This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, March 2000, p. 775-777, Vol. 44, No. 3
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Occurrence of the New Tetracycline Resistance Gene tet(W) in Bacteria from the Human Gut

Karen P. Scott,* Claire M. Melville, Teresa M. Barbosa,dagger and Harry J. Flint

Rowett Research Institute, Bucksburn, Aberdeen, AB21 9SB, United Kingdom

Received 9 August 1999/Returned for modification 2 November 1999/Accepted 16 December 1999


    ABSTRACT
Top
Abstract
Text
References

Members of our group recently identified a new tetracycline resistance gene, tet(W), in three genera of rumen obligate anaerobes. Here, we show that tet(W) is also present in bacteria isolated from human feces. The tet(W) genes found in human Fusobacterium prausnitzii and Bifidobacterium longum isolates were more than 99.9% identical to those from a rumen isolate of Butyrivibrio fibrisolvens.


    TEXT
Top
Abstract
Text
References

The rapid increase in antibiotic resistance in human pathogenic bacteria is a major problem, particularly for nosocomial infections (5). In the past, antibiotic resistance genes have primarily been described either in clinical pathogens or in antibiotic-producing microorganisms, and comparatively little work has been done on the incidence of antibiotic resistance in the commensal gut flora, either of humans or of animals. A new ribosome-protection-type tetracycline resistance (Tcr) gene, tet(W), (GenBank accession no. AJ222769), was recently identified in the rumen anaerobe Butyrivibrio fibrisolvens and was also found in rumen isolates of Selenomonas spp. and Mitsuokella spp. and in one Mitsuokella isolate from a Japanese pig (1). The high degree of homology between all of these tet(W) genes suggested that recent gene transfer events had resulted in the spread of the gene. tet(W) was shown to be chromosomally located in B. fibrisolvens and to transfer at frequencies of 10-3 to 10-5 per recipient between genotypically diverse B. fibrisolvens strains in vitro (10). The translated product of tet(W) shares only 68% amino acid homology with Tet(O) and Tet(M) proteins (1). Here, we describe for the first time the identification of tet(W) in anaerobic bacteria recovered from human feces.

Human fecal samples were resuspended in anaerobic 0.1 M sodium phosphate buffer (pH 7.2), and dilutions were plated out anaerobically either on M2GCS agar plates (6) containing 5 or 10 µg of tetracycline per ml or in M2GCS roll tubes (2) containing 10 µg of tetracycline per ml. Plates were inoculated in an anaerobic cabinet (55% CO2, 40% N2, and 5% H2; Coy Laboratory Products Inc., Grass Lake, Mich.), and roll tubes were prepared under 100% CO2 (2). Cultures were incubated at 37°C.

For one sample from a middle-aged male receiving daily tetracycline treatment over a 10-year period, more than 99% of the 8.3 × 1010 colonies growing anaerobically were Tcr. Random colonies were picked from roll tubes and regrown in the presence of 10 µg of tetracycline per ml. Total genomic DNA was purified (10) and amplified by PCR, either using degenerate primers which identify all ribosome-protection-type Tcr genes (1) or using a primer combination specific for tet(W) (tetW for [5' AAGCGGCAGTCACTTCCTTCC 3'] and tet2 [see reference 1]). All 14 of the colonies tested yielded a product with the degenerate Tcr primer set, while only one, isolate K10, yielded a product with primers specific for tet(W). Culturing of two additional samples from 25-year-old individuals who had not taken antibiotics for at least 10 years showed that less than 0.01% of the total anaerobic bacterial count was Tcr. Total genomic DNA purified from 3 of 20 Tcr colonies (F5, F8, and F10) from one individual yielded a PCR product when the primer set specific for tet(W) was used.

The PCR products obtained as described above were sequenced using the ABI 377 automated sequencing system and confirmed to be tet(W) products using a basic local alignment search tool search for database comparisons. This initial sequence analysis demonstrated that the tet(W) gene from the human isolates was very closely related to tet(W) genes from the rumen isolates (1). An extended region of the new tet(W) genes was amplified using primers corresponding to positions 165 to 185 and 2096 to 2113 in the database sequence AJ222769. Subsequent sequence analysis showed that the genes from K10 and F5 differed by a single nucleotide and, furthermore, differed by 0 or 1 nucleotides (nt), respectively, over 1,864 nt of the 1,917-nt coding sequence of the B. fibrisolvens tet(W) gene. Table 1 indicates the sequence divergence between the tet(W) genes we have identified so far. The degree of homology observed for tet(W) genes of diverse origin is much higher than that observed for other ribosome-protection-type Tcr genes and indicates that the gene has not evolved greatly following acquisition by the divergent host bacteria, which therefore implies that transfer events resulting in the spread of tet(W) have been recent. A survey done to compare tet(Q) genes from Bacteroides or Prevotella isolates of animal and human origin indicated that an internal 407-nt segment differed by up to 59 nt between different isolates (8). Although this survey found that human isolates of Prevotella intermedia and Bacteroides fragilis contained tet(Q) genes which were identical across the region analyzed, the closest homology between genes from different hosts was 98%.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Characteristics of bacterial strains harboring tet(W)

Bacterial isolates confirmed to contain tet(W) were partially characterized by Gram staining and by sequencing 16S ribosomal DNA fragments amplified by PCR using eubacterial primers (12). Searches for homologous sequences in the database showed that the K10 isolate was related to Clostridium spp. and that the F5, F8, and F10 isolates were related to Bifidobacterium spp. Further identification at the Scottish Anaerobe Laboratory (University of Edinburgh) confirmed the identity of K10 as Fusobacterium prausnitzii and the identities of F5, F8, and F10 as Bifidobacterium longum. F. prausnitzii, unlike other Fusobacterium spp., is related to gram-positive bacteria (11).

The genetic location of these closely related tet(W) genes from the different bacterial species was investigated. Total genomic DNA was purified from the human isolates F5, F8, and K10 and digested with EcoRI or BamHI. Hybridization of the resulting Southern blot to a 32P-labeled tet(W) probe indicated that different fragments contain the gene in different species, the hybridizing bands ranging in size from 7 kb (B. fibrisolvens 1.230) to 12 kb (B. longum F8 [Fig. 1]). The tet(W) probe also recognized a second, faint BamHI fragment in F. prausnitzii. Attempts at PCR amplification using primers specific for regions of the transferable element TnB123O flanking tet(W) did not yield products with the human isolates. The extent of the homology and the mobility of tet(W) genes from the different isolates are currently being investigated.


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1.   Southern blot of total genomic DNA purified from the human isolates digested with either EcoRI (lanes 1 to 5) or BamHI (lanes 6 to 8) hybridized to a PCR-amplified tet(W) probe corresponding to nucleotides 165 to 2113 in the database sequence. Lane 1, B. fibrisolvens 1.230 (positive control); lanes 2 and 6, B. longum F5; lanes 3 and 7, B. longum F8; lanes 4 and 8, F. prausnitzii K10; lane 5, B. fibrisolvens 2221 (Tcs, negative control).

The results described here indicate that the newly identified tet(W) gene is widespread among anaerobic commensal gut bacteria. The identification of the gene in F. prausnitzii, the fifth most dominant human colonic anaerobe (7), indicates that, as is the case with rumen isolates, tet(W) occurs in some of the most abundant members of the gut flora. From a recent survey it was inferred that tet(Q) could be the most common Tcr gene among anaerobic gram-negative bacteria (4), and the group conducting the survey also identified tet(Q) in gram-positive bacteria for the first time. They also found, however, that a number of the Tcr isolates contain unknown Tcr genes. Some, perhaps many, of these unknown genes could prove to be tet(W).

The extremely high level of sequence identity between the tet(W) genes found in bacteria of different genera isolated from different hosts implies recent gene transfer events. Although the tet(W) gene is located on a highly mobile chromosomal element, TnB123O (10), in the B. fibrisolvens strain where it was first identified, the same mobile element does not appear to be present in all rumen isolates (1) or in human isolates that carry tet(W). Thus, the full range of mechanisms by which the tet(W) gene has spread remains to be elucidated. Interestingly, with the exception of B. fibrisolvens (DNA G+C content of 36 to 41%), tet(W) generally seems to be associated with higher-G+C-content bacterial species (Fusobacterium sp. G+C content, 52 to 57%; B. longum G+C content, 58%; Selenomonas sp. G+C content, 54 to 61%; and Mitsuokella sp. G+C content, 56 to 58%). tet(W) itself has a much higher G+C content (53%) than most ribosome-protection-type tet genes (1), and this may be reflected in its host range.

The occurrence of almost identical Tcr genes in commensal bacteria from the animal and human gut is evidence of recent gene flow between these populations and leads to the important conclusion that obligate anaerobiosis is not a barrier to genetic exchange. The most likely route for transfer between hosts may be via intermediary facultative anaerobes that are capable of colonizing animals and man. Alternatively, it is also likely that transfer of obligately anaerobic gut bacteria between hosts occurs with sufficient frequency to mediate gene transfer events. It is of course impossible to conclude from the present evidence whether transfer of tet(W) has been predominantly to or from the human gut flora. This question is clearly central to the debate over the use of antibiotics as growth promoters in agriculture and the impact such use has on the clinical use of antibiotics in the treatment of human disease. Tetracyclines continue to be important as therapeutic antibiotics, but they are still employed in agriculture in many countries (3), making them overall the second most used group of antibiotics worldwide (9).


    ACKNOWLEDGMENTS

This work was supported by SERAD (Scottish Executive Rural Affairs Department) and by a studentship award to T. M. Barbosa (Sub-Programa Ciência e Tecnologia do 2° Quadro Comunitário de Apoio PRAXIS XXI/BD/3382/94).

B. fibrisolvens strains JK51 and JK214 were kind gifts from J. Kopecny.


    FOOTNOTES

* Corresponding author. Mailing address: Rowett Research Institute, Greenburn Rd., Bucksburn, Aberdeen, AB21 9SB, United Kingdom. Phone: 44 (0) 1224 712751. Fax: 44 (0) 1224 716687. E-mail: k.scott{at}rri.sari.ac.uk.

dagger Present address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111.


    REFERENCES
Top
Abstract
Text
References

1. Barbosa, T. M., K. P. Scott, and H. J. Flint. 1999. Evidence for recent intergeneric transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O) in ruminal bacteria. Environ. Microbiol. 1:53-64[CrossRef][Medline].
2. Bryant, M. P. 1972. Commentary on the Hungate technique for cultivation of anaerobic bacteria. Am. J. Clin. Nutr. 25:1324-1328[Free Full Text].
3. Khachatourians, G. G. 1998. Agricultural use of antibiotics and the evolution and transfer of antibiotic-resistant bacteria. Can. Med. Assoc. J. 159:1129-1136[Abstract].
4. Leng, Z., D. E. Riley, R. E. Berger, J. N. Krieger, and M. C. Roberts. 1997. Distribution and mobility of the tetracycline resistance determinant tetQ. J. Antimicrob. Chemother. 40:551-559[Abstract/Free Full Text].
5. Levy, S. B. 1992. The antibiotic paradox: how miracle drugs are destroying the miracle. Plenum Press, New York, N.Y.
6. Miyazaki, K., J. C. Martin, R. Marinsek-Logar, and H. J. Flint. 1997. Degradation and utilization of xylans by the rumen anaerobe Prevotella bryantii (formerly P. ruminicola subsp. brevis) B14. Anaerobe 3:373-381[CrossRef][Medline].
7. Moore, W. E. C., and L. H. Moore. 1995. Intestinal floras of populations that have a high risk of colon cancer. Appl. Environ. Microbiol. 61:3202-3207[Abstract].
8. Nikolich, M. P., G. Hong, N. J. Shoemaker, and A. A. Salyers. 1994. Evidence for natural horizontal transfer of tetQ between bacteria that normally colonize humans and bacteria that normally colonize livestock. Appl. Environ. Microbiol. 60:3255-3260[Abstract/Free Full Text].
9. Roberts, M. C. 1996. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19:1-24[CrossRef][Medline].
10. Scott, K. P., T. M. Barbosa, K. J. Forbes, and H. J. Flint. 1997. High-frequency transfer of a naturally occurring chromosomal tetracycline resistance element in the ruminal anaerobe Butyrivibrio fibrisolvens. Appl. Environ. Microbiol. 63:3405-3411[Abstract].
11. Wang, R. F., W. W. Cao, and C. E. Cerniglia. 1996. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation. Int. J. Syst. Bacteriol. 46:341-343[Abstract/Free Full Text].
12. Weisberg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703[Abstract/Free Full Text].


Antimicrobial Agents and Chemotherapy, March 2000, p. 775-777, Vol. 44, No. 3
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Kazimierczak, K. A., Scott, K. P., Kelly, D., Aminov, R. I. (2009). Tetracycline Resistome of the Organic Pig Gut. Appl. Environ. Microbiol. 75: 1717-1722 [Abstract] [Full Text]  
  • Kazimierczak, K. A., Rincon, M. T., Patterson, A. J., Martin, J. C., Young, P., Flint, H. J., Scott, K. P. (2008). A New Tetracycline Efflux Gene, tet(40), Is Located in Tandem with tet(O/32/O) in a Human Gut Firmicute Bacterium and in Metagenomic Library Clones. Antimicrob. Agents Chemother. 52: 4001-4009 [Abstract] [Full Text]  
  • Ammor, M. S., Florez, A. B., Alvarez-Martin, P., Margolles, A., Mayo, B. (2008). Analysis of tetracycline resistance tet(W) genes and their flanking sequences in intestinal Bifidobacterium species. J Antimicrob Chemother 62: 688-693 [Abstract] [Full Text]  
  • Rosander, A., Connolly, E., Roos, S. (2008). Removal of Antibiotic Resistance Gene-Carrying Plasmids from Lactobacillus reuteri ATCC 55730 and Characterization of the Resulting Daughter Strain, L. reuteri DSM 17938. Appl. Environ. Microbiol. 74: 6032-6040 [Abstract] [Full Text]  
  • Spigaglia, P., Barbanti, F., Mastrantonio, P. (2008). Tetracycline Resistance Gene tet(W) in the Pathogenic Bacterium Clostridium difficile. Antimicrob. Agents Chemother. 52: 770-773 [Abstract] [Full Text]  
  • Aires, J., Doucet-Populaire, F., Butel, M. J. (2007). Tetracycline Resistance Mediated by tet(W), tet(M), and tet(O) Genes of Bifidobacterium Isolates from Humans. Appl. Environ. Microbiol. 73: 2751-2754 [Abstract] [Full Text]  
  • Patterson, A. J., Rincon, M. T., Flint, H. J., Scott, K. P. (2007). Mosaic Tetracycline Resistance Genes Are Widespread in Human and Animal Fecal Samples. Antimicrob. Agents Chemother. 51: 1115-1118 [Abstract] [Full Text]  
  • Florez, A. B., Ammor, M. S., Alvarez-Martin, P., Margolles, A., Mayo, B. (2006). Molecular Analysis of tet(W) Gene-Mediated Tetracycline Resistance in Dominant Intestinal Bifidobacterium Species from Healthy Humans. Appl. Environ. Microbiol. 72: 7377-7379 [Abstract] [Full Text]  
  • Billington, S. J., Jost, B. H. (2006). Multiple Genetic Elements Carry the Tetracycline Resistance Gene tet(W) in the Animal Pathogen Arcanobacterium pyogenes. Antimicrob. Agents Chemother. 50: 3580-3587 [Abstract] [Full Text]  
  • Kazimierczak, K. A., Flint, H. J., Scott, K. P. (2006). Comparative Analysis of Sequences Flanking tet(W) Resistance Genes in Multiple Species of Gut Bacteria.. Antimicrob. Agents Chemother. 50: 2632-2639 [Abstract] [Full Text]  
  • Masco, L., Van Hoorde, K., De Brandt, E., Swings, J., Huys, G. (2006). Antimicrobial susceptibility of Bifidobacterium strains from humans, animals and probiotic products. J Antimicrob Chemother 58: 85-94 [Abstract] [Full Text]  
  • Macovei, L., Zurek, L. (2006). Ecology of antibiotic resistance genes: characterization of enterococci from houseflies collected in food settings.. Appl. Environ. Microbiol. 72: 4028-4035 [Abstract] [Full Text]  
  • Margolles, A., Moreno, J. A., van Sinderen, D., de los Reyes-Gavilan, C. G. (2005). Macrolide Resistance Mediated by a Bifidobacterium breve Membrane Protein. Antimicrob. Agents Chemother. 49: 4379-4381 [Abstract] [Full Text]  
  • Stanton, T. B., Humphrey, S. B., Scott, K. P., Flint, H. J. (2005). Hybrid tet Genes and tet Gene Nomenclature: Request for Opinion. Antimicrob. Agents Chemother. 49: 1265-1266 [Full Text]  
  • Moubareck, C., Gavini, F., Vaugien, L., Butel, M. J., Doucet-Populaire, F. (2005). Antimicrobial susceptibility of bifidobacteria. J Antimicrob Chemother 55: 38-44 [Abstract] [Full Text]  
  • Smith, M. S., Yang, R. K., Knapp, C. W., Niu, Y., Peak, N., Hanfelt, M. M., Galland, J. C., Graham, D. W. (2004). Quantification of Tetracycline Resistance Genes in Feedlot Lagoons by Real-Time PCR. Appl. Environ. Microbiol. 70: 7372-7377 [Abstract] [Full Text]  
  • Melville, C. M., Brunel, R., Flint, H. J., Scott, K. P. (2004). The Butyrivibrio fibrisolvens tet(W) Gene Is Carried on the Novel Conjugative Transposon TnB1230, Which Contains Duplicated Nitroreductase Coding Sequences. J. Bacteriol. 186: 3656-3659 [Abstract] [Full Text]  
  • Campos, J., Hernando, M., Roman, F., Perez-Vazquez, M., Aracil, B., Oteo, J., Lazaro, E., de Abajo, F., the Group of Invasive Haemophilus Infections of th, (2004). Analysis of Invasive Haemophilus influenzae Infections after Extensive Vaccination against H. influenzae Type b. J. Clin. Microbiol. 42: 524-529 [Abstract] [Full Text]  
  • Stanton, T. B., Humphrey, S. B. (2003). Isolation of Tetracycline-Resistant Megasphaera elsdenii Strains with Novel Mosaic Gene Combinations of tet(O) and tet(W) from Swine. Appl. Environ. Microbiol. 69: 3874-3882 [Abstract] [Full Text]  
  • Villedieu, A., Diaz-Torres, M. L., Hunt, N., McNab, R., Spratt, D. A., Wilson, M., Mullany, P. (2003). Prevalence of Tetracycline Resistance Genes in Oral Bacteria. Antimicrob. Agents Chemother. 47: 878-882 [Abstract] [Full Text]  
  • Oteo, J., Campos, J., Baquero, F., Spanish members of the European Antimicrobial Resi, (2002). Antibiotic resistance in 1962 invasive isolates of Escherichia coli in 27 Spanish hospitals participating in the European Antimicrobial Resistance Surveillance System (2001). J Antimicrob Chemother 50: 945-952 [Abstract] [Full Text]  
  • Billington, S. J., Songer, J. G., Jost, B. H. (2002). Widespread Distribution of a Tet W Determinant among Tetracycline-Resistant Isolates of the Animal Pathogen Arcanobacterium pyogenes. Antimicrob. Agents Chemother. 46: 1281-1287 [Abstract] [Full Text]  
  • Melville, C. M., Scott, K. P., Mercer, D. K., Flint, H. J. (2001). Novel Tetracycline Resistance Gene, tet(32), in the Clostridium-Related Human Colonic Anaerobe K10 and Its Transmission In Vitro to the Rumen Anaerobe Butyrivibrio fibrisolvens. Antimicrob. Agents Chemother. 45: 3246-3249 [Abstract] [Full Text]  
  • Chopra, I., Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev. 65: 232-260 [Abstract] [Full Text]  
  • Aminov, R. I., Garrigues-Jeanjean, N., Mackie, R. I. (2001). Molecular Ecology of Tetracycline Resistance: Development and Validation of Primers for Detection of Tetracycline Resistance Genes Encoding Ribosomal Protection Proteins. Appl. Environ. Microbiol. 67: 22-32 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, K. P.
Right arrow Articles by Flint, H. J.