31). Single-antibiotic therapy has not been very effective, and successful treatment usually requires two or three antibiotics given in combination with a proton pump inhibitor (31). Several hypotheses have been proposed in the literature to explain this seemingly elevated in vivo antibiotic resistance, including acid inactivation of the drug, inappropriate formulation, variable compliance, and inability of the drug to accumulate in the gastric mucosa. However, such speculation on the basis for in vivo resistance is premature, since there have been no fundamental studies of antibiotic uptake and efflux mechanisms in H. pylori and the basis for the normal high susceptibility of this bacterium to antibiotics is not known.

There are three basic uptake systems across the outer membrane (10), namely, the uptake of hydrophilic substances through the water-filled channels of porins, uptake of polycations via self-promoted uptake at divalent cation binding sites on lipopolysaccharide, and uptake of hydrophobic substances through the outer membrane bilayer. We previously demonstrated that Helicobacter contains at least five porins (part of a 32-member family of outer membrane proteins) (6, 8). These porins are expressed relatively weakly compared to those of other bacteria, although the main candidate nonspecific porin of H. pylori, HopE, formed large channels (6). Here we have examined the other uptake pathways.

Intrinsic antibiotic resistance in gram-negative bacteria involves the collaboration of restricted outer membrane permeability with secondary defense mechanisms, such as periplasmic -lactamase or antibiotic efflux (23). In Pseudomonas aeruginosa, for example, intrinsic resistance can be overcome by increasing the outer membrane permeability (e.g., by expressing in the outer membrane a large-channel porin [11] or by utilizing a permeabilizing agent, such as a chelator or polycation [28]) and also by mutating the MexA-MexB-OprM efflux system (17) or, for specific -lactams, by mutationally preventing chromosomal -lactamase induction (5). The genomes of two strains of H. pylori have been sequenced (1, 30), and there are no -lactamase homolog genes in either strain.

There are at least four conserved families of efflux systems associated with bacterial resistance to antibiotics (25). One of these families, which is widespread among gram-negative bacteria, is the resistance-nodulation-division (RND) family of efflux systems (22, 26). The RND family efflux systems are dependent on the proton motive force. Such systems, including the AcrAB-TolC system in Escherichia coli (19), the AcrAB system in Haemophilus influenzae (27), the MexAB-OprM system in P. aeruginosa (17), and the MtrCDE system in Neisseria gonorrhoeae (9), are responsible for the intrinsic resistance to a wide variety of structurally and chemically unrelated antibiotics and other antimicrobial compounds (22, 25, 26). In each of these cases, inactivation of the RND systems by mutation renders the bacteria hypersusceptible to a wide variety of antimicrobials (22, 25, 26), whereas upregulation of these systems leads to multiple antibiotic resistance (14, 17).

We previously reported the presence of three gene fragments encoding components of putative RND efflux systems in H. pylori 11637 (4). In this study, we have examined the determinants of the intrinsic susceptibility of H. pylori to antibiotics and whether efflux mediated by any of the three putative efflux systems is a determinant.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacteria, plasmids, and culture conditions. H. pylori strains were grown as previously described (8). H. pylori 26695 was provided by K. Eaton (Ohio State University, Columbus); H. pylori 11637, SS1 (16), J99, ArHp64, ArHp12, ArHp18, ArHp25, ArHp210, and UA861 (13) were obtained from the culture collection of Astra Research Center Boston (Cambridge, Mass.). These strains represent isolates from Australia (SS1 and ArHp25), Sweden (ArHp210), Argentina (ArHp64), the United States (J99 and ArHp12), and Canada (ArHp18 and UA861). An H. pylori 11637 genomic library constructed in the cosmid pLAFR3 (29) and maintained in E. coli HB101 was used for the cloning of the H. pylori hefABC RND operon. P. aeruginosa H103 and K372 and its oprM:: mutant K613 were previously described (16). The vector pBluescript was from Stratagene (La Jolla, Calif.). E. coli DH5 was used for subcloning the hefABC operon. E. coli W4680 and its acrAB::Tn903 Kan^r mutant WZM120 (18) were kindly provided by Keith Poole (Queens University, Ontario, Canada). E. coli and P. aeruginosa strains were grown in Luria broth. For cloning in E. coli, ampicillin was used at 100 µg/ml and tetracycline was used at 18 µg/ml.

