Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2001, p. 3162-3170, Vol. 45, No. 11
Departments of
Genetics,1
Microbiology,2 Pharmacology and
Cancer Biology,7 and
Medicine,5 The Howard Hughes Medical
Institute, Duke University Medical Center, Durham, North Carolina
27710; Departments of Biochemistry and Molecular
Biology3 and Microbiology and
Immunology,4 Medical University of South
Carolina, Charleston, South Carolina 29425; and Abbott
Laboratories, Abbott Park, Illinois 600646
Received 23 April 2001/Returned for modification 10 July
2001/Accepted 2 August 2001
Candida albicans and Cryptococcus
neoformans cause both superficial and disseminated infections
in humans. Current antifungal therapies for deep-seated infections are
limited to amphotericin B, flucytosine, and azoles. A limitation is
that commonly used azoles are fungistatic in vitro and in vivo. Our
studies address the mechanisms of antifungal activity of the
immunosuppressive drug rapamycin (sirolimus) and its analogs with
decreased immunosuppressive activity. C. albicans
rbp1/rbp1 mutant strains lacking a homolog of the
FK506-rapamycin target protein FKBP12 were found to be viable and
resistant to rapamycin and its analogs. Rapamycin and analogs
promoted FKBP12 binding to the wild-type Tor1 kinase but not to a
rapamycin-resistant Tor1 mutant kinase (S1972R). FKBP12 and TOR
mutations conferred resistance to rapamycin and its analogs in
C. albicans, C. neoformans, and
Saccharomyces cerevisiae. Our findings demonstrate the
antifungal activity of rapamycin and rapamycin analogs is mediated via
conserved complexes with FKBP12 and Tor kinase homologs in divergent
yeasts. Taken together with our observations that rapamycin and its
analogs are fungicidal and that spontaneous drug resistance occurs at a
low rate, these mechanistic findings support continued investigation of
rapamycin analogs as novel antifungal agents.
Cryptococcus neoformans
and Candida albicans are two common opportunistic fungal
pathogens. Current antifungal agents in clinical use include
amphotericin B, fluconazole, and flucytosine (29), which
have side effects, lack fungicidal activity, or lack activity against
emerging resistant mutants (66). Thus, additional
antifungal agents are needed.
Several new antifungal agents are in development. The candins are
1,3- Rapamycin (sirolimus) is a natural product of the bacterium
Streptomyces hygroscopicus originally discovered in a screen
for antimicrobial activity against C. albicans and later
found to have potent immunosuppressive activity (4,
63). Rapamycin diffuses into the cell and associates with the
peptidyl-prolyl isomerase FKBP12. Rapamycin inhibits FKBP12
enzymatic activity; however, this inhibition is not related to
immunosuppressive or antifungal activity. The targets of the
FKBP12-rapamycin complex are the TOR kinases. Two TOR proteins, Tor1
and Tor2, have been characterized in the yeasts S. cerevisiae and Schizosaccharomyces pombe, and a
single TOR homolog has been identified in C. albicans, C. neoformans, Drosophila melanogaster, and humans
(10, 18, 33, 39, 49, 56, 64). The Tor kinase has been
functionally conserved from yeast to humans (2). Both
immunosuppression in mammalian cells and the toxicity of rapamycin in
S. cerevisiae and C. neoformans are mediated via
FKBP12-dependent inhibition of Tor kinases (12, 18, 33, 34,
41). The FKBP12-rapamycin complex binds to a small region on Tor
(the FKBP12-rapamycin binding domain [FRB domain]) adjacent to the
carboxy-terminal kinase domain (17). Mutations in the FRB
domain prevent FKBP12-rapamycin binding to TOR and confer rapamycin
resistance (12, 15, 18, 34, 41, 59, 69). In addition, TOR
proteins have a toxic effector domain that, when overexpressed, arrests
cell growth (3).
Recent studies in the model yeasts S. cerevisiae
and S. pombe reveal that the Tor kinases function in a
nutrient-sensing pathway (reviewed in reference 54).
Inhibition of Tor signaling by FKBP12-rapamycin induces autophagy
(1, 38, 46), represses ribosomal protein gene expression
(14, 53, 68), induces nitrogen catabolite-repressed genes
(6, 8, 14, 31), and inhibits translation (5, 7). In S. pombe, rapamycin blocks mating in response
to nutrient limitation (65). The Tor2 kinase is
essential in S. pombe and S. cerevisiae, whereas in S. pombe the Tor1 kinase is
required for mating and stationary-phase entry (64). Thus,
the TOR pathway likely serves as a global nutrient-sensing pathway that
will be conserved in pathogenic fungi.
Rapamycin inhibits the growth of several fungi, including C. neoformans, C. albicans, Candida stelloidea,
A. fumigatus, Aspergillus flavus,
Aspergillus niger, Fusarium oxysporum, and
Penicillium sp. (18, 24, 47, 67). We are
interested in FKBP12 and TOR as targets for novel antifungal agents.
