Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, February 2000, p. 411-413, Vol. 44, No. 2
Department of Microbiology, Monash
University, Clayton, Victoria 3800, Australia
Received 26 April 1999/Returned for modification 4 May
1999/Accepted 29 October 1999
The ErmB macrolide-lincosamide-streptogramin B (MLS) resistance
determinant from Clostridium difficile 630 contains two
copies of an erm(B) gene, separated by a 1.34-kb direct
repeat also found in an Erm(B) determinant from Clostridium
perfringens. In addition, both erm(B) genes are
flanked by variants of the direct repeat sequence. This genetic
arrangement is novel for an ErmB MLS resistance determinant.
Clostridium difficile is
the causative agent of antibiotic-associated diarrhea and
pseudomembranous colitis, diseases generally associated with exposure
to antibiotics. The antibiotics most commonly involved include
clindamycin, cephalosporins, and ampicillin (2); however,
virtually all antibacterial agents have been implicated.
Erythromycin is a member of the macrolide-lincosamide-streptogramin B
(MLS) group of protein synthesis inhibitors (11, 16). In
many bacterial species (4, 6, 11, 12), MLS resistance is
mediated by erm genes, which encode 23S RNA methylases.
Numerous erm genes have been characterized and divided into
distinct classes based on their sequence similarity (19).
The most widely distributed of these classes of Erm determinants is the
Erm B/AM class, which has recently been renamed as the ErmB class
(19), the erm genes belonging to this class now
being referred to as erm(B) genes (19).
ErmB determinants have been detected in both Clostridium
perfringens (3) and C. difficile (9,
21). The C. perfringens determinant is located on a
large mobilizable plasmid, pIP402, and consists of an erm(B)
gene (previously ermBP) flanked by 1.34-kb direct repeat
(DR) sequences (4) (Fig. 1).
Each DR contains an open reading frame (ORF), ORF298, the putative
product of which has similarity to ParA and Soj proteins, which are
involved in plasmid and chromosomal partitioning (8, 23).
ORF298 is flanked by the highly palindromic repeated sequences of
palA and palB (4).
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Macrolide-Lincosamide-Streptogramin B
Resistance Determinant from Clostridium difficile 630 Contains Two erm(B) Genes
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References

View larger version (28K):
[in a new window]
FIG. 1.
Comparative genetic organization of the Erm(B)
determinants from C. difficile, C. perfringens
(4), Enterococcus faecalis (pAM
1)
(14), Streptococcus agalactiae (pIP501)
(18), E. faecalis (Tn917)
(24), and Escherichia coli (6). The
approximate extent and organization of the determinants are shown
schematically and are not necessarily to scale. Regions of nucleotide
sequence similarity are indicated by the same shading. The solid arrows
indicate the individual ORFs and their respective direction of
transcription. The approximate location of the palindromic sequences
(palA and palB) is indicated by the boldface
lines below the shaded boxes. The palA', palB',
and palI sequences represent the portions of the C. perfringens erm(B)-derived palA and palB
homologues that are present at the ends of the deletion in these
variants of the DR sequence. Functional and nonfunctional leader
peptide sequences are indicated by solid and open triangles
respectively. The promoter deletion upstream of the C. difficile
erm2(B) gene is indicated by the solid oval. The region of pIP501
for which no sequence data are available is indicated by a single
broken line. This comparison varies slightly from the previously
published figure (Fig. 2 in reference 4).
Hybridization analysis of erythromycin-resistant C. difficile strains has also revealed the presence of
erm(B) genes (previously ermZ or
ermBZ) (9, 21). The objective of our studies was to examine the genetic organization of the ErmB determinant from C. difficile 630. This strain (28) was grown at
37°C in an anaerobic glove chamber (Coy Laboratories; 80%
N2, 10% H2, 10% CO2) in BHIS medium (25) supplemented with erythromycin (50 µg/ml) or
rifampin (20 µg/ml). C. perfringens CP592 (5)
was grown anaerobically on nutrient agar (20) containing
erythromycin (50 µg/ml). Recombinant strains were derivatives of
Escherichia coli DH5
(Bethesda Research Laboratories,
Inc.) and were grown in 2YT medium (17) containing erythromycin (150 µg/ml).
Cloning experiments (22) utilized the low-copy-number E. coli plasmid vector pWSK29 (27). Small-scale plasmid DNA isolation was performed by a modified mini alkaline-lysis-polyethylene glycol precipitation procedure (Applied Biosystems). DNA sequencing was carried out with the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit on an Applied Biosystems 373 DNA sequencer. DNA was prepared from both C. difficile and C. perfringens by dye buoyant density gradient ultracentrifugation at 260,000 × g for 20 h at 20°C (1).
To determine the size of the C. difficile 630 fragment carrying the erm(B) gene, chromosomal DNA samples (10 µg) were digested with Sau3A or HindIII and separated by electrophoresis on 0.8% agarose. Southern blots (26) were probed at high stringency with a 688-bp erm(B)-specific digoxigenin-labelled probe prepared by PCR with the primers 2980 (5'AATAAGTAAACAGGTAACGTT 3') and 2981 (5'GCTCCTTGGAAGCTGTCAGTAG 3'). A single hybridizing 9.7-kb HindIII band was observed (Fig. 2) after washing at high stringency and probe detection with CDP-Star (Boehringer-Mannheim). However, after Sau3A digestion, two hybridizing bands of 2.0 and 2.3 kb were evident (Fig. 2). In contrast, with DNA from C. perfringens CP592, only single hybridizing bands were detected with each enzyme (Fig. 2). The presence of two hybridizing Sau3A bands in strain 630 DNA suggested that either there were two erm(B) genes separated by less than 9.7 kb, or there was a single erm(B) gene which contained an internal Sau3A site that was not present in the erm(B) gene from C. perfringens.
|
The 9.7-kb HindIII fragment from strain 630 was cloned into pWSK29, and the erm(B) gene region of the recombinant plasmid, pJIR1594, was completely sequenced on both strands across all restriction sites. Sequence analysis revealed that this ErmB determinant had a novel genetic organization. Two identical copies of the erm(B) gene were present, which we have designated as erm1(B) and erm2(B) (Fig. 1). The genes had 99% sequence identity to the erm(B) gene from C. perfringens and greater than 97% sequence identity to all other erm(B) genes. In addition, the two genes were separated by a single complete copy of the DR sequence that is found on either side of the C. perfringens erm(B) gene and in association with most of the other erm(B) genes (Fig. 1).
Upstream of erm2(B) was an apparent deletion that removed the erm(B) promoter. It is therefore unlikely that the erm2(B) gene is expressed; however, expression from an upstream promoter such as the erm1(B), ORF3, or ORF298 promoters cannot be ignored.
Upstream of erm1(B) was a potential erm leader peptide sequence, a potential promoter, and 75 bp of the DR sequence (Fig. 1). Leader peptide sequences are commonly found upstream of inducible erm genes (7). The leader peptide gene region contains a number of inverted repeats and leads to the regulation of erm expression by translational attenuation (15). Based on the similarity of the upstream region of other erm genes to the leader peptide sequence upstream of erm(C), several other erm genes, including some erm(B) genes, have been proposed to be regulated by translational attenuation. Examination of constitutive erm genes showed that the leader peptide sequence was either absent or was mutated and nonfunctional (10, 15). Analysis of the leader peptide sequence upstream of erm1(B) indicated that it was similar to nonfunctional leader peptides. Therefore, induction experiments were carried out to determine whether erythromycin resistance was constitutively or inducibly expressed in strain 630. The results showed that when the cells were subcultured from medium that did not contain erythromycin, the same growth rate was observed in the presence or absence of erythromycin (data not shown), suggesting that the erm1(B) leader peptide is not functional in strain 630 and that erythromycin resistance is constitutively expressed.
Downstream of both erm1(B) and erm2(B) was ORF3, which is found in the same position in virtually all ErmB determinants (13) (Fig. 1). Further downstream of erm2(B) was a variant of the DR sequence. This variant contained a deletion that had removed ORF298 and another deletion that appeared to have removed the last 75 bp of the DR sequence. This region was identical to the 75 bp of the DR found upstream of erm1(B), suggesting that other recombination events may also have occurred.
Comparative analysis (Fig. 1) of the various ErmB determinants revealed
that the C. difficile 630 determinant is the only member of
this class which has two erm structural genes. In addition, almost all of the erm(B) genes are flanked by complete or
deleted (
DR) variants of the DR sequence. None of these variants are identical, each deletion apparently having occurred at a slightly different location. Therefore, it is likely that homologous
recombination events involving the palA and palB
sequences are responsible for the deletions, rather than site-specific
recombination events.
The only erm(B) gene that is flanked by two complete copies of the DR sequence is from C. perfringens. We previously postulated that this determinant represents the ErmB progenitor and that the other determinants have arisen through homologous recombination events which remove part of the DR sequences (4). We propose that the evolution of the C. difficile determinant may have involved a duplication of the putative progenitor determinant with subsequent recombination events, which resulted in two erm(B) genes separated by a complete copy of the DR sequence.
Nucleotide sequence accession number. The GenBank accession number of the DNA sequence of the C. difficile ErmB determinant is AF109075.
| |
ACKNOWLEDGMENTS |
|---|
We thank the Australian National Health and Medical Research Council for research support.
K.A.F. was the recipient of an Australian Postgraduate Award.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Monash University, Clayton, Victoria 3800, Australia. Phone: 61-3-9905-4825. Fax: 61-3-9905-4811. E-mail: Julian.Rood{at}med.monash.edu.au.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abraham, L. J., and J. I. Rood.
1985.
Molecular analysis of transferable tetracycline resistance plasmids from Clostridium perfringens.
J. Bacteriol.
161:636-640 |
| 2. | Bartlett, J. G. 1981. Antimicrobial agents implicated in Clostridium difficile toxin associated diarrhea or colitis. Johns Hopkins Med. J. 149:6-9[Medline]. |
| 3. |
Berryman, D. I., and J. I. Rood.
1989.
Cloning and hybridization analysis of ermP, a macrolide-lincosamide-streptogramin B resistance determinant from Clostridium perfringens.
Antimicrob. Agents Chemother.
33:1346-1353 |
| 4. |
Berryman, D. I., and J. I. Rood.
1995.
The closely related ermB-ermAM genes from Clostridium perfringens, Enterococcus faecalis (pAM 1), and Streptococcus agalactiae (pIP501) are flanked by variants of a directly repeated sequence.
Antimicrob. Agents Chemother.
39:1830-1834[Abstract].
|
| 5. | Brefort, G., M. Magot, H. Ionesco, and M. Sebald. 1977. Characterization and transferability of Clostridium perfringens plasmids. Plasmid 1:52-66[CrossRef][Medline]. |
| 6. |
Brisson-Noël, A.,
M. Arthur, and P. Courvalin.
1988.
Evidence for natural gene transfer from gram-positive cocci to Escherichia coli.
J. Bacteriol.
170:1739-1745 |
| 7. | Dubnau, D., and M. Monod. 1986. The regulation and evolution of MLS resistance. Banbury Rep. 24:369-387. |
| 8. |
Easter, C. L.,
H. Schwab, and D. R. Helinski.
1998.
Role of the parCBA operon of the broad-host-range plasmid RK2 in stable plasmid maintenance.
J. Bacteriol.
180:6023-6030 |
| 9. |
Hächler, H.,
B. Berger-Bächi, and F. H. Kayser.
1987.
Genetic characterization of a Clostridium difficile erythromycin-clindamycin resistance determinant that is transferable to Staphylococcus aureus.
Antimicrob. Agents Chemother.
31:1039-1045 |
| 10. |
Kamimiya, S., and B. Weisblum.
1988.
Translational attenuation control of ermSF, an inducible resistance determinant encoding rRNA N-methyltransferase from Streptomyces fradiae.
J. Bacteriol.
170:1800-1811 |
| 11. |
LeClerq, R., and P. Courvalin.
1991.
Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification.
Antimicrob. Agents Chemother.
35:1267-1272 |
| 12. |
LeClerq, R., and P. Courvalin.
1991.
Intrinsic and unusual resistance to macrolide, lincosamide, and streptogramin antibiotics in bacteria.
Antimicrob. Agents Chemother.
35:1273-1276 |
| 13. | Lyras, D., and J. I. Rood. 1997. Transposable genetic elements and antibiotic resistance determinants from Clostridium perfringens and Clostridium difficile, p. 73-92. In J. Rood, B. McClane, J. Songer, and R. Titball (ed.), The clostridia: molecular biology and pathogenesis. Academic Press, San Diego, Calif. |
| 14. | Martin, B., G. Alloing, V. Mejean, and J.-P. Claverys. 1987. Constitutive expression of erythromycin resistance mediated by the ermAM determinant of plasmid pAM-beta-1 results from deletion of 5' leader peptide sequences. Plasmid 18:250-253[CrossRef][Medline]. |
| 15. |
Mayford, M., and B. Weisblum.
1990.
The ermC leader peptide: amino acid alterations leading to differential efficiency of induction by macrolide-lincosamide-streptogramin B antibiotics.
J. Bacteriol.
172:3772-3779 |
| 16. | Menninger, J. R. 1985. Functional consequences of binding macrolides to ribosomes. J. Mol. Biol. 16:23-24[CrossRef]. |
| 17. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 18. |
Pujol, C.,
S. Ehrlich, and L. Janniere.
1994.
The promiscuous plasmids pIP501 and pAM 1 from Gram-positive bacteria encode complementary resolution functions.
Plasmid
31:100-105[CrossRef][Medline].
|
| 19. |
Roberts, M. C.,
J. Sutcliffe,
P. Courvalin,
L. B. Jensen,
J. I. Rood, and H. Seppala.
1999.
Nomenclature for macrolide and macrolide-lincosamide Streptogramin B antibiotic resistance determinants.
Antimicrob. Agents Chemother.
43:2823-2830 |
| 20. | Rood, J. I. 1983. Transferable tetracycline resistance in Clostridium perfringens strains of porcine origin. Can. J. Microbiol. 29:1241-1246[Medline]. |
| 21. |
Rood, J. I., and S. T. Cole.
1991.
Molecular genetics and pathogenesis of Clostridium perfringens.
Microbiol. Rev.
55:621-648 |
| 22. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 23. | Sharpe, M. E., and J. Errington. 1996. The Bacillus subtilis soj-spoOJ locus is required for a centromere-like function involved in prespore chromosome partitioning. Mol. Microbiol. 21:501-509[CrossRef][Medline]. |
| 24. |
Shaw, J. H., and D. B. Clewell.
1985.
Complete nucleotide sequence of macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis.
J. Bacteriol.
164:782-796 |
| 25. |
Smith, C. J.,
S. M. Markowitz, and F. L. Macrina.
1981.
Transferable tetracycline resistance in Clostridium difficile.
Antimicrob. Agents Chemother.
19:997-1003 |
| 26. | Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[CrossRef][Medline]. |
| 27. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199[CrossRef][Medline]. |
| 28. |
Wüst, J., and U. Hardegger.
1983.
Transferable resistance to clindamycin, erythromycin, and tetracycline in Clostridium difficile.
Antimicrob. Agents Chemother.
23:784-786 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»