Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, April 2000, p. 991-996, Vol. 44, No. 4
Kenya Medical Research Institute/Wellcome
Trust Collaborative Research Program, Wellcome Trust Research
Laboratories, Nairobi,1 and Center for
Geographic Medicine Research, Coast, Kenya Medical Research Institute,
Kilifi,4 Department of Pharmacology and
Therapeutics, University of Liverpool, Liverpool L69 3BX, United
Kingdom2; and Department of Genetics,
University of Washington, Seattle, Washington
98195-73603
Received 21 June 1999/Returned for modification 25 October
1999/Accepted 18 January 2000
The antifolate combination of pyrimethamine (PM) and sulfadoxine
(SD) is the last affordable drug combination available for wide-scale
treatment of falciparum malaria in Africa. Wherever this combination
has been used, drug-resistant parasites have been selected rapidly. A
study of PM-SD effectiveness carried out between 1997 and 1999 at
Kilifi on the Kenyan coast has shown the emergence of RI and RII
resistance to PM-SD (residual parasitemia 7 days after treatment) in 39 out of 240 (16.25%) patients. To understand the mechanism that
underlies resistance to PM-SD, we have analyzed the dihydrofolate
reductase (DHFR) and dihydropteroate synthase (DHPS) genotypes of 81 patients. Fifty-one samples were obtained, before treatment, from
patients who remained parasite free for at least 7 days after
treatment. For a further 20 patients, samples were obtained before
treatment and again when they returned to the clinic with parasites 7 days after PM-SD treatment. Ten additional isolates were obtained from
patients who were parasitemic 7 days after treatment but who were not
sampled before treatment. More than 65% of the isolates (30 of 46) in
the initial group had wild-type or double mutant DHFR alleles, and all
but 7 of the 47 (85%) had wild-type DHPS alleles. In the paired
(before and after treatment) samples, the predominant combinations of DHFR and DHPS alleles before treatment were of triple mutant DHFR and
double mutant DHPS (41% [7 of 17]) and of double mutant DHFR and
double mutant DHPS (29% [5 of 17]). All except one of the posttreatment isolates had triple mutations in DHFR, and most of these
were "pure" triple mutants. In these isolates, the combination of a
triple mutant DHFR and wild-type DHPS was detected in 6 of 29 cases
(20.7%), the combination of a triple mutant DHFR and a single mutant
(A437G) DHPS was detected in 4 of 29 cases (13.8%), and the
combination of a triple mutant DHFR and a double mutant (A437G, L540E)
DHPS was detected in 16 of 29 cases (55.2%). These results demonstrate
that the triply mutated allele of DHFR with or without mutant DHPS
alleles is associated with RI and RII resistance to PM-SD. The
prevalence of the triple mutant DHFR-double mutant DHPS combination may
be an operationally useful marker for predicting the effectiveness of
PM-SD as a new malaria treatment.
As chloroquine-resistant parasites
have spread throughout Africa (5, 35),
pyrimethamine-sulfadoxine (PM-SD) has increasingly become the drug
combination of choice for the treatment of uncomplicated malaria. PM is
an inhibitor of dihydrofolate reductase (DHFR), which is one component
of a bifunctional protein, the other component being thymidylate
synthetase (7). SD is thought to act against dihydropteroate
synthase (DHPS), a bifunctional protein that combines with
hydroxymethypterin pyrophosphokinase (6, 25). The inhibitory activity of each drug is greatly augmented when they are used in
combination, but the mechanism of this synergism is not yet understood.
Wherever PM-SD has been used, the selection of resistant Plasmodium falciparum populations has been rapid (35,
36, 37). The emergence of PM-SD resistance is of immediate
concern in Africa since it is the last of the available and affordable antimalarial drugs. This is especially true for Kenya, which only recently replaced chlorquine with PM-SD as the first-line treatment for
nonsevere malaria (17).