Reagents. Chemical reagents were purchased from Sigma Chemical (St. Louis, Mo.). Restriction enzymes, polymerases, and other molecular biology reagents were purchased from Gibco BRL (Burlington, Ontario) and used as described in the manufacturer's instructions. [³H]chloramphenicol (1 mCi/ml; 30 to 60 Ci/mmol) and [³H]tetracycline (1 mCi/ml; 0.77 Ci/mmol) were purchased from Du Pont, NEN (Boston, Mass.).

MIC determination. The MICs in Table 1 were determined by the broth microdilution method (3). Disk diffusion assays to assess the knockout mutants were done as follows. A sterile cotton-tipped swab was dipped into the H. pylori suspension (diluted to twice the McFarland standard) and streaked in three directions across a tryptic soy agar (BBL; Becton Dickinson and Company, Cockeysville, Md.) supplemented with 5% sheep blood (Remel, Lenexa, Kans.). The plates were dried for 5 min, and then disks containing the antibiotics (Remel) were placed on the agar surface. The plates were incubated for 3 days in a microaerophilic atmosphere (5% O₂, 10% CO₂, and 85% N₂); (Cellstar Trigas incubator; Queue Systems, Asheville, N.C.) at 37°C. At the end of the incubation period, the diameters of the zones of growth inhibition were measured.

Cloning and DNA sequencing of the hefABC operon. Molecular biology protocols were performed according to standard methods (20). The DNA sequence of the hefABC operon of H. pylori 11637 was generated by shotgun sequencing of random subclones of cosmid clone 200:4, which contained the hefABC putative efflux system (4). Briefly, p200:4 was partially restricted with Sau3A1 restriction enzyme, and the resulting DNA was size fractionated on an agarose gel. Restriction fragments approximately 1 to 3 kb long were purified and ligated into BamHI-digested pBluescript. The resultant recombinant clones were screened in hybridization experiments with the DNA insert from the H. pylori alkaline phosphatase clone 200 (4) as a probe. The clones that reacted positively with the probe were sequenced with the universal reverse and forward primers. The remaining DNA sequence gaps were filled in by primer walking with p200:4 as a template. Sequence assembly was facilitated by the use of the Contig Alignment Program (12). The resulting DNA sequences covered the hefABC operon at least twice on each DNA strand. All DNA sequencing was done on an ABI 373 automated DNA sequencer with the ABI Prism dye terminator sequencing kit.

Presence of putative efflux operons in other H. pylori strains. The linkage of the hefABC, hefDEF, and hefGHI genes was examined in H. pylori SS1, ArHp25, ArHp210, ArHp64, ArHp12, ArHp18, and UA861 by using PCR primers specific for each gene in the particular cluster with a "reverse" primer specific for the gene encoding the RND pump protein (hefC, hefF, or hefI) in the respective cluster. The primers used were hefA, 5'CTTCAAAGGCTAGTTTGGATGCGGC; hefB, 5'CAGCGATACAGCAAAATTGGGGGCGC; hefC, 5'TTACTACGACTTATCCTGGGGCTAGCGCTG; hefD, 5'GACACGATGCTAGCGATTGTGGAGCC; hefE, 5'GGCGAGCAGGTGAAGGCTGGAGATGC; hefF, Hel1 (see below); hefG, 5'GGCGATTACAACGCTTATTACAACGC; hefH, 5'ATGGCTATGTGGAAAAGCTTTATGC; and hefI, 5'GAAATTGTGGTTAAAAAAGAAGGGGC. The reverse RND pump gene-specific primers were hefC, 5'CCCCATCAATTTCCACATTCTCCGC; hefF, Hel2 (see below), and hefI, 5'GCAAAAAATATCGCGCCCCCCACATGC. PCRs were performed in a Perkin-Elmer 9600 PCR machine. The reactions consisted of 35 cycles, with each cycle composed of 15 s at 94°C (denaturation), 30 s at 50°C (annealing), and 150 s at 72°C (extension). After a final extension of 10 min at 72°C, the amplicons were electrophoresed on a 1.2% agarose gel with 0.04 M Tris-acetate-0.001 M EDTA, pH 8.0 (TAE).

