Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, March 2000, p. 775-777, Vol. 44, No. 3
Rowett Research Institute, Bucksburn,
Aberdeen, AB21 9SB, United Kingdom
Received 9 August 1999/Returned for modification 2 November
1999/Accepted 16 December 1999
Members of our group recently identified a new tetracycline
resistance gene, tet(W), in three genera of rumen obligate
anaerobes. Here, we show that tet(W) is also present in
bacteria isolated from human feces. The tet(W) genes found
in human Fusobacterium prausnitzii and
Bifidobacterium longum isolates were more than 99.9%
identical to those from a rumen isolate of Butyrivibrio fibrisolvens.
The rapid increase in antibiotic
resistance in human pathogenic bacteria is a major problem,
particularly for nosocomial infections (5). In the past,
antibiotic resistance genes have primarily been described either in
clinical pathogens or in antibiotic-producing microorganisms, and
comparatively little work has been done on the incidence of antibiotic
resistance in the commensal gut flora, either of humans or of animals.
A new ribosome-protection-type tetracycline resistance
(Tcr) gene, tet(W), (GenBank accession no.
AJ222769), was recently identified in the rumen anaerobe
Butyrivibrio fibrisolvens and was also found in rumen
isolates of Selenomonas spp. and Mitsuokella spp.
and in one Mitsuokella isolate from a Japanese pig
(1). The high degree of homology between all of these
tet(W) genes suggested that recent gene transfer events had
resulted in the spread of the gene. tet(W) was shown to be
chromosomally located in B. fibrisolvens and to transfer at
frequencies of 10 Human fecal samples were resuspended in anaerobic 0.1 M sodium
phosphate buffer (pH 7.2), and dilutions were plated out anaerobically either on M2GCS agar plates (6) containing 5 or 10 µg of
tetracycline per ml or in M2GCS roll tubes (2) containing 10 µg of tetracycline per ml. Plates were inoculated in an anaerobic
cabinet (55% CO2, 40% N2, and 5%
H2; Coy Laboratory Products Inc., Grass Lake, Mich.), and
roll tubes were prepared under 100% CO2 (2).
Cultures were incubated at 37°C.
For one sample from a middle-aged male receiving daily tetracycline
treatment over a 10-year period, more than 99% of the 8.3 × 1010 colonies growing anaerobically were Tcr.
Random colonies were picked from roll tubes and regrown in the presence
of 10 µg of tetracycline per ml. Total genomic DNA was purified
(10) and amplified by PCR, either using degenerate primers
which identify all ribosome-protection-type Tcr genes
(1) or using a primer combination specific for
tet(W) (tetW for [5' AAGCGGCAGTCACTTCCTTCC 3']
and tet2 [see reference 1]). All 14 of the
colonies tested yielded a product with the degenerate Tcr
primer set, while only one, isolate K10, yielded a product with primers
specific for tet(W). Culturing of two additional samples from 25-year-old individuals who had not taken antibiotics for at least
10 years showed that less than 0.01% of the total anaerobic bacterial
count was Tcr. Total genomic DNA purified from 3 of 20 Tcr colonies (F5, F8, and F10) from one individual yielded
a PCR product when the primer set specific for tet(W) was used.
The PCR products obtained as described above were sequenced using the
ABI 377 automated sequencing system and confirmed to be
tet(W) products using a basic local alignment search tool
search for database comparisons. This initial sequence analysis
demonstrated that the tet(W) gene from the human isolates
was very closely related to tet(W) genes from the rumen
isolates (1). An extended region of the new
tet(W) genes was amplified using primers corresponding to
positions 165 to 185 and 2096 to 2113 in the database sequence AJ222769. Subsequent sequence analysis showed that the genes from K10
and F5 differed by a single nucleotide and, furthermore, differed by 0 or 1 nucleotides (nt), respectively, over 1,864 nt of the 1,917-nt
coding sequence of the B. fibrisolvens tet(W) gene. Table
1 indicates the sequence divergence
between the tet(W) genes we have identified so far. The
degree of homology observed for tet(W) genes of diverse
origin is much higher than that observed for other
ribosome-protection-type Tcr genes and indicates that the
gene has not evolved greatly following acquisition by the divergent
host bacteria, which therefore implies that transfer events resulting
in the spread of tet(W) have been recent. A survey done to
compare tet(Q) genes from Bacteroides or
Prevotella isolates of animal and human origin indicated
that an internal 407-nt segment differed by up to 59 nt between
different isolates (8). Although this survey found that
human isolates of Prevotella intermedia and
Bacteroides fragilis contained tet(Q) genes which
were identical across the region analyzed, the closest homology between
genes from different hosts was 98%.
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Occurrence of the New Tetracycline Resistance
Gene tet(W) in Bacteria from the Human Gut
and
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
3 to 10
5 per recipient
between genotypically diverse B. fibrisolvens strains in
vitro (10). The translated product of tet(W)
shares only 68% amino acid homology with Tet(O) and Tet(M) proteins
(1). Here, we describe for the first time the identification
of tet(W) in anaerobic bacteria recovered from human feces.
TABLE 1.
Characteristics of bacterial strains
harboring tet(W)
Bacterial isolates confirmed to contain tet(W) were partially characterized by Gram staining and by sequencing 16S ribosomal DNA fragments amplified by PCR using eubacterial primers (12). Searches for homologous sequences in the database showed that the K10 isolate was related to Clostridium spp. and that the F5, F8, and F10 isolates were related to Bifidobacterium spp. Further identification at the Scottish Anaerobe Laboratory (University of Edinburgh) confirmed the identity of K10 as Fusobacterium prausnitzii and the identities of F5, F8, and F10 as Bifidobacterium longum. F. prausnitzii, unlike other Fusobacterium spp., is related to gram-positive bacteria (11).
The genetic location of these closely related tet(W) genes
from the different bacterial species was investigated. Total genomic DNA was purified from the human isolates F5, F8, and K10 and digested with EcoRI or BamHI. Hybridization of the
resulting Southern blot to a 32P-labeled tet(W)
probe indicated that different fragments contain the gene in different
species, the hybridizing bands ranging in size from 7 kb (B. fibrisolvens 1.230) to 12 kb (B. longum F8 [Fig.
1]). The tet(W) probe also
recognized a second, faint BamHI fragment in F. prausnitzii. Attempts at PCR amplification using primers specific
for regions of the transferable element TnB123O flanking
tet(W) did not yield products with the human isolates. The
extent of the homology and the mobility of tet(W) genes from the different isolates are currently being investigated.
|
The results described here indicate that the newly identified tet(W) gene is widespread among anaerobic commensal gut bacteria. The identification of the gene in F. prausnitzii, the fifth most dominant human colonic anaerobe (7), indicates that, as is the case with rumen isolates, tet(W) occurs in some of the most abundant members of the gut flora. From a recent survey it was inferred that tet(Q) could be the most common Tcr gene among anaerobic gram-negative bacteria (4), and the group conducting the survey also identified tet(Q) in gram-positive bacteria for the first time. They also found, however, that a number of the Tcr isolates contain unknown Tcr genes. Some, perhaps many, of these unknown genes could prove to be tet(W).
The extremely high level of sequence identity between the tet(W) genes found in bacteria of different genera isolated from different hosts implies recent gene transfer events. Although the tet(W) gene is located on a highly mobile chromosomal element, TnB123O (10), in the B. fibrisolvens strain where it was first identified, the same mobile element does not appear to be present in all rumen isolates (1) or in human isolates that carry tet(W). Thus, the full range of mechanisms by which the tet(W) gene has spread remains to be elucidated. Interestingly, with the exception of B. fibrisolvens (DNA G+C content of 36 to 41%), tet(W) generally seems to be associated with higher-G+C-content bacterial species (Fusobacterium sp. G+C content, 52 to 57%; B. longum G+C content, 58%; Selenomonas sp. G+C content, 54 to 61%; and Mitsuokella sp. G+C content, 56 to 58%). tet(W) itself has a much higher G+C content (53%) than most ribosome-protection-type tet genes (1), and this may be reflected in its host range.
The occurrence of almost identical Tcr genes in commensal bacteria from the animal and human gut is evidence of recent gene flow between these populations and leads to the important conclusion that obligate anaerobiosis is not a barrier to genetic exchange. The most likely route for transfer between hosts may be via intermediary facultative anaerobes that are capable of colonizing animals and man. Alternatively, it is also likely that transfer of obligately anaerobic gut bacteria between hosts occurs with sufficient frequency to mediate gene transfer events. It is of course impossible to conclude from the present evidence whether transfer of tet(W) has been predominantly to or from the human gut flora. This question is clearly central to the debate over the use of antibiotics as growth promoters in agriculture and the impact such use has on the clinical use of antibiotics in the treatment of human disease. Tetracyclines continue to be important as therapeutic antibiotics, but they are still employed in agriculture in many countries (3), making them overall the second most used group of antibiotics worldwide (9).
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by SERAD (Scottish Executive Rural Affairs Department) and by a studentship award to T. M. Barbosa (Sub-Programa Ciência e Tecnologia do 2° Quadro Comunitário de Apoio PRAXIS XXI/BD/3382/94).
B. fibrisolvens strains JK51 and JK214 were kind gifts from J. Kopecny.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Rowett Research Institute, Greenburn Rd., Bucksburn, Aberdeen, AB21 9SB, United Kingdom. Phone: 44 (0) 1224 712751. Fax: 44 (0) 1224 716687. E-mail: k.scott{at}rri.sari.ac.uk.
Present address: Department of Molecular Biology and Microbiology,
Tufts University School of Medicine, Boston, MA 02111.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Barbosa, T. M., K. P. Scott, and H. J. Flint. 1999. Evidence for recent intergeneric transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O) in ruminal bacteria. Environ. Microbiol. 1:53-64[CrossRef][Medline]. |
| 2. |
Bryant, M. P.
1972.
Commentary on the Hungate technique for cultivation of anaerobic bacteria.
Am. J. Clin. Nutr.
25:1324-1328 |
| 3. | Khachatourians, G. G. 1998. Agricultural use of antibiotics and the evolution and transfer of antibiotic-resistant bacteria. Can. Med. Assoc. J. 159:1129-1136[Abstract]. |
| 4. |
Leng, Z.,
D. E. Riley,
R. E. Berger,
J. N. Krieger, and M. C. Roberts.
1997.
Distribution and mobility of the tetracycline resistance determinant tetQ.
J. Antimicrob. Chemother.
40:551-559 |
| 5. | Levy, S. B. 1992. The antibiotic paradox: how miracle drugs are destroying the miracle. Plenum Press, New York, N.Y. |
| 6. | Miyazaki, K., J. C. Martin, R. Marinsek-Logar, and H. J. Flint. 1997. Degradation and utilization of xylans by the rumen anaerobe Prevotella bryantii (formerly P. ruminicola subsp. brevis) B14. Anaerobe 3:373-381[CrossRef][Medline]. |
| 7. |
Moore, W. E. C., and L. H. Moore.
1995.
Intestinal floras of populations that have a high risk of colon cancer.
Appl. Environ. Microbiol.
61:3202-3207 |
| 8. |
Nikolich, M. P.,
G. Hong,
N. J. Shoemaker, and A. A. Salyers.
1994.
Evidence for natural horizontal transfer of tetQ between bacteria that normally colonize humans and bacteria that normally colonize livestock.
Appl. Environ. Microbiol.
60:3255-3260 |
| 9. | Roberts, M. C. 1996. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19:1-24[CrossRef][Medline]. |
| 10. |
Scott, K. P.,
T. M. Barbosa,
K. J. Forbes, and H. J. Flint.
1997.
High-frequency transfer of a naturally occurring chromosomal tetracycline resistance element in the ruminal anaerobe Butyrivibrio fibrisolvens.
Appl. Environ. Microbiol.
63:3405-3411 |
| 11. |
Wang, R. F.,
W. W. Cao, and C. E. Cerniglia.
1996.
Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.
Int. J. Syst. Bacteriol.
46:341-343 |
| 12. |
Weisberg, W. G.,
S. M. Barns,
D. A. Pelletier, and D. J. Lane.
1991.
16S ribosomal DNA amplification for phylogenetic study.
J. Bacteriol.
173:697-703 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»