In vitro analyses have clearly demonstrated that resistance to PM is
associated with the mutation of the amino acid Ser to Asn at codon 108 of DHFR. Ancillary point mutations of Asn to Ile at codon 51 and of Cys
to Arg at codon 59 are associated with an increase of resistance, and a
higher level of PM resistance occurs in the presence of the point
mutation Ile to Leu at codon 164 (2, 8, 12, 15, 18, 19, 21, 24,
39). When in vitro analyses are carried out with
low-concentration-folate or folate-free medium, a point mutation in
DHPS that changes Ala to Gly at codon 437 is associated with SD
resistance. Additional changes of Ser to Phe and Ser to Ala at residue
436, Ala to Gly at residue 581, Lys to Glu at residue 540, and Ala to
Ser or Ala to Thr at codon 613 are associated with higher levels of
resistance (26, 27, 31). However, when the same experiments
were carried out with physiological levels of folate, the impact of
these point mutations in DHPS on PM-SD susceptibility was less clear
(33, 34).
We have proposed a model for the mechanism of antifolate resistance in
P. falciparum which ascribes a primary role to mutations in
the parasite gene which encodes DHFR-thymidylate synthetase and
considers mutations in the parasite DHPS to be of secondary importance
(34). This model predicts that populations comprised principally of parasites with triple mutant alleles of DHFR begin to
accumulate mutations in DHPS as well. If this is the case, then the
DHPS mutations would augment the already significant resistance to
PM-SD (22, 23, 32).
It is now common at our study site in Kilifi, Kenya, for 10 to 20% of
patients treated with PM-SD to remain parasitemic 7 days after
treatment. To understand the mechanism that underlies resistance to
PM-SD, we analyzed the DHFR and DHPS alleles in these PM-SD-resistant
parasites and correlated the clinical and parasitological data with
molecular markers to better define the alleles in each gene associated
with resistance to PM-SD.
P. falciparum isolates were collected during a
monitoring exercise to establish the extent of PM-SD resistance at the
Kenya Medical Research Institute unit within the Kilifi District
Hospital on the Kenya coast between July 1997 and December 1998. Febrile children aged 3 to 71 months with uncomplicated malaria were
recruited if they were well enough for outpatient management and
fulfilled the following criteria: (i) a capillary hemoglobin level of 5 g% or greater and (ii) a P. falciparum parasitemia level
above 2,000 but below 250,000 per µl of blood. In our study, we were interested only in those who received PM-SD (PM, 1.25 mg/kg of body
weight; SD, 25 mg/kg; single dose). Isolates from 51 patients who were
aparasitemic after 7 days and 30 patients who remained parasitemic 7 days after treatment were analyzed. Fifty-microliter blood samples
before and 7 days after PM-SD treatment were spotted onto filter paper,
dried, and kept at ambient temperature until analyzed. Parasite genomic
material was prepared according to the methanol fixation protocol
(13) adapted for P. falciparum parasites by J. Cortese (personal communication). Briefly, a small piece of
blood-impregnated filter paper was snipped and put in a 0.5-ml
microcentrifuge tube containing 50 µl of absolute methanol for 15 min
at ambient temperature. Thereafter, the methanol was poured off and the
paper was allowed to dry so that all of the methanol evaporated. Fifty
microliters of sterilized water was then added to the tube, which was
heated at 95°C for 15 min in a PCR machine, and tubes were vortexed
every 3 min during this incubation. Following centrifugation
(15,000 × g, 2 min), 2.5 to 5 µl of the solution was
used as the template for PCR analysis.
Point mutations in codons 108, 51, 59, and 164 of DHFR were detected by
the techniques of allele-specific PCR and enzyme digestion (11,
18) after the nested amplification of the DHFR domain as
described elsewhere (21). Point mutations in codons 436, 437, 540, 581, and 613 of DHPS were analyzed by PCR amplification and
restriction enzyme digestion (11). To increase the
sensitivity and specificity of the DHPS amplification, we designed a
new set of long primers for the first round of PCR; the primer
designations and sequences are as follows: 209 (sense), 5'
AACCTAAACGTCCTGTTCAAAGAATGTTTGAAATGTAAATGAAGG 3', and 210 (antisense), 5'
CCTCATGTAATTCATCTGAAACATCCAATTGTGTGATTTGTCCAC 3'. These primers
were used at a concentration of 0.2 µM in the presence of 200 µM
each deoxynucleoside triphosphate, 2.5 mM MgCl2, and 1.5 U
of Taq polymerase (Promega, Southampton, United Kingdom) under the following conditions: preincubation at 92°C for 45 s; cycling at 92°C for 30 s, 55°C for 45 s, and 72°C for
45 s; and a final extension at 72°C for 5 min. The initial
amplification was set up in 25 µl for 25 cycles. From this reaction,
1 µl was used for the secondary amplification (11), for
which the primer concentration was increased to 1 µM and the number
of cycles was 35. All the other amplification parameters were identical
to those of the initial step. Restriction enzyme digestions were
carried out as described elsewhere (11).