Gene expression analysis of the hef operons by RT PCR. RNA was isolated from H. pylori SS1 that had been grown in vitro (on chocolate blood agar plates) or directly from the stomachs of C57BL/6 mice that were colonized with H. pylori SS1 (in vivo). The RNA was prepared with the S.N.A.P. total RNA isolation kit from Invitrogen (Carlsbad, Calif.). The RNA was analyzed by reverse transcriptase (RT) PCR with the SuperScript RT-PCR kit from Gibco BRL (Gaithersburg, Md.). The gene-specific primers for the efflux pumps used were designed from the sequence alignments of the genes from H. pylori 26695 and J99. For hefF, the Hel1 (5'CTAGCCCTGAAGAAATGGAAAACAACATCG) and Hel2 (5'CCTTGCCATGTCATTAAAATCCG) PCR primers were predicted to amplify a 418-bp amplicon, whereas for hefI, the Hel3 (5'TCAAATCCAGCGTGATGTAGTAGCCG) and Hel4 (5'ATTTATCCCCCAAATCAATGAAGGGG) PCR primers were predicted to produce a 515-bp amplicon. Three independent reactions were used for each analysis. Total nucleic acid (before DNA removal) was used as a positive control template, whereas RNA was used as a template in two identical reactions where the only difference was the addition of the RT enzyme. The reactions were held at 37°C for 30 min prior to 35 cycles of PCR with parameters of 15 s at 94°C, 15 s at 55°C, and 1 min at 72°C. The reaction mixtures were then electrophoresed on a 1% TAE agarose gel.

Uptake of [³H]tetracycline, [³H]chloramphenicol, and 1-N-phenylnapthylamine (NPN) by H. pylori. Two-day cultures of H. pylori 26695, grown on chocolate blood agar plates, were resuspended in phosphate-buffered saline, washed once in 5 mM HEPES buffer (pH 7.2) containing 10 µM MgCl₂, and resuspended at an optical density at 600 nm of 0.5 in 5 mM glucose-5 mM HEPES buffer at either pH 4, pH 7.2, or pH 9; the cell suspension was aliquoted and used immediately in the uptake assays.

DNA and protein sequence analysis. Pairwise sequence alignments were performed with the ALIGN program at the Genestream Search network server (http://genome.eerie.fr/bin/align-guess.cgi), Montpellier, France. Phylogenetic analysis was done with the PHYLIP phylogeny inference package (8a). Phylogenetic trees were constructed with the nearest-neighbor distance matrix. DNA similarity searches were performed with the BLAST algorithm (2).

Mutagenesis of the putative efflux operons. Mutagenesis of hefL was performed as follows. The internal portion (bp 724 to 2152) of the hefI gene (JHP1249) was amplified from H. pylori J99 as a 1.43-kb fragment and cloned into pGEM-T (Gibco BRL). Inverse PCR was then used to inactivate the gene by the insertion of the Km^r cassette from pILL600 (15) and a concomitant deletion between positions 1325 and 1647 of the hefI gene. This suicide plasmid construct was then introduced into H. pylori J99 by natural transformation, and transformants were selected by plating on selective media containing 25 µg of kanamycin/ml. Chromosomal DNA was prepared from several transformants and analyzed by PCR to ensure that the double crossover had occurred in the correct position. Mutagenesis of hefC and hefF were carried out in a similar fashion. Specifically, an internal fragment of the hefC gene (JHP554) was cloned into pGEM-T (bp 134 to 2729), and after inverse PCR, the Km^r cassette was inserted between positions 640 and 2219 of hefC, resulting in a 1,579-bp deletion. An internal portion of the hefF gene (JHP903) was cloned into pGEM-T (bp167 to 1429), and after inverse PCR, the Km^r cassette was inserted between positions 585 and 1019 of hefF, resulting in a 434-bp deletion.

Nucleotide sequence accession number. The DNA sequence of the hefABC operon was submitted to the GenBank database (accession no. AF059041).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Hydrophobic and self-promoted uptake. Consistent with the data from other laboratories (21), H. pylori demonstrated high susceptibility to -lactams, quinolones, and other hydrophilic agents and to chloramphenicol and other hydrophobic agents but relatively low susceptibility to the polycations polymyxin B and cationic antimicrobial peptides (Table 1).

View larger version (15K): [in this window] [in a new window]   FIG. 1.   Uptake of NPN by E. coli (A) and H. pylori (B) in the presence of NPN alone (dashed lines), after the addition of NPN and polymyxin B (solid lines), and after incubation of E. coli with CCCP prior to the addition of NPN and polymyxin B (dotted lines). a. u., arbitrary unit.

H. pylori putative RND efflux operons. We considered whether a lack of efflux was responsible for the high intrinsic antibiotic susceptibility of H. pylori. The H. pylori 26695 genomic sequence was reported to contain only six open reading frames (ORFs) with homology to RND efflux components (ORFs 606, 607, 969, 970, 1328, and 1329) (1, 30), and these pairs of genes correlated to the DNA inserts from H. pylori alkaline phosphatase fusion clones 200, 61, and 12, identified by us as portions of efflux operons (4). We identified three additional linked genes. There were no other RND efflux systems predicted in either strain of H. pylori for which the genomic sequence has been elucidated.

View larger version (11K): [in this window] [in a new window]   FIG. 2.   Phylogenetic tree showing the relationship of the H. pylori RND pump proteins to other RND pump proteins. The three putative H. pylori RND efflux pump proteins (HefC, HefF, and HefI) are divergent from the clusters of RND efflux pump proteins involved in the efflux of divalent cations (CnrA [Ralstonia eutropha], NccA [Alcaligenes denitrificans], HelA [Legionella pneumophila], and CzcA [R. eutropha]) and those pumps involved in multiple-drug efflux (AcrA [E. coli], MexB [P. aeruginosa], MexD [P. aeruginosa], and MtrD [N. gonorrhoeae]).

In vitro and in vivo expression of putative efflux operons. RT-PCR was used to analyze the in vitro and in vivo expression of the H. pylori putative efflux systems. The results of these experiments are shown in Fig. 3. Using PCR primers specific for hefF, a PCR amplicon of the expected size (418 bp) was visible both in vitro and in vivo and was absent in the negative control (Fig. 3A), suggesting that hefF was expressed both in vivo and in vitro. The PCR primers specific for hefI failed to amplify a product in vitro (even when the autoradiograms were overexposed or when larger amounts of template were used) but did produce an amplicon of the expected size (515 bp) in vivo (Fig. 3B, lane 4), and the amplicon was absent in the negative control (Fig. 3B, lane 5). Analysis of hefC revealed that it was also expressed both in vitro and in vivo (data not shown).

View larger version (74K): [in this window] [in a new window]   FIG. 3.   In vitro and in vivo expression of the H. pylori hef operons; RT-PCR of H. pylori grown in vitro (A) and in vivo (B). Lanes 1 to 3 were done with hefF-specific PCR primers, while lanes 4 to 6 were done with the hefI-specific PCR primers. The RT-PCR mixtures in lanes 1 and 4 contained reverse transcriptase, Taq DNA polymerase, and RNA; lanes 2 and 5 are the negative controls and contained Taq DNA polymerase and RNA; lanes 3 and 6 are the positive controls and contained all the nucleic acids (prior to DNase treatment) plus Taq DNA polymerase. Lanes S, size standards.

NPN efflux. The addition of 6.4 µg of polymyxin B/ml to E. coli resulted in the rapid uptake of the hydrophobic fluorescent dye NPN followed by a decrease in fluorescence over time, in the presence of a proton motive force, due to active efflux of NPN by the bacterial cells (Fig. 1A). Dissipation of the proton motive force by preincubation of the cells with the proton translocator CCCP completely abolished the extrusion of NPN by the cells, as previously shown for P. aeruginosa (18). In contrast, in H. pylori, once NPN fluorescence reached its maximum level after polymyxin B treatment, it did not diminish over the time course of these experiments, suggesting that H. pylori did not efflux NPN (Fig. 1B). The lack of any detectable efflux activity may have been caused by the cells becoming deenergized over the course of the experiments. However, examination of the cells by phase-contrast microscopy showed that the cells were actively motile, indicating that the cells maintained a proton motive force throughout the time course of these experiments. To see if the addition of a carbon source could energize active efflux of NPN, the H. pylori cells were preincubated with 18 different potential carbon sources. The experiments were also repeated at pH 4 and pH 9 in an attempt to induce an artificial proton motive force. However, the addition of these carbon sources and the alteration of the assay medium pH were not able to promote the extrusion of NPN by H. pylori, suggesting that NPN was not a substrate for active efflux by in vitro-grown H. pylori.

Accumulation of [³H]tetracycline and [³H]chloramphenicol by H. pylori. Since NPN was not a substrate for active efflux by H. pylori, we examined the accumulation of [³H]tetracycline and [³H]chloramphenicol, which are substrates for active efflux by many RND multiple-drug efflux systems. If these compounds were effluxed by H. pylori, the addition of CCCP would result in increased uptake, as observed in other bacteria (14, 19). Incubation of H. pylori 11637 with either [³H]tetracycline or [³H]chloramphenicol resulted in the accumulation of radiolabel by the cells. Pretreatment of H. pylori with CCCP, however, resulted in a reduction rather than an increase in the accumulation of both [³H]chloramphenicol (Fig. 4) and [³H]tetracycline (not shown) relative to the untreated control. These results are consistent with an influence of the membrane potential on the partitioning of these antibiotics across the cell membrane.

View larger version (15K): [in this window] [in a new window]   FIG. 4.   CCCP inhibition of [3H]chloramphenicol uptake by H. pylori (solid bars) and H. pylori pretreated with 40 µM CCCP (open bars). The cells were incubated separately in the presence of [3H]chloramphenicol. Aliquots were removed at 1, 15, 30, and 45 min following the addition of [3H]chloramphenicol and processed as stated in Materials and Methods. The amount of radioactivity on the filter was determined by scintillation counting. The relative uptake is defined as the percentage of radioactivity (counts per minute) accumulated by the cells divided by the total radioactivity (counts per minute) present. Representative results from one of three experiments are shown.

Mutagenesis of the H. pylori putative RND efflux operons. The three efflux pump proteins were individually mutagenized in the chromosome of H. pylori J99 by marker exchange mutagenesis. The abilities of the resulting mutants to grow or divide in vitro were not affected. When analyzed by disk diffusion, the susceptibilities of the mutants to 19 antibiotics (amoxicillin-clavulanic acid, amikacin, aztreonam, chloramphenicol, ceftazidime, cefaclor, ciprofloxacin, cephalothin, clarithromycin, clindamycin, cefotaxime, cefoxitin, gentamicin, imipenem, kanamycin, nalidixic acid, methicillin, tetracycline, and vancomycin), many of which were known substrates for active efflux systems, were unchanged.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

H. pylori is an enigma, in that it is quite sensitive to most antimicrobial agents in the laboratory, with the exception of polycations, but very difficult to treat in patients. This paper describes data providing reasons for this observation. We demonstrate here that H. pylori apparently lacks an effective RND efflux system for antibiotics. Studies of uptake of tetracycline, chloramphenicol, and NPN (Fig. 1 and 4), as well as metronidazole (21), indicated that these compounds, which are typical substrates for RND efflux systems, are not effluxed by H. pylori in an energy-dependent fashion. While only RND efflux systems are known to have a wide variety of types of antibiotic substrates, other, simpler efflux systems, usually with a single cytoplasmic pump protein, have been reported to influence passage of a specific class of antibiotics. For example, tetracycline and chloramphenicol pumps (22) have been reported to be involved in resistance in some bacteria (although usually in mutational or plasmid-borne rather than intrinsic resistance). However, only three gene products with any homology to this class of major facilitator efflux proteins were observed, namely, HP1165, HP1182, and HP1185 of strain 26695. However, there was no compelling evidence based on either the neighboring genes or the highest number of hits (which tended to be to genes obtained as part of genome-sequencing projects) that these genes were really involved in antibiotic resistance. In any case, these proteins were clearly not involved in the energy-dependent efflux of NPN, tetracycline, or chloramphenicol in vitro (since no such efflux was observed in H. pylori [Fig. 4]). This was also true of HP1082 and HP1206, which showed some homology to mammalian multiple-drug efflux proteins and to other members of the ATP-binding cassette family of uptake and export proteins. Consistent with the above analysis, the MICs for H. pylori of antibiotics like chloramphenicol, tetracycline, and, in part, novobiocin, ciprofloxacin, and erythromycin, were more reminiscent of those for mutants of P. aeruginosa and E. coli lacking the major RND systems involved in intrinsic antibiotic resistance rather than the MICs for wild-type gram-negative bacteria. Of the three putative efflux systems identified in H. pylori, only one, HefABC, showed any homology to the RND efflux systems involved in multidrug resistance in other bacteria, but it was clearly a somewhat distant relative (Fig. 2). It was apparently expressed under laboratory conditions, as was HefDEF (but not HefGHI), a relative of the cation efflux subfamily of the RND efflux systems (26). However, knockouts in any of these three operons failed to influence susceptibility to 19 different antibiotics. While it remains marginally possible that HefABC and HefDEF contribute equally to the efflux of multiple antibiotics, this would be unprecedented in any bacterium studied to date and seems unlikely based on the high susceptibility of H. pylori to most antibiotics and on our tetracycline, NPN, and chloramphenicol transport data, which argue against the existence of any functional efflux operon under laboratory conditions.

In marked contrast, the constitutive expression of specific RND efflux systems is a significant factor in the intrinsic resistance of all gram-negative bacteria studied to date to multiple classes of antibiotics (22, 25, 26). The role of RND multiple-drug efflux systems in intrinsic antibiotic resistance has been demonstrated in several human pathogens, including E. coli (20), H. influenzae (27), N. gonorrhoeae (9), and P. aeruginosa (17).

The expression of RND efflux systems in many bacteria is regulated by environmental stimuli, including the presence of antibiotics and antimicrobial compounds, the growth stage, and stress factors (22, 25, 26). The RT-PCR data presented here suggest the presence of a regulatory mechanism controlling the in vivo expression of the hefGHI operon. The H. pylori hefI-specific mRNA could only be detected in vivo (Fig. 4), suggesting that the entire hefGHI operon was expressed under these conditions. However, detection of hefC and hefF mRNAs (Fig. 4), both in vivo and in vitro, suggested that these operons were expressed constitutively. While our RT-PCR data did not quantitate the levels at which these two operons were expressed, transport and susceptibility data confirmed that in vitro-grown H. pylori did not express any efflux systems at a level that influenced antibiotic susceptibility. Collectively, these results indicate that active efflux does not play a role in the in vitro intrinsic resistance of H. pylori to many antibiotics. However, we cannot rule out the potential role of efflux in the in vivo intrinsic resistance of H. pylori to antibiotics.

The other part of the intrinsic resistance equation is uptake. We previously demonstrated that H. pylori, unlike other gram-negative bacteria, contained no predominant porin species. However, it did contain approximately 2,000 copies of a nonspecific porin, HopE, with a large channel (1.5 nS for the monomer in 1 M KCl; cf. E. coli OmpF, which has a monomer single-channel conductance of 0.57 nS), and we anticipate that most antibiotics would equilibrate reasonably rapidly across the outer membrane of H. pylori (cf. P. aeruginosa, which has only 200 copies or so of large-channel porins with a monomer single-channel conductance of 1.7 nS in 1 M KCl). Thus, given the lack of secondary defense mechanisms (10), such as -lactamase (not present in H. pylori) and efflux (not functional for at least some antibiotics under laboratory conditions), we would anticipate a relatively modest influence of porin-mediated permeation on intrinsic resistance. Similarly, reasonable uptake of hydrophobic substances, like NPN, novobiocin, and chloramphenicol, coupled with nonfunctioning efflux systems, as observed in efflux-defective P. aeruginosa (24) and E. coli (19), would explain the relatively high susceptibility of H. pylori to hydrophobic antibiotics. Conversely, a poorly functioning self-promoted uptake system, as observed here, is consistent with the low sensitivity of H. pylori to the polycationic lipopeptide polymyxin B (Table 1) and the observed resistance to antimicrobial peptides. We presume that this is due to the unique structure of H. pylori lipopolysaccharide, since this molecule is very influential in self-promoted uptake.