The C. albicans RBP1 gene encoding a homolog of the target
protein FKBP12 was previously identified (25). We isolated
C. albicans rbp1/rbp1 and also TOR1-1/TOR1 mutant
strains that were viable and rapamycin resistant. These findings, and
results using the yeast two-hybrid assay, demonstrate that
rapamycin antifungal activity is exerted via FKBP12 and Tor1
homologs in C. albicans. In addition, we analyzed the
antifungal activity of rapamycin analogs with reduced immunosuppressive activity against C. albicans, C. neoformans, and
S. cerevisiae (22). Two analogs retain
antifungal activity in vitro and promote FKBP12-Tor
complexes. Further examination of rapamycin analogs as potential
antifungal agents is warranted.
Media, drugs, and strains
Media were
prepared as previously described (55). 5-Fluoroorotic acid
(5-FOA) medium was prepared as described previously (9) by
using 625 µg of 5-FOA/ml and replacing uracil with 100 µg of
uridine/ml. Rapamycin and its analogs (Abbott Labs) were added to media
or disks from stock solutions in 90% ethanol-10% Tween 20. Strains
used are listed in Table 1.
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.11.3162-3170.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Rapamycin and Less Immunosuppressive Analogs Are
Toxic to Candida albicans and Cryptococcus
neoformans via FKBP12-Dependent Inhibition of TOR
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-glucan synthase inhibitors and are potently active against
Candida species and Aspergillus fumigatus
(23, 40, 51, 52). The pneumocandin caspofungin
acetate-MK-0991 is in phase III clinical trials for candida infections
and has been approved for refractory aspergillosis. Broad-spectrum
triazoles, including voriconazole, posaconazole, and ravuconazole, are
being studied in human trials (50). Combination therapy
with different antifungal agents may also improve therapy (20,
28, 62).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains used in this study
RBP1 insertion-deletion constructs. The RBP1 disruption plasmids pAG70 and pAG71 contain the CaURA3MX3 (30) disruption cassette replacing nucleotides (nt) 40 to 189 of the RBP1 open reading frame (ORF). These plasmids are identical except that the CaURA3MX3 cassettes are in an opposite orientation. The RBP1 disruption plasmids were constructed in three steps. First, the genomic RBP1 locus and ~900 bp of flanking sequence was PCR amplified from the uracil auxotrophic strain YJM126 and subcloned into pGEM-T Easy (Promega), resulting in plasmid pAG54. Next, the NotI insert was subcloned into the NotI site of the yeast-E. coli shuttle vector pRS314 (CEN ARS TRP1 [58]), resulting in plasmid pAG67. Finally, the CaURA3MX3 disruption cassette was subcloned into plasmid pAG67 by in vivo PCR-directed recombination.
Primers. The primers used were as follows: JM37, CCTCGACATCATCTGCCC; PR80, CAAGGAGTCAACCACCACTAAG; PR83, TCTGAGTCTGGGTGTGGGTC; PR92, CAGCACTGGAAGGTATGAGTG; PR103, ATGTCTG AAGAACTTCCACAAATTGAAATTGTTCAAGAAGCAGCTGAAGCTTC GTACGC; PR104, GCACCACCTTTACCATAATTGTTAGTTAAAGAAATATGCATAGGCCACTAGTGGATCTG; PR130, ATGTCTGAAGAACTT CCACAAATTGAAATTGTTCAAGGCATAGGCCACTAGTGGATCTG; PR131, TTAGCACCACCTTTACCATAATTGTTAGTTAAAGAAATATCAGCTGAAGCTTCGTACGC; JOHE2920, GTACGAGAATTCATGTCTGAAGAACTTCCACAA; JOHE2921, GCAACGGGATCCTTATTGACCATTAACACCAAG; JOHE6244, TTTATGGCACGAACAATGGCACGATGCTTTGG AAGATGCTAGCAGGTTTTTCTTTGGTGAACACAACACAGAAAAGAT GTTT; JOHE6245, TTTATGGCACGAACAATGGCACGATGCTTTGGAA GATGCTCGCAGGTTTTTCTTTGGTGAACACAACACAGAAAAGATGT TT; JOHE6246, TTTATGGCACGAACAATGGCACGATGCTTTGGAAGA TGCTATCAGGTTTTTCTTTGGTGAACACAACACAGAAAAGATGTTT; JOHE6247, GGCAAGGTGTTTCTTGAAGC; and JOHE6248, TACTTCTTGATTCGCGATAGC.
PCR conditions. The RBP1 ORF and ~900 nt of flanking genomic DNA was PCR amplified by using primers PR80 and PR83. The 50-µl reaction consisted of 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 0.1% Triton X-100, 100 µg of genomic DNA, 0.5 µM PR80, 0.5 µM PR83, 0.2 mM concentrations of each deoxynucleoside triphosphate (dNTP), and 0.5 U of Vent polymerase (New England Biolabs). DNA amplification was initiated with a 4-min denaturation at 94°C followed by 30 amplification cycles (94°C for 1 min, 55°C for 15 s, and 72°C for 3 min) and was terminated with a 7-min 72°C extension.
The CaURA3MX3 cassettes were PCR amplified for in vivo PCR-directed recombination by using the primer pairs PR103-PR104 (for the forward orientation of the disruption cassette) and PR130-PR131 (for the reverse orientation). These primers amplify the CaURA3MX3 cassette (from plasmid pAG61 [30]) by adding 5'-terminal extensions homologous to nt 1 to 39 (PR103 and PR131) and 190 to 226 (PR102 and PR130) of the RBP1 ORF. Each 100-µl reaction consisted of 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.1 mM MgCl2, 0.1% gelatin, 100 ng of pAG61, 0.5 µM concentrations of each primer, 0.2 µM concentrations of each dNTP, and 2.5 U of REDTAQ DNA Polymerase (Sigma). DNA amplification was initiated with a 3-min 94°C denaturation followed by 30 cycles (94°C for 30 s, 55°C for 10 s, and 72°C for 3 min) and was terminated with a 7-min 72°C extension.RBP1 disruption. The gene disruption cassettes from plasmids pAG70 and pAG71 were PCR amplified as described for the RBP1 locus except that the denaturation time was reduced to 1 min. To disrupt the first RBP1 ORF, the ~3.5-kb PCR product was transformed into C. albicans CAI4 (27) by electroporation (60). Prototrophic transformants were selected on minimal medium (synthetic dextrose [SD]). Homologous disruptants were verified by colony PCR (45) using primers PR92 and JM37 and Southern blotting. A resulting rbp1::CaURA3MX3F/RBP1 strain, YAG116, was chosen.
To select for loss of the CaURA3F ORF in strain YAG116, these cells were grown overnight in rich medium plus uridine, ~105 cells were plated on 5-FOA medium, and 5-FOA-resistant cells were assayed by Southern blotting and colony PCR with primers PR80 and PR92 to verify the loss of the CaURA3 ORF. A resulting rbp1::MX3/RBP1 strain, YAG134, was used for a second round of gene disruption using the RBP1 disruption construct from plasmid pAG71. As above, homologous disruptants were verified by colony PCR with primers PR80 and JM37 and Southern blotting. Strain YAG171 was shown to have the genotype rbp1::MX3/rbp1::CaURA3MX3R (Fig. 1B and C)
|
Mutagenesis of C. albicans TOR1.
C.
albicans TOR1-1 and also TOR1-2 mutant strains (JRB12
and JRB21) were created by transformation of strain SC5314 or BWP17 with 81-mer oligonucleotides designed to carry the wild-type
TOR1 sequence or a single base pair change (A
C or
GT) in the Tor1 FRB domain which result in single amino acid
substitutions (SR or SI) and also disrupt an NheI
restriction site. The wild-type partial sequence of C. albicans Tor1 was found in the Genome Project at Stanford
University. Transformants were selected on yeast
extract-peptone-dextrose (YPD) plates containing 0.1 µg of
rapamycin/ml. Multiple resistant isolates were obtained with the
mutagenic oligonucleotides, whereas none were obtained with the
wild-type oligonucleotide. These mutants were not cross-resistant to
FK506 plus fluconazole and are therefore not rbp1/rbp1
mutants. Homologous recombination was verified by colony PCR with
primers JOHE 6247 and JOHE 6248, followed by digestion of the 1.5-kb
PCR product with the restriction enzyme NheI. The presence
of a 1.5-kb uncleaved fragment indicated the presence of the mutant
TOR1-1 allele. Genomic DNA flanking the TOR1 and TOR1-1 alleles was isolated by PCR from genomic DNA from
strain JRB12 and cloned, and restriction digestion with NheI
and sequence analysis of multiple clones revealed five wild-type and
six mutant alleles of the eleven analyzed. A similar analysis of the
wild-type TOR1 strain SC5314 yielded six wild-type and no
mutant TOR1 sequences.
Two-hybrid assays.
The yeast S. cerevisiae
two-hybrid strain used was SMY4 (Y190 TOR1-3 fpr1::ADE2)
(16). The two-hybrid fusion plasmids used were pGAD424 and
pGBT9 (26). The C. albicans RBP1 gene was fused to the GAL4 activation domain [GAL4(AD)] in plasmid pGAD424. First, the RBP1 gene was amplified with primers JOHE2920 and
JOHE2921 by using plasmid pAG54 as a template. The PCR product was
cleaved with EcoRI and BamHI and cloned in the
corresponding sites in plasmid pGAD424, yielding plasmid pMCC4.
Plasmids pML80 (TOR1) and pML82 (TOR1-1) expressing the S. cerevisiae TOR1 gene or the TOR1-1 mutant allele,
respectively, fused to the GAL4 DNA-binding domain [GAL4(BD)] in
plasmid pGBT9 were as described previously (41). Plasmids
expressing the GAL4(BD)-C. neoformans TOR1 FRB domain, the GAL4(BD)-C. neoformans TOR1-1
mutant FRB domain, and the GAL4(AD)-C. neoformans FKBP12
were as described previously (18). The two-hybrid strain
SMY4 was cotransformed with the two-hybrid fusion plasmids, cells were
grown on SD-Leu-Trp synthetic medium, and the -galactosidase
activity was assayed by using the chromogenic substrate
chlorophenol--D-galactopyranoside (CPRG) (16). For two-hybrid growth assays, cells were resuspended
in top agar (0.7% Bacto agar in water) on the surface of synthetic SD-Leu-Trp-His medium with 10 mM 3-aminotriazole. Disks without or with 1 µg of rapamycin or an analog were placed on the
surface, and cells were incubated for 2 to 3 days at 30°C. Colony
formation indicated GAL4-dependent expression of the
GAL-HIS3 reporter gene fusion by FKBP12-ligand-TOR interactions.
Growth inhibition assays.
C. albicans, C. neoformans, or S. cerevisiae cells were cultured in YPD
liquid medium overnight, and ~106 cells were
resuspended in 3 ml of top agar (0.7% Bacto agar in water), which was
poured onto the surface of YPD medium (90-mm plates) and allowed to
solidify. Disks without or with 1 µg of rapamycin or an analog were
placed on the surface. Cultures were incubated for 24 to 36 h at
30°C. Experiments to determine MICs and minimal fungicidal
concentrations (MFCs) were performed by the broth microdilution method
according to the recommendations of the National Committee for Clinical
Laboratory Standards (NCCLS) (44). The optical density at
600 nm (OD600) was measured with a Beckman
spectrophotometer after incubation for 48 h (C. albicans) or 72 h (C. neoformans) at 30°C. The
MIC was defined as the lowest drug concentration in which a visual
turbidity of 
80% inhibition was observed compared to that produced
by the growth control. The MFC was determined as previously described
(21). Briefly, 100-µl aliquots from wells with growth
inhibition were plated onto Sabouraud agar plates. The lowest
concentration that yielded three or fewer colonies was recorded as the MFC.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Disruption of the C. albicans RBP1
genes by homologous recombination.
S. cerevisiae cells
treated with rapamycin irreversibly arrest growth, and the effect of
rapamycin is mediated by the prolyl-isomerase FKBP12 (33).
The FKBP12-rapamycin complex binds to and inhibits the TOR kinases, and
strains that lack FKBP12 are viable and rapamycin resistant
(33). The human pathogenic yeast C. albicans is markedly sensitive to rapamycin
(63). We found that rapamycin has fungicidal activity
(Table 2), and in a standard
Luria-Delbrück fluctuation test the spontaneous rate of rapamycin
resistance was found to be low (~1 in 108
cells). The presumed target of rapamycin in this fungus is the FKBP12
homolog encoded by the RBP1 gene (25). To test
this hypothesis, a homozygous rbp1/rbp1 mutant strain was
constructed.
|
::CaURA3MX3 allele in the forward
orientation (Fig. 1A) was PCR amplified and electroporated into
the ura3/ura3 strain CAI4 to generate the
rbp1::CaURA3MXF/RBP1 heterozygous mutant strain,
YAG116. To reuse the CaURA3MX3 cassette for the second round
of gene deletion, the rbp1/RBP1 YAG116 cells were treated with 5-FOA to select for loss of the URA3 ORF by
recombination of the flanking direct repeats (designated as
MX3). A 5-FOA resistant, uracil auxotrophic
rbp1::MX3/RBP1 strain, YAG134, was transformed with the
rbp1::CaURA3MX3 allele in the reverse orientation (Fig. 1A), resulting in the homozygous rbp1/rbp1 mutant
YAG171. The genotypes of wild-type (CAI4), rbp1/RBP1
heterozygous (YAG116 and YAG134), and
rbp1/rbp1 homozygous (YAG171) strains were verified by
both colony PCR (Fig. 1B) and Southern blotting (Fig. 1C).
C. albicans FKBP12 homolog Rbp1 is required
for rapamycin antifungal action.
The FKBP12 homolog Rbp1 was
found to mediate rapamycin action in C. albicans. The
wild-type RBP1/RBP1 parental strain and the
rbp1/RBP1 heterozygous mutant were sensitive to inhibition by rapamycin, whereas the rbp1/rbp1 homozygous mutant was
rapamycin resistant (Fig. 2A). The
rbp1/RBP1 heterozygous strain readily gave rise to
rapamycin-resistant colonies. Consistent with the interpretation that
these isolates arise from spontaneous homozygosis that produces
rbp1/rbp1 mutants by mitotic recombination, these isolates
were prototrophic, cross-resistant to another drug that targets Rbp1
(FK506 plus fluconazole), and the majority lacked the wild-type
RBP1 gene by PCR analysis. In summary, the FKBP12 homolog
Rbp1 mediates rapamycin antifungal activity against C. albicans.
|
C. albicans TOR1-1 mutation confers rapamycin resistance. To test if the Tor1 kinase is the target of the FKBP12-rapamycin complex, two different point mutations were introduced into the FRB domain of C. albicans Tor1 to result in an amino acid substitution (serine to isoleucine or arginine) at a serine residue implicated in rapamycin-FKBP12 binding to fungal and mammalian Tor proteins (11, 12, 15, 17, 18, 34, 41, 59, 69). These amino acid substitutions were introduced into the C. albicans TOR1 gene by transformation with a single-stranded mutagenic 80-mer oligonucleotide and selection on rapamycin-containing medium. PCR amplification with primers flanking the site of mutation and digestion with NheI (a site present in wild-type TOR1 is destroyed by the introduced mutation) revealed that both wild-type TOR1 and the TOR1-1 or TOR1-2 mutant allele were present (Fig. 2C and data not shown). The PCR products for strain JRB12 (TOR1-1/TOR1) were cloned; of 11 clones, 5 were digested by NheI and contained the wild-type TOR1 sequence, whereas 6 were NheI resistant and contained the mutant sequence. The resulting heterozygous TOR1-1/TOR1 (JRB12) and TOR1-2/TOR1 (JRB21) cells were viable and rapamycin resistant, indicating that the Tor1 kinase is the target of the Rbp1-rapamycin complex and that the TOR1-1 and TOR1-2 mutations confer dominant drug resistance (Fig. 2A).
C. albicans FKBP12 homolog binds to wild-type Tor1
but not to a Tor1-1 mutant.
The yeast two-hybrid system was used
to test whether the C. albicans FKBP12 homolog Rbp1
interacts with the Tor1 protein. Protein-drug-protein
interactions were monitored by measuring -galactosidase expression
from a GAL-lacZ reporter gene (Fig. 2D). Rapamycin-dependent
interactions were detected between wild-type S. cerevisiae
Tor1 and the C. albicans FKBP12 homolog Rbp1. In contrast,
the S. cerevisiae rapamycin-resistant Tor1-1 S1972R mutant protein failed to interact with FKBP12-rapamycin (Fig. 2D). The
S1972R mutation does not affect the stability of the Tor1-1 mutant as
previously reported (41). Thus, the S1972R mutation
prevents the formation of the FKBP12-rapamycin-TOR complex. These
findings indicate that the C. albicans FKBP12 homolog Rbp1 forms a complex with rapamycin that interacts with the TOR kinase at
the FRB domain in vivo.
Nonimmunosuppressive rapamycin analogs are toxic to
C. albicans, C. neoformans, and
S. cerevisiae via FKBP12-dependent inhibition
of TOR.
Previously, several rapamycin derivatives were prepared,
and their immunosuppressive and antifungal activities were determined (22). Analog 2 is
1,2,3,4- tetrahydro-rapamycin. Analogs 18 [(S)-2-methyl-thienyl], 19 [(S)-NOHCOOibu],
and 23 [(S)-NOHCON-piperidyl] are 7-substituted rapamycin analogs. We assessed the fungal activities of these rapamycin analogs with diminished immunosuppressive activities by
determining MICs and MFCs using the NCCLS criteria, as well as a drug
diffusion assay. Analog 2 was fungicidal to wild-type C. albicans, C. neoformans, and S. cerevisiae but not to
the isogenic FKBP12 or TOR mutants (Fig.
3, Table 2). Analog 23 was
also toxic and fungicidal to C. albicans and
C. neoformans via FKBP12-dependent inhibition of Tor but
showed no activity against S. cerevisiae (Fig. 3). Analogs
18 and 19 were weakly toxic to C. neoformans in the drug
diffusion assay (Fig. 3B); however, the MIC was >100 µg/ml (Table
2). Analogs 18 and 19 had no activity against either C. albicans or S. cerevisiae (Fig. 3A and C; Table 2). In
summary, analogs 2 and 23 are the most toxic to C. neoformans and C. albicans, and they share a common
mechanism of antifungal action with rapamycin involving
FKBP12-dependent inhibition of Tor kinases.
|
) or with 1 µg of
rapamycin (R) or analogs 2, 18, 19, and 23 were placed on the surface
of the medium and incubated for 24 to 36 h at 30°C.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The identification of novel drug targets is of great importance in the field of medical mycology. We have previously demonstrated that rapamycin is toxic to C. neoformans via FKBP12-rapamycin inhibition of the Tor1 kinase (18). Here we assessed the antifungal activities and mechanisms of action of rapamycin and its analogs with diminished immunosuppressive activities against C. neoformans and C. albicans.
We established that rapamycin and two less immunosuppressive analogs are toxic to C. neoformans and C. albicans via FKBP12-dependent inhibition of Tor1. First, we constructed a C. albicans rbp1/rbp1 mutant by a sequential two-step method by using two different rbp1::URA3 disruption alleles in which the marker gene was in opposite orientations. Second, point mutations were introduced into the FRB domain of the C. albicans Tor1 homolog by transformation with mutagenic 80-mer oligonucleotides. Both classes of mutants are resistant to rapamycin and its analogs, indicating that antifungal activity is mediated via binding to the C. albicans FKBP12 homolog Rbp1 and Tor1. Third, rapamycin promoted interactions between the C. albicans FKBP12 homolog and wild-type S. cerevisiae Tor1 in the two-hybrid assay. Rapamycin analogs 2 and 23 also promoted strong interactions between the cryptococcal FKBP12 and Tor1 homologs. Our studies extend the understanding of the conserved antifungal mechanism of action of rapamycin and its analogs from the basidiomycete C. neoformans to the ascomycetous human pathogen C. albicans.
Although analogs 2 and 23, with the highest toxicity to C. neoformans and C. albicans, can only achieve <50% of the antifungal activity of rapamycin itself, they were previously found to be ~1,000-fold less immunosuppressive than rapamycin in a human T-cell proliferation assay (22). Additional work is warranted to develop or to test existing rapamycin analogs (42) with a greater selective toxicity for lower eukaryotes. There is a clear advantage for the use of analogs of known immunosuppressive drugs, such as rapamycin, since there is a wealth of structural, molecular, and pharmacological information on the activity of these compounds (13, 37, 57). Rapamycin was approved by the Food and Drug Administration as an immunosuppressant for renal transplant recipients in August 1999. New studies are investigating the efficacy of using rapamycin alone or in combination with FK506 and cyclosporine A in other transplant conditions. Interestingly, we have found previously that cyclosporine A and FK506, and also analogs of these compounds with reduced or no immunosuppressive activity, are toxic to C. neoformans (19, 48). Additional advantages of rapamycin and its analogs are their oral activity, fungicidal activity, and the fact that spontaneous drug resistance is infrequent in vitro.
The use of rapamycin as an antifungal agent in an in vivo setting was reported by earlier studies wherein rapamycin was found to protect 50% of mice from an otherwise-lethal infection with C. albicans (4) and to improve the survival of mice with invasive aspergillosis (35, 36). These studies and our findings suggest that patients receiving rapamycin may benefit from both the immunosuppressive and the antifungal activities of rapamycin. It remains to be tested if rapamycin or its analogs with decreased immunosuppressive activity confer a beneficial effect in animal models of candidiasis and cryptococcal meningitis or in transplant recipients currently receiving rapamycin.
| |
ACKNOWLEDGMENTS |
|---|
We thank Christina Hull for comments. Strain SGY243 (YJM126) was obtained from Squibb and strain BWP17 was obtained from Aaron Mitchell.
These studies were supported by R01 grant AI41937 (to J.H., M.E.C., and J.R.P.) and a supplement (to M.C.C.) from the NIAID, by P01 grant AI44975 from the NIAID to the Duke University Mycology Unit, and in part by MUCU grant 21363 (to M.D.). Alan Goldstein is supported by the DUMC interdisciplinary training program in AIDS-NIAID T32-AI07392-10. Maria E. Cardenas is supported by K01 award CA77075 from the NCI. Joseph Heitman is a Burroughs-Wellcome Scholar in Molecular Pathogenic Mycology and an associate investigator of the Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Box 3546, 322 CARL Bldg., Research Dr., Duke University Medical Center, Durham, NC 27710. Phone: (919) 684-2824. Fax: (919) 684-5458. E-mail: heitm001{at}duke.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Abeliovich, H.,
J. W. A. Dunn,
J. Kim, and D. J. Klionsky.
2000.
Dissection of autophagosome biogenesis into distinct nucleation and expansion steps.
J. Cell Biol.
151:1025-1034 |
| 2. |
Alarcon, C. M.,
M. E. Cardenas, and J. Heitman.
1996.
Mammalian RAFT1 kinase domain provides rapamycin-sensitive. TOR function in yeast.
Genes Dev.
10:279-288 |
| 3. |
Alarcon, C. M.,
J. Heitman, and M. E. Cardenas.
1999.
Protein kinase activity and identification of a toxic effector domain of the target of rapamycin TOR proteins in yeast.
Mol. Biol. Cell
10:2531-2546 |
| 4. | Baker, H., A. Sidorowicz, S. N. Sehgal, and C. Venzina. 1978. Rapamycin (AY-22,989), a new antifungal antibiotic. III. In vitro and in vivo evaluation. J. Antibiot. 31:539-545[Medline]. |
| 5. | Barbet, N. C., U. Schneider, S. B. Helliwell, I. Stansfield, M. F. Tuite, and M. N. Hall. 1996. TOR controls translation initiation and early G1 progression in yeast. Mol. Biol. Cell 7:25-42[Abstract]. |
| 6. | Beck, T., and M. N. Hall. 1999. The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402:689-692[CrossRef][Medline]. |
| 7. |
Berset, C.,
H. Trachsel, and M. Altmann.
1998.
The TOR (target of rapamycin) signal transduction pathway regulates the stability of translation initiation factor eIF4G in the yeast Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
95:4264-4269 |
| 8. |
Bertram, P. G.,
J. H. Choi,
J. Carvalho,
W. Ai,
C. Zeng,
T. F. Chan, and X. F. Zheng.
2000.
Tripartite regulation of Gln3p by TOR, Ure2p and phosphatases.
J. Biol. Chem.
275:35727-35733 |
| 9. | Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline]. |
| 10. | Brown, E. J., M. W. Albers, T. B. Shin, K. Ichikawa, C. T. Keith, W. S. Lane, and S. L. Schreiber. 1994. A mammalian protein targeted by G1-arresting rapamycin-receptor complex. Nature 369:756-759[CrossRef][Medline]. |
| 11. | Brown, E. J., P. A. Beal, C. T. Keith, J. Chen, T. B. Shin, and S. L. Schreiber. 1995. Control of p70 S6 kinase by kinase activity of FRAP in vivo. Nature 377:441-446[CrossRef][Medline]. |
| 12. |
Cafferkey, R.,
P. R. Young,
M. M. McLaughlin,
D. J. Bergsma,
Y. Koltin,
G. M. Sathe,
L. Faucette,
W.-K. Eng,
R. K. Johnson, and G. P. Livi.
1993.
Dominant missense mutations in a novel yeast protein related to mammalian phosphatidylinositol 3-kinase and VPS34 abrogate rapamycin cytotoxicity.
Mol. Cell. Biol.
13:6012-6023 |
| 13. |
Cardenas, M. E.,
M. C. Cruz,
M. D. Poeta,
N. Chung,
J. R. Perfect, and J. Heitman.
1999.
Antifungal activities of antineoplastic agents: Saccharomyces cerevisiae as a model system to study drug action.
Clin. Microbiol. Rev.
12:583-611 |
| 14. |
Cardenas, M. E.,
N. S. Cutler,
M. C. Lorenz,
C. J. Di Como, and J. Heitman.
1999.
The TOR signaling cascade regulates gene expression in response to nutrients.
Genes Dev.
13:3271-3279 |
| 15. | Cardenas, M. E., and J. Heitman. 1995. FKBP12-rapamycin target TOR2 is a vacuolar protein with an associated phosphatidylinositol-4 kinase activity. EMBO J. 14:5892-5907[Medline]. |
| 16. | Cardenas, M. E., C. Hemenway, R. S. Muir, R. Ye, D. Fiorentino, and J. Heitman. 1994. Immunophilins interact with calcineurin in the absence of exogenous immunosuppressive ligands. EMBO J. 13:5944-5957[Medline]. |
| 17. | Choi, J., J. Chen, S. L. Schreiber, and J. Clardy. 1996. Structure of the FKBP12-rapamycin complex interacting with the binding domain of human FRAP. Science 273:239-242[Abstract]. |
| 18. |
Cruz, M. C.,
L. M. Cavallo,
J. M. Görlach,
G. Cox,
J. R. Perfect,
M. E. Cardenas, and J. Heitman.
1999.
Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans.
Mol. Cell. Biol.
19:4101-4112 |
| 19. |
Cruz, M. C.,
M. D. Poeta,
P. Wang,
R. Wenger,
G. Zenke,
V. F. J. Quesniaux,
N. R. Movva,
J. R. Perfect,
M. E. Cardenas, and J. Heitman.
2000.
Immunosuppressive and nonimmunosuppressive cyclosporin analogs are toxic to the opportunistic fungal pathogen Cryptococcus neoformans via cyclophilin dependent inhibition of calcineurin.
Antimicrob. Agents Chemother.
44:143-149 |
| 20. |
Del Poeta, M.,
M. C. Cruz,
M. E. Cardenas,
J. R. Perfect, and J. Heitman.
2000.
Synergistic antifungal activities of bafilomycin A(1), fluconazole, and the pneumocandin MK-0991/caspofungin acetate (L-743,873) with calcineurin inhibitors FK506 and L-685,818 against Cryptococcus neoformans.
Antimicrob. Agents Chemother.
44:739-746 |
| 21. |
Del Poeta, M.,
W. A. Schell,
C. C. Dykstra,
S. Jones,
R. R. Tidwell,
A. Czarny,
M. Bajic,
M. Bajic,
A. Kumar,
D. Boykin, and J. R. Perfect.
1998.
Structure: in vitro activity relationships of pentamidine analogues and dication-substituted bis-benzimidazoles as new antifungal agents.
Antimicrob. Agents Chemother.
42:2495-2502 |
| 22. | Dickman, D. A., H. Ding, Q. Li, A. M. Nilius, D. J. Balli, S. J. Ballaron, J. M. Trevillyan, M. L. Smith, L. S. Seif, K. Kim, A. Sarthy, R. C. Goldman, J. J. Plattner, and Y. L. Bennani. 2000. Antifungal rapamycin analogues with reduced immunosuppressive activity. Bioorg. Med. Chem. Lett. 10:1405-1408[CrossRef][Medline]. |
| 23. |
Douglas, C. M.,
J. A. D'Ippolito,
G. J. Shei,
M. Meinz,
J. Onishi,
J. A. Marrinan,
W. Li,
G. Abruzzo,
A. Flattery,
K. Bartizal,
A. Mitchell, and M. B. Kurtz.
1997.
Identification of the FKS1 gene of Candida albicans as the essential target of 1,3--D-glucan synthase inhibitors.
Antimicrob. Agents Chemother.
41:2471-2479 |
| 24. | Fang, A., G. K. Wong, and A. L. Demain. 2000. Enhancement of the antifungal activity of rapamycin by the coproduced elaiophylin and nigericin. J. Antibiot. 53:158-162[Medline]. |
| 25. | Ferrara, A., R. Cafferkey, and G. P. Livi. 1992. Cloning and sequence analysis of a rapamycin-binding protein-encoding gene (RBP1) from Candida albicans. Gene 113:125-127[CrossRef][Medline]. |
| 26. | Fields, S. 1993. The two-hybrid system to detect protein-protein interactions. Methods Enzymol. 5:116-124. |
| 27. | Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728[Abstract]. |
| 28. |
Franzot, S. P., and A. Casadevall.
1997.
Pneumocandin L-743,872 enhances the activities of amphotericin B and fluconazole against Cryptococcus neoformans in vitro.
Antimicrob. Agents Chemother.
41:331-336 |
| 29. |
Georgopapadakou, N. H., and T. J. Walsh.
1996.
Antifungal agents: chemotherapeutic targets and immunologic strategies.
Antimicrob. Agents Chemother.
40:279-291 |
| 30. | Goldstein, A. L., X. Pan, and J. H. McCusker. 1999. Heterologous URA3MX cassettes for gene replacement in Saccharomyces cerevisiae. Yeast 15:507-511[CrossRef][Medline]. |
| 31. |
Hardwick, J. S.,
F. G. Kuruvilla,
J. K. Tong,
A. F. Shamji, and S. L. Schreiber.
1999.
Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins.
Proc. Natl. Acad. Sci. USA
96:14866-14870 |
| 32. | Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[CrossRef][Medline]. |
| 33. |
Heitman, J.,
N. R. Movva, and M. N. Hall.
1991.
Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast.
Science
253:905-909 |
| 34. | Helliwell, S. B., P. Wagner, J. Kunz, M. Deuter-Reinhard, R. Henriquez, and M. N. Hall. 1994. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast. Mol. Biol. Cell 5:105-118[Abstract]. |
| 35. | High, K. P. 1994. The antimicrobial activities of cyclosporine, FK506, and rapamycin. Transplantation 57:1689-1700[Medline]. |
| 36. | High, K. P., and R. G. Washburn. 1997. Invasive aspergillosis in mice immunosuppressed with cyclosporin A, tacrolimus (FK506), or sirolimus (rapamycin). J. Infect. Dis. 175:222-225[Medline]. |
| 37. | Ingle, G. R., T. M. Sievers, and C. D. Holt. 2000. Sirolimus: continuing the evolution of transplant immunosuppression. Ann. Pharmacother. 34:1044-1055[Abstract]. |
| 38. |
Kamada, Y.,
T. Funakoshi,
T. Shintani,
K. Nagano,
M. Ohsumi, and Y. Ohsumi.
2000.
Tor-mediated induction of autophagy via an Apg1 protein kinase complex.
J. Cell Biol.
150:1507-1513 |
| 39. | Kunz, J., R. Henriquez, U. Schneider, M. Deuter-Reinhard, N. R. Movva, and M. N. Hall. 1993. Target of rapamycin in yeast, TOR2, is an essential phosphatidylinositol kinase homolog required for G1 progression. Cell 73:585-596[CrossRef][Medline]. |
| 40. |
Kurtz, M. B.,
E. M. Bernard,
F. F. Edwards,
C. M. Douglas,
J. A. Marrinan,
J. Dropinski, and D. Armstrong.
1995.
Aerosol and parenteral pneumocandins are effective in a rat model of pulmonary Aspergillosis.
Antimicrob. Agents Chemother.
39:1784-1789 |
| 41. |
Lorenz, M. C., and J. Heitman.
1995.
TOR mutations confer rapamycin resistance by preventing interaction with FKBP12-rapamycin.
J. Biol. Chem.
270:27531-27537 |
| 42. | Luengo, J. I., D. S. Yamashita, D. Dunnington, A. K. Beck, L. W. Rozamus, H.-K. Yen, M. J. Bossard, M. A. Levy, A. Hand, T. Newman-Tarr, A. Badger, L. Faucette, R. K. Johnson, K. D'Alessio, T. Porter, A. Y. L. Shu, R. Heys, J. Choi, P. Kongsaeree, J. Clardy, and D. A. Holt. 1995. Structure-activity studