This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosenau, A.
Right arrow Articles by Quentin, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosenau, A.
Right arrow Articles by Quentin, R.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, March 2000, p. 760-762, Vol. 44, No. 3
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Capnocytophaga ochracea: Characterization of a Plasmid-Encoded Extended-Spectrum TEM-17 beta -Lactamase in the Phylum Flavobacter-Bacteroides

Agnes Rosenau,1,* Blandine Cattier,1 Nathalie Gousset,1 Patrick Harriau,1 Alain Philippon,2 and Roland Quentin1

Département de Microbiologie Médicale et Moléculaire, Centre Hospitalier Universitaire Bretonneau, 37044 Tours cedex,1 and Service de Bactériologie, Hôpital Cochin (Université Paris V), 75679 Paris cedex 14,2 France

Received 9 June 1999/Returned for modification 2 September 1999/Accepted 29 November 1999


    ABSTRACT
Top
Abstract
Text
References

A plasmid-encoded extended-spectrum TEM beta -lactamase with a pI of 5.5 was detected in a Capnocytophaga ochracea clinical isolate. The bla gene was associated with a strong TEM-2 promoter and was derived from blaTEM-1a with a single-amino-acid substitution: Glu104right-arrowLys, previously assigned to TEM-17, which is thus the first TEM beta -lactamase to be reported in the phylum Flavobacter-Bacteroides.


    TEXT
Top
Abstract
Text
References

The dissemination of antibiotic resistance is a clear example of gene exchange between distantly related bacteria (13). However, this phenomenon is rare enough that the presence of a TEM beta -lactamase in Capnocytophaga ochracea, a Cytophagale belonging to the phylum Flavobacter-Bacteroides (14), is of note, this type of enzyme being previously described only in the very phylogenetically distant Proteobacteria (4, 17, 22). C. ochracea is a capnophilic gram-negative fusiform rod with gliding motility. It is part of the normal gingival flora in humans and causes gingivitis and periodontitis. It may cause systemic infections in immunocompromised and neutropenic patients (11). Antibiotic treatment was originally based on its susceptibility to penicillins, including benzylpenicillin (7). The organism was later shown to be susceptible to extended-spectrum cephalosporins, making it possible to prescribe these drugs (2). Enzymatic resistance to beta -lactams, including extended-spectrum cephalosporins, was reported as early as 1986 in clinical isolates of C. ochracea (3, 8, 18, 19). The genetic basis of resistance was not determined for any of the resistant strains. We report for the first time a plasmid-encoded TEM extended-spectrum beta -lactamase in a clinical isolate of C. ochracea.

(This work was presented at the 98th General Meeting of the American Society for Microbiology, Atlanta, Ga., 17 to 21 May 1998.)

C. ochracea CIP 105321 was isolated in 1996 at Bretonneau Hospital Tours, France, from a culture of blood from an 11-year-old child with acute myeloid leukemia, fever (39°C), severe neutropenia, and oral mucositis who had received an empiric antibiotic treatment, including ceftazidime. The beta -lactamase reaction in the nitrocefin-disk test (Cefinase; bioMérieux, Marcy l'Etoile, France) was positive. The disk-agar diffusion test performed on chocolate agar containing 1% PolyVitex (bioMérieux) showed that strain CIP 105321 was resistant to penams (amoxicillin, ticarcillin, and piperacillin) and cephems (cephalothin, cefoperazone, cefuroxime, cefotaxime, ceftazidime, ceftriaxone, cefpirome, and cefepime), but susceptible to cefoxitin, aztreonam, piperacillin-tazobactam, and imipenem. There was extensive synergy between amoxicillin-clavulanic acid and beta -lactam disks, including those for all extended-spectrum cephalosporins tested. The strain was also resistant to gentamicin, polymyxin B, and cotrimoxazole, as commonly reported in the genus Capnocytophaga (7, 19). MICs were determined by agar dilution on Wilkins-Chalgren agar (Difco, Detroit, Mich.) with an inoculum of 104 CFU per spot (3, 18). The MICs of the two beta -lactamase inhibitors, clavulanic acid and sulbactam, were found to be 0.6 and 0.8 µg/ml, respectively. To prevent an intrinsic antibacterial effect of clavulanate and sulbactam, a concentration of 0.1 µg/ml (if combined with a beta -lactam) was then used for all plates. The strain was resistant to amoxicillin (MIC, 512 µg/ml), had intermediate resistance to piperacillin (MIC, 32 µg/ml), and was more resistant to ceftazidime (MIC, 64 µg/ml) than to cefpirome, cefepime, and cefotaxime (MIC, 16 µg/ml). It was susceptible to imipenem and cefoxitin, as was the beta -lactamase-negative control strain, CIP 103448. Clavulanic acid and sulbactam partly restored the activity of amoxicillin, cefotaxime, and ceftazidime (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   In vitro susceptibility of C. ochracea strains to antibiotics

Three types of crude beta -lactamase extract were prepared. Lysis by sonication and by Triton treatment was performed as previously described (8). For lysis by both sonication and detergent, 4% Triton X-100 was added to the sonicated cells. The beta -lactamase activity of the supernatants was estimated by the iodine procedure in gels containing benzylpenicillin, by comparing the decolorized zones obtained with that for a sonicated extract containing TEM-1 beta -lactamase (6). beta -Lactamase activity was not detected in a 24-h broth culture or a Triton extract. Weak activity was detected in a sonicated extract, and strong activity was obtained if Triton was added after sonication. The analytical isoelectric focusing method used was adapted from that described by Foweraker et al. (8), with polyacrylamide gels containing ampholines (Pharmacia, Uppsala, Sweden) with a pH range of 3.5 to 9.5. Focusing of the enzyme could only be achieved for extracts containing Triton and if 4% Triton was included in the gel. This was previously reported to be the case for two other beta -lactamases in Capnocytophaga, possibly due to enzyme binding to membrane components (8, 18). The beta -lactamase migrated as a single band with an estimated pI of 5.5 in comparisons with known beta -lactamases (TEM-1, pI 5.4; TEM-3, pI 6.3; and TEM-4, pI 5.9).

Plasmid DNA isolated by alkaline lysis was about 9 kb in size. Plasmid curing was done by culture with ethidium bromide and replica plating (6). The cured clones were highly susceptible to all beta -lactams tested (Table 1) and did not produce beta -lactamase detectable by the nitrocefin test on colonies. Resistance to other antimicrobial agents was not affected.

PCR was performed with plasmid DNA as the template and a pair of primers (Eurogentec, Seraing, Belgium), 1079 [5'-d(GGTCTGACAGTTACCAATGC)-3'] and 6 [5'-d(GAAGACGAAAGGGCCTCGTG)-3'], internal to blaTEM-1, with nucleotide positions given according to the numbering of Sutcliffe (21). Both strands of the PCR product were sequenced by automated fluorescent sequencing with an ABI Prism 377 sequencer (Perkin-Elmer), by using Thermo Sequenase dye terminator cycle sequencing premixed version 2.0 (Amersham, Les Ulis, France). Analysis of the nucleotide sequence (Table 2) showed that the gene encoding C. ochracea beta -lactamase differed from the blaTEM-1a gene by four silent mutations (positions 469, 682, 863, and 985) and that there was a Glu104right-arrowLys amino acid substitution in the protein according to the numbering scheme of Ambler et al. (1, 9). Lys104 substitution is common in extended-spectrum beta -lactamases derived from TEM-1 or TEM-2 enzymes and is always associated with one to three additional amino acid changes at positions 21, 153, 164, 182, 237, 238, 240, and 265 (15; http://www.lahey.org/studies/webt.htm). The presence of single mutation Glu104right-arrowLys has already been suspected on the basis of colony hybridization with specific oligonucleotide probes (oligotyping) in a single strain of Klebsiella pneumoniae. The enzyme was called TEM-17 (12). After sequencing of the corresponding gene, the deduced amino acid sequence was identical to that of TEM-15, and the enzyme was therefore redesignated TEM-15 (10). Because the beta -lactamase of C. ochracea CIP 105321 presents the single Glu104right-arrowLys amino acid substitution, we assigned it the number TEM-17 (http://www.lahey.org/studies/webt.htm). As for most of these enzymes, the blaTEM-17 gene was associated with a strong TEM-2 promoter with a C-to-T substitution at nucleotide 32 that increases the amount of enzyme (5).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Nucleotide and amino acid differences between blaTEM-1a, blaTEM-2, and blaTEM-17

It is not clear how Capnocytophaga acquired a blaTEM gene. Given the probable emergence in 1986 of the first isolates of Capnocytophaga producing extended-spectrum beta -lactamases and the small size of the plasmids involved, the donating strain probably transferred the extended-spectrum beta -lactamase gene via a transposon. However, Capnocytophaga may have acquired the blaTEM-1 gene via a transposon or small plasmid and then modified the blaTEM-1 gene by point mutation to give blaTEM-17, possibly due to selection pressure exerted by the extended-spectrum cephalosporins used to treat neutropenic patients. The ecological niche of Capnocytophaga and the small size of the plasmid involved suggest that the donating strain was of the genus Haemophilus or Neisseria, in which TEM extended-spectrum beta -lactamases have never been reported. The TEM-1 beta -lactamase should therefore also be present in Capnocytophaga strains.

In conclusion, the emergence of such inactivating enzymes in the Flavobacter-Bacteroides phylum at the same time as in the very distant Proteobacteria phylum (16, 20) requires further molecular investigation to trace the movements of the blaTEM gene.

Nucleotide sequence accession number. The nucleotide sequence of blaTEM-17 has been assigned accession no. Y14574 in the EMBL Nucleotide Sequence Database.


    ACKNOWLEDGMENTS

We thank M. Kiredjian, Laboratoire des Identifications Bactériennes, Institut Pasteur Paris, France, for the identification at the species level of the Capnocytophaga strain.


    FOOTNOTES

* Corresponding author. Mailing address: Département de Microbiologie Médicale et Moléculaire, EA2639, Centre Hospitalier Universitaire Bretonneau, 2 Bd Tonnelé, 37044 Tours cedex, France. Phone: 33 247478059. Fax: 33 247473812. E-mail: rosenau{at}med.univ-tours.fr.


    REFERENCES
Top
Abstract
Text
References

1. Ambler, R. P., A. F. W. Coulson, J. M. Frère, J. M. Ghuysen, B. Joris, M. Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A beta -lactamases. Biochem. J. 276:269-272.
2. Arlet, G., M. J. Sanson-Le Pors, I. M. Casin, M. Ortenberg, and Y. Perol. 1987. In vitro susceptibility of 96 Capnocytophaga strains, including a beta -lactamase producer, to new beta -lactam antibiotics and six quinolones. Antimicrob. Agents Chemother. 31:1283-1284[Abstract/Free Full Text].
3. Arlet, G., M. J. Sanson-Le Pors, S. Castaigne, and Y. Perol. 1987. Isolation of a strain of beta -lactamase-producing Capnocytophaga ochracea. J. Infect. Dis. 155:1346[Medline].
4. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for beta -lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233[Medline].
5. Chen, S.-T., and R. C. Clowes. 1987. Variations between the nucleotide sequences of Tn1, Tn2, and Tn3 and expression of beta -lactamase in Pseudomonas aeruginosa and Escherichia coli. J. Bacteriol. 169:913-916[Abstract/Free Full Text].
6. Courvalin, P., F. Goldstein, A. Philippon, and J. Sirot (ed.). 1985. L'antibiogramme. MPC-Vidéom, Paris, France.
7. Forlenza, S. W., M. G. Newman, A. L. Horikoshi, and U. Blachman. 1981. Antimicrobial susceptibility of Capnocytophaga. Antimicrob. Agents Chemother. 19:144-146[Abstract/Free Full Text].
8. Foweraker, J. E., P. M. Hawkey, J. Heritage, and H. W. Van Landuyt. 1990. Novel beta -lactamase from Capnocytophaga sp. Antimicrob. Agents Chemother. 34:1501-1504[Abstract/Free Full Text].
9. Goussard, S., and P. Courvalin. 1991. Sequence of the genes blaT-1B and blaT-2. Gene 102:71-73[CrossRef][Medline].
10. Goussard, S., and P. Courvalin. 1999. Updated sequence information for TEM beta -lactamase genes. Antimicrob. Agents Chemother. 43:367-370[Abstract/Free Full Text].
11. Kristensen, B., H. C. Schønheyder, N. A. Peterslund, S. Rosthøj, N. Clausen, and W. Frederiksen. 1995. Capnocytophaga (Capnocytophaga ochracea group) bacteremia in hematological patients with profound granulocytopenia. Scand. J. Infect. Dis. 27:153-155[Medline].
12. Mabilat, C., and P. Courvalin. 1990. Development of "oligotyping" for characterization and molecular epidemiology of TEM beta -lactamases in members of the family Enterobacteriaceae. Antimicrob. Agents Chemother. 34:2210-2216[Abstract/Free Full Text].
13. Maiden, M. C. J. 1998. Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria. Clin. Infect. Dis. 27:S12-S20.
14. Nakagawa, Y., and K. Yamasato. 1996. Emendation of the genus Cytophaga and transfer of Cytophaga agarovorans and Cytophaga salmonicolor to Marinilabilia gen. nov.: phylogenetic analysis of the Flavobacterium-Cytophaga complex. Int. J. Syst. Bacteriol. 46:599-603[Abstract/Free Full Text].
15. Palzkill, T., and D. Botstein. 1992. Identification of amino acid substitutions that alter the substrate specificity of TEM-1 beta -lactamase. J. Bacteriol. 174:5237-5243[Abstract/Free Full Text].
16. Paul, G. C., G. Gerbaud, A. Bure, A. M. Philippon, B. Pangon, and P. Courvalin. 1989. TEM-4, a new plasmid-mediated beta -lactamase that hydrolyzes broad-spectrum cephalosporins in a clinical isolate of Escherichia coli. Antimicrob. Agents Chemother. 33:1958-1963[Abstract/Free Full Text].
17. Philippon, A., S. Ben Redjeb, G. Fournier, and A. Ben Hassen. 1989. Epidemiology of extended spectrum beta -lactamases. Infection 17:347-354[CrossRef][Medline].
18. Roscoe, D. L., S. J. V. Zemcov, D. Thornber, R. Wise, and A. M. Clarke. 1992. Antimicrobial susceptibilities and beta -lactamase characterization of Capnocytophaga species. Antimicrob. Agents Chemother. 36:2197-2200[Abstract/Free Full Text].
19. Rummens, J. L., B. Gordts, and H. W. Van Landuyt. 1986. In vitro susceptibility of Capnocytophaga species to 29 antimicrobial agents. Antimicrob. Agents Chemother. 30:739-742[Abstract/Free Full Text].
20. Sirot, D., J. Sirot, R. Labia, A. Morand, P. Courvalin, A. Darfeuille-Michaud, R. Perroux, and R. Cluzel. 1987. Transferable resistance to third-generation cephalosporins in clinical isolates of Klebsiella pneumoniae: identification of CTX-1, a novel beta -lactamase. J. Antimicrob. Chemother. 20:323-334[Abstract/Free Full Text].
21. Sutcliffe, J. G. 1978. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc. Natl. Acad. Sci. USA 75:3737-3741[Abstract/Free Full Text].
22. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271[Free Full Text].


Antimicrobial Agents and Chemotherapy, March 2000, p. 760-762, Vol. 44, No. 3
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Handal, T., Giraud-Morin, C., Caugant, D. A., Madinier, I., Olsen, I., Fosse, T. (2005). Chromosome- and Plasmid-Encoded {beta}-Lactamases in Capnocytophaga spp.. Antimicrob. Agents Chemother. 49: 3940-3943 [Abstract] [Full Text]  
  • Jolivet-Gougeon, A., Tamanai-Shacoori, Z., Desbordes, L., Burggraeve, N., Cormier, M., Bonnaure-Mallet, M. (2004). Genetic Analysis of an Ambler Class A Extended-Spectrum Beta-Lactamase from Capnocytophaga ochracea. J. Clin. Microbiol. 42: 888-890 [Abstract] [Full Text]  
  • Bradford, P. A. (2001). Extended-Spectrum {beta}-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clin. Microbiol. Rev. 14: 933-951 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosenau, A.
Right arrow Articles by Quentin, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosenau, A.
Right arrow Articles by Quentin, R.