The Epi Info (Atlanta, Ga.) version 6 package was used for statistical analyses.
Between July 1997 and January 1999, 272 children with
uncomplicated falciparum malaria were treated with PM-SD in the
outpatient clinic at the Kilifi District Hospital. Eleven children were
withdrawn because of vomiting of the drug. Of the 261 remaining, 240 returned to the clinic at day 7 for follow-up. Of these 240 children,
39 (16.25%) were parasitemic at day 7. These 39 children had a mean of
17,498 parasites/µl of blood before treatment and 638 parasites/µl 7 days after PM-SD treatment, which is a clear indication of RI or RII
resistance according to the World Health Organization classification for chloroquine resistance (38).
Table 1 summarizes the initial DHFR and
DHPS genotypes of 51 isolates from children who remained aparasitemic
at day 7. Thirty out of 46 isolates (65%) had either wild-type DHFR,
single mutant DHFR (S108N), or double mutant DHFR (S108N paired with
N51I or C59R). Sixteen of 46 isolates (35%) carried a triple mutant
DHFR genotype (S108N, N51I, and C59R). Some of these mutants were from mixed infections that included wild-type DHFRs from parasites as well.
Forty-two of 47 (89%) of these isolates exhibited the wild-type DHPS
genotype at positions 437 and 540, but 5 carried a mutant allele at
position 436. In these isolates, no I164L mutation in DHFR or A581G or
A613S mutation in DHPS was observed.
0066-4804/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Towards an Understanding of the Mechanism of
Pyrimethamine-Sulfadoxine Resistance in Plasmodium
falciparum: Genotyping of Dihydrofolate Reductase and
Dihydropteroate Synthase of Kenyan Parasites
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
DHFR and DHPS genotypes of P. falciparum
isolates collected before PM-SD treatment in Kilifi, Kenya, between
1997 and 1998a
Thirty children who remained parasitemic after treatment with PM-SD
were identified. Twenty isolates were collected both before and 7 days
after treatment for DHFR and DHPS genotype analysis (three additional
isolates were collected 14, 16, and 28 days after treatment). Samples
from an additional 10 children were analyzed upon their return at 7 days, but their day 0 samples were not available for analysis. The
results are summarized in Table 2. Before
treatment, 11 of 17 isolates contained triple mutant DHFR alleles
(S108N, N51I, and C59R), predominantly mixed with wild-type codons at
positions 51 and/or 59, and 6 of 17 contained double mutant DHFR
alleles (S108N paired with N51I or C59R); no isolate with wild-type
DHFR was found. The analysis of DHPS alleles showed that only 2 isolates among 19 had wild-type DHPS alleles, 2 had single mutant
alleles (A437G), and 14 had double mutant alleles (A436F and K540E).
One isolate had point mutations that encode A436F and A437G. In this
group, the predominant combinations of DHFR and DHPS in the
pretreatment isolates were triple mutant DHFR with double mutant DHPS
alleles (43.75% [7 of 16]) and double mutant DHFR with double mutant
DHPS alleles (31.25% [5 of 16]).
|
Examination of the pretreatment isolates from the two groups allows two important conclusions. First, the triple mutant DHFR allele is now extremely common in this population. The patients who remained parasitemic were more likely to carry parasites with this genotype than those who cleared their infection for at least 7 days (relative risk, 2.44; confidence interval, 1.03 to 5.78). Second, if one examines both DHFR and DHPS genotypes, a striking difference is observed: patients who carried parasites with triple or double mutations in DHFR and double mutations in DHPS were far more likely to remain parasitemic than those with wild-type DHPS (relative risk, 12.0; confidence interval, 3.1 to 46.4). Thus, the combination of these two mutant genotypes is a very clear risk factor for drug failure.
The most pronounced difference between the pre- and posttreatment samples was observed in the DHFR genotype. After treatment, all parasites except one carried triple mutant DHFR alleles and isolates that had carried mixed populations with wild-type DHFR alleles were often rendered "pure" triple mutants (PCR analysis showed only parasites with mutant codons at positions 108, 51, and 59) by PM-SD treatment. The remaining isolate contained a double mutant (S108N-N51I) DHFR allele. The change in DHPS genotype as a function of PM-SD treatment was far less pronounced. Most initial isolates that were doubly mutant in DHPS retained the same genotype after treatment. Two A437G DHPS mutants and one A436F-A437G DHPS mutant exhibited the double mutation A437G K540E after treatment. One isolate, L23, exhibited mutations at both 437 and 540 before treatment but reversed to the wild-type genotype after treatment, and one A436F-A437G double mutant (isolate 214) became an A437G single mutant after treatment. Because 10 of the pretreatment isolates were unavailable for analysis, we cannot directly examine changes in the full data set, but overall, changes in the DHPS genotypes did not suggest any strong trends of selection during treatment. However, the isolates are presented chronologically, and the A437G-K540E double mutant genotype is more common in isolates collected at the end of the period. In addition, there was a tendency for some mixed genotypes in the pretreated group to become pure genotypes after treatment.
Since the determination of the nature of selection exerted by the combination of PM and SD is one goal of our study, the combinations of DHFR and DHPS alleles are of particular interest. After treatment, the combination of a triple mutant DHFR and a double mutant (A437G-L540E) DHPS was the most common, being detected in 16 of 29 cases (55.17%). Six of 29 isolates (20.68%) had a triple mutant DHFR and a wild-type DHPS, and 4 of 29 isolates (13.80%) had a triple mutant DHFR and single mutant (A437G) DHPS. One triple mutant DHFR isolate had the S436F-A437G DHPS allele, and another had a single mutation at S436A but mixed with the wild-type codon. The isolate that had a double mutant DHFR allele also had a double mutant DHPS allele (A437G-K540E). Even after selection, none of the analyzed isolates had alleles with point mutations at codon 164 of DHFR or at codons 581 and 613 of DHPS. Overall, the patterns show a strong trend toward selection of triply mutated DHFR alleles and some tendency toward DHPS alleles with additional mutations as well.
| |
DISCUSSION |
|---|
|
|
|---|
In vitro analyses have clearly shown that polymorphisms in DHFR and DHPS are associated with resistance to PM and SD (when tests are carried out in low-concentration-folate or folate-free medium), but markers associated with the emergence of in vivo resistance to the combination PM-SD are yet to be clearly defined. Our results demonstrate a clear genotype pattern associated with the emergence of RI or RII resistance to PM-SD in vivo: parasites that carried a triple mutant allele of DHFR and a double mutant allele of DHPS were the most likely to escape drug action. Indeed, more than 96% of the parasites observed 7 days after treatment had triple mutations in DHFR, and more than 75% of these also had a single mutation (A437G) or a double mutation (A437G and K540E) in DHPS. Our previous data (33) and those published by Basco and coworkers (3) show that three mutants in the DHFR domain can be used as a marker to predict the clinical outcome of PM-SD treatment in situations where PM-SD has been used only sparingly. Under these conditions, the prevalence of the triple DHFR allele is relatively low and the parasites that carry these alleles are clearly at a selective advantage. However, when triple mutant DHFR becomes the most common allele in the P. falciparum population, then the status of DHPS is also relevant to the prediction of PM-SD failure, as we have observed here.
Even the combination of both genetic markers in a parasite or a patient is unlikely to be a perfect predictor of clinical outcome in an individual patient. For example, among those patients that retained parasites after PM-SD treatment, we found one isolate (47/Pf042) that exhibited wild-type DHFR (although this allele occurred together with double and/or triple mutant DHFR) and another isolate with only a double mutant DHFR genotype. If the triple mutant DHFR is necessary for the occurrence of PM-SD resistance, these parasites should have been sensitive to PM-SD. Such discrepancies have also been described elsewhere (16). These discrepancies presumably reflect the variation in the many parameters that can affect response to treatment: absorption and metabolism of the drug, immunological status, and, most importantly, the level of folate. Indeed, it has been shown that folate supplementation is associated with a decrease of PM-SD effectiveness in vivo (28; also unpublished data from Kilifi and Entasopia, Kenya). In addition, P. falciparum isolates differ in their abilities to use exogenous folate (30). These factors complicate the prediction of treatment outcome on the basis of parasite DHFR genotype for a single patient but do not (from our data) significantly reduce the usefulness of the triple mutation in DHFR with the double mutation in DHPS as a predictor of escape from PM-SD treatment. Surveillance of the DHFR and DHPS genotypes in P. falciparum populations can provide a potent tool to predict the efficacy of PM-SD in a local region.
Very few studies have assessed the relation between polymorphism in DHFR and DHPS and the clinical outcome of PM-SD treatment in Africa. The first analysis was done with Tanzanian P. falciparum populations (9, 14, 29). Similar studies have been carried out in Cameroon (3) and Mali (10), although the number of PM-SD-resistant isolates was very low in these two West African sites. Our report is the first of its kind to assess Kenyan isolates. All of these studies show that the triple mutant DHFR allele can be paired with wild-type, single mutant (A437), or double mutant (A437G-K540E or A437G-A581G) DHPS in patients who exhibit an RI or RII level of resistance to PM-SD. One interpretation of these data is that the selection of PM-SD resistance is a stepwise process. We propose that selection of mutations in DHFR gradually decreases the sensitivity of the parasites to the PM component of PM-SD. Once the marginally PM-sensitive triple mutant alleles of DHFR are well established in the population, selection of mutations in DHPS occurs and sensitivity to SD diminishes as well (E. Mberu, M. Mosobo, M. A. Nzila, G. Kokwaro, C. H. Sibley, and W. M. Watkins, unpublished data; M. A. Nzila et al., unpublished data). The result is an inexorable decrease in the efficacy of PM-SD, and when three or more mutations in both DHFR and DHPS are common in the population, clinical failure of the drug results.
The most frequent point mutation in DHPS in our isolates was A437G. This mutation is also the predominant allele described previously for Kenya (29) and other locations throughout the world (4, 6, 10, 20, 25, 26, 29). It occurs alone or in combination with other point mutations. In vitro analyses have shown that this single mutation can lead to a 10-fold increase in the Ki (26) and 50% inhibitory concentrations (31) for SD and can confer on transfected parasites a 5-fold increase in SD resistance (27) in low-concentration-folate or folate-free medium. These observations led Triglia et al. to propose that this mutation is a necessary first step that allows the other changes to be selected, a situation similar to the apparent requirement for the S108N change before subsequent mutations are selected in the DHFR allele. Our results are in agreement with this hypothesis. We have described for the first time two PM-SD-resistant isolates with the S436F-A437G DHPS genotype. One of two isolates was collected at day 0, and it showed a reversal to the wild-type genotype at codon 436 after PM-SD treatment. By relating PM-SD clinical outcome and DHPS genotype, the same reversal of the S436A codon to the wild-type genotype was reported for isolates after PM-SD treatment in Tanzania (9, 14), in South America (20), and in Mali (10). These observations support the hypothesis that polymorphism at codon 436, especially the Ala codon, may be considered an alternative wild-type codon (4). Our data confirm the absence of mutations at codon 613 (A613S and A613T) in DHPS in areas where PM-SD resistance is common. These alterations have also been found in only three reference isolates, D6, W2, and V1S, and recently in Mali (10) (an area where PM-SD is still highly effective). Despite the high resistance level conferred by the presence of these codons (in the isolates V1S and W2, which have A437G), the presence of point mutations at this codon may be associated in some way with reduced fitness of the parasite, explaining their absence in field isolates, as previously proposed (27).
An alternative antifolate drug, chlorproguanil-dapsone, is currently in clinical trials (1). As we predicted (33), PM-SD-resistant parasites (those with a triple mutation in DHFR but with or without mutations in DHPS) are sensitive to this combination (H. Dayo, J. Sulo, and P. Winstanley, unpublished data). However, the continued use of PM-SD will likely select for DHFR quadruple mutations (N51I, C59R, S108N, and I164L) and additional mutations in DHPS which are likely to be associated with RIII PM-SD resistance and which may render even chlorproguanil-dapsone ineffective (34). Recognition of the rapid selection of resistance to PM-SD offers the opportunity to choose alternatives other than PM-SD when chloroquine is replaced. Monitoring mutations in P. falciparum DHFR and DHPS by molecular analysis is one tool for understanding the dynamics of the selection for resistance to antifolate drugs and designing optimal strategies for their therapeutic use.
| |
ACKNOWLEDGMENTS |
|---|
We thank the director of the Kenya Medical Research Institute for permission to publish these data. We appreciate the constructive criticism of Eleanor Hankins.
This work was supported by the Wellcome Trust of Great Britain (grants 045010 and 056769), the UNDP/World Bank/WHO Special Program for Research and Training in Tropical Diseases (grant 980369), and the NIH (grant AI 42321 to C.H.S.). E.K.M. holds a training fellowship in the International Training and Research in Emerging Infectious Diseases (ITREID) program at the University of Washington, Seattle. A.N.M., E.K.M., and W.M.W. are grateful to the Wellcome Trust for personal support.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Wellcome Trust Research Laboratories, P.O. Box 43640, Nairobi, Kenya. Phone: 2542 725 390. Fax: 254 2 711 673. E-mail: anzila{at}WTRL.OR.KE.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amukoye, E., P. A. Winstanley, W. M. Watkins, R. W. Snow, J. Hatcher, M. Mosobo, E. Ngumbao, B. Lowe, M. Ton, G. Minyiri, and K. Marsh. 1997. Chlorproguanil-dapsone: effective treatment for uncomplicated falciparum malaria. Antimicrob. Agents Chemother. 41:2261-2264[Abstract]. |
| 2. | Basco, L. K., P. Eldin de Pecoulas, C. M. Wilson, J. Le Bras, and A. Mazabraud. 1995. Point mutations in the dihydrofolate reductase-thymidylate synthase gene and pyrimethamine and cycloguanil resistance in Plasmodium falciparum. Mol. Biochem. Parasitol. 69:135-138[CrossRef][Medline]. |
| 3. |
Basco, L. K.,
R. Tahar, and P. Ringwald.
1998.
Molecular basis of in vivo resistance to sulfadoxine-pyrimethamine in African adult patients infected with Plasmodium falciparum malaria parasites.
Antimicrob. Agents Chemother.
42:1811-1814 |
| 4. | Basco, L. K., and P. Ringwald. 1998. Molecular epidemiology of malaria in Yaounde, Cameroon. II. Baseline frequency of point mutations in the dihydropteroate synthase gene of Plasmodium falciparum. Am. J. Trop. Med. Hyg. 58:374-377[Abstract]. |
| 5. | Bloland, P. B., E. M. Lackritz, P. N. Kazembe, J. B. Were, R. Steketee, and C. C. Campbell. 1993. Beyond chloroquine: implications of drug resistance for evaluating malaria therapy efficacy and treatment policy in Africa. J. Infect. Dis. 167:932-937[Medline]. |
| 6. | Brooks, D. R., P. Wang, M. Read, W. M. Watkins, P. F. Sims, and J. E. Hyde. 1994. Sequence variation of the hydroxymethyldihydropterin pyrophosphokinase: dihydropteroate synthase gene in lines of the human malaria parasite, Plasmodium falciparum, with differing resistance to sulfadoxine. Eur. J. Biochem. 224:397-405[Medline]. |
| 7. |
Bzik, D. J.,
W. B. Li,
T. Horii, and J. Inselburg.
1987.
Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.
Proc. Natl. Acad. Sci. USA
84:8360-8364 |
| 8. |
Cowman, A. F.,
M. J. Morry,
B. A. Biggs,
G. A. Cross, and S. J. Foote.
1988.
Amino acid changes linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum.
Proc. Natl. Acad. Sci. USA
85:9109-9113 |
| 9. | Curtis, J., M. T. Duraisingh, and D. C. Warhurst. 1998. In vivo selection for a specific genotype of dihydropteroate synthetase of Plasmodium falciparum by pyrimethamine-sulfadoxine but not chlorproguanil-dapsone treatment. J. Infect. Dis. 177:1429-1433[Medline]. |
| 10. | Diourte, Y., A. Djimde, O. K. Doumbo, I. Sagara, Y. Coulibaly, A. Dicko, M. Diallo, M. Diakite, J. F. Cortese, and C. V. Plowe. 1999. Pyrimethamine-sulfadoxine efficacy and selection for mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase in Mali. Am. J. Trop. Med. Hyg. 60:475-478[Abstract]. |
| 11. | Duraisingh, M. T., J. Curtis, and D. C. Warhurst. 1998. Plasmodium falciparum: detection of polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes by PCR and restriction digestion. Exp. Parasitol. 89:1-8[CrossRef][Medline]. |
| 12. |
Foote, S. J.,
D. Galatis, and A. F. Cowman.
1990.
Amino acids in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum involved in cycloguanil resistance differ from those involved in pyrimethamine resistance.
Proc. Natl. Acad. Sci. USA
87:3014-3017 |
| 13. | Gregory, C. A., Y. Myal, and R. P. Shiu. 1995. Rapid genotyping of transgenic mice using dried blood spots from Guthrie cards for PCR analysis. BioTechniques 18:758-760[Medline]. |
| 14. | Jelinek, T., A. M. Ronn, M. M. Lemnge, J. Curtis, J. Mhina, M. T. Duraisingh, I. C. Bygbjerg, and D. C. Warhurst. 1998. Polymorphisms in the dihydrofolate reductase (DHFR) and dihydropteroate synthetase (DHPS) genes of Plasmodium falciparum and in vivo resistance to sulphadoxine/pyrimethamine in isolates from Tanzania. Trop. Med. Int. Health 3:605-609[CrossRef][Medline]. |
| 15. | Khan, B., S. Omar, J. N. Kanyara, M. Warren-Perry, J. Nyalwidhe, D. S. Peterson, T. Wellems, S. Kaniaru, J. Gitonga, F. J. Mulaa, and D. K. Koech. 1997. Antifolate drug resistance and point mutations in Plasmodium falciparum in Kenya. Trans. R. Soc. Trop. Med. Hyg. 91:456-460[CrossRef][Medline]. |
| 16. | Kublin, J. G., R. S. Witzig, A. H. Shankar, J. Q. Zurita, R. H. Gilman, J. A. Guarda, J. F. Cortese, and C. V. Plowe. 1998. Molecular assays for surveillance of antifolate-resistant malaria. Lancet 351:1629-1630[CrossRef][Medline]. |
| 17. | Ministry of Health. 1998. National guidelines for diagnosis, treatment and prevention of malaria for health workers. Ministry of Health, Kenya. |
| 18. |
Nzila-Mounda, A.,
E. K. Mberu,
C. H. Sibley,
C. V. Plowe,
P. A. Winstanley, and W. M. Watkins.
1998.
Kenyan Plasmodium falciparum field isolates: correlation between pyrimethamine and chlorcycloguanil activity in vitro and point mutations in the dihydrofolate reductase domain.
Antimicrob. Agents Chemother.
42:164-169 |
| 19. |
Peterson, D. S.,
W. K. Milhous, and T. E. Wellems.
1990.
Molecular basis of differential resistance to cycloguanil and pyrimethamine in Plasmodium falciparum malaria.
Proc. Natl. Acad. Sci. USA
87:3018-3022 |
| 20. | Plowe, C. V., J. F. Cortese, A. Djimde, O. C. Nwanyanwu, W. M. Watkins, P. A. Winstanley, J. G. Estrada-Franco, R. E. Mollinedo, J. C. Avila, J. L. Cespedes, D. Carter, and O. K. Doumbo. 1997. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine use and resistance. J. Infect. Dis. 176:1590-1596[Medline]. |
| 21. | Reeder, J. C., K. H. Rieckmann, B. Genton, K. Lorry, B. Wines, and A. F. Cowman. 1996. Point mutations in the dihydrofolate reductase and dihydropteroate synthetase genes and in vitro susceptibility to pyrimethamine and cycloguanil of Plasmodium falciparum isolates from Papua, New Guinea. Am. J. Trop. Med. Hyg. 55:209-213. |
| 22. | Sims, P. F., P. Wang, and J. E. Hyde. 1998. On the efficacy of antifolate antimalarial combinations in Africa. Parasitol. Today 14:136-137. |
| 23. | Sims, P. F., P. Wang, and J. E. Hyde. 1999. Selection and synergy in Plasmodium falciparum. Parasitol. Today 15:132-134[CrossRef][Medline]. |
| 24. | Snewin, V. A., S. M. England, P. F. Sims, and J. E. Hyde. 1989. Characterisation of the dihydrofolate reductase-thymidylate synthetase gene from human malaria parasites highly resistant to pyrimethamine. Gene 76:41-52[CrossRef][Medline]. |
| 25. |
Triglia, T., and A. F. Cowman.
1994.
Primary structure and expression of the dihydropteroate synthetase gene of Plasmodium falciparum.
Proc. Natl. Acad. Sci. USA
91:7149-7153 |
| 26. |
Triglia, T.,
J. G. Menting,
C. Wilson, and A. F. Cowman.
1997.
Mutations in dihydropteroate synthase are responsible for sulfone and sulfonamide resistance in Plasmodium falciparum.
Proc. Natl. Acad. Sci. USA
94:13944-13949 |
| 27. | Triglia, T., P. Wang, P. F. Sims, J. E. Hyde, and A. F. Cowman. 1998. Allelic exchange at the endogenous genomic locus in Plasmodium falciparum proves the role of dihydropteroate synthase in sulfadoxine-resistant malaria. EMBO J. 17:3807-3815[CrossRef][Medline]. |
| 28. | van Hensbroek, M. B., S. Morris-Jones, S. Meisner, S. Jaffar, L. Bayo, R. Dackour, C. Phillips, and B. M. Greenwood. 1995. Iron, but not folic acid, combined with effective antimalarial therapy promotes haematological recovery in African children after acute falciparum malaria. Trans. R. Soc. Trop. Med. Hyg. 89:672-676[CrossRef][Medline]. |
| 29. | Wang, P., C. S. Lee, R. Bayoumi, A. Djimde, O. Doumbo, G. Swedberg, L. D. Dao, H. Mshinda, M. Tanner, W. M. Watkins, P. F. Sims, and J. E. Hyde. 1997. Resistance to antifolates in Plasmodium falciparum monitored by sequence analysis of dihydropteroate synthetase and dihydrofolate reductase alleles in a large number of field samples of diverse origins. Mol. Biochem. Parasitol. 89:161-177[CrossRef][Medline]. |
| 30. | Wang, P., M. Read, P. F. Sims, and J. E. Hyde. 1997. Sulfadoxine resistance in the human malaria parasite Plasmodium falciparum is determined by mutations in dihydropteroate synthetase and an additional factor associated with folate utilization. Mol. Microbiol. 23:979-986[CrossRef][Medline]. |
| 31. | Wang, P., P. F. Sims, and J. E. Hyde. 1997. A modified in vitro sulfadoxine susceptibility assay for Plasmodium falciparum suitable for investigating Fansidar resistance. Parasitology 115:223-230. |
| 32. | Wang, P., R. K. Brobey, T. Horii, P. F. Sims, and J. E. Hyde. 1999. Utilization of exogenous folate in the human malaria parasite Plasmodium falciparum and its critical role in antifolate drug synergy. Mol. Microbiol. 32:1254-1262[CrossRef][Medline]. |
| 33. | Watkins, W. M., E. K. Mberu, P. A. Winstanley, and C. V. Plowe. 1997. The efficacy of antifolate antimalarial combination in Africa: a predictive model based on pharmacodynamic and pharmacokinetic analyses. Parasitol. Today 13:459-464[CrossRef][Medline]. |
| 34. | Watkins, W. M., E. K. Mberu, P. A. Winstanley, and C. V. Plowe. 1999. More on `the efficacy of antifolate antimalarial combinations in Africa'. Parasitol. Today 15:131-132[CrossRef][Medline]. |
| 35. | Wernsdorfer, W. H. 1994. Epidemiology of drug resistance in malaria. Acta Trop. 56:143-156[CrossRef][Medline]. |
| 36. |
White, N. J.
1992.
Antimalarial drug resistance: the pace quickens.
J. Antimicrob. Chemother.
30:571-585 |
| 37. | White, N. J., and P. L. Olliaro. 1996. Strategies for the prevention of antimalarial drug resistance: rationale for combination chemotherapy for malaria. Parasitol. Today 12:399-401[CrossRef][Medline]. |
| 38. | World Health Organization. 1973. Chemotherapy of malaria and resistance to antimalarials: report of a WHO scientific group. WHO Tech. Rep. Ser. 529. |
| 39. | Zindrou, S., P. D. Nguyen, D. S. Nguyen, O. Skold, and G. Swedberg. 1996. Plasmodium falciparum: mutation pattern in the dihydrofolate reductase-thymidylate synthase genes of Vietnamese isolates, a novel mutation, and coexistence of two clones in a Thai patient. Exp. Parasitol. 84:56-64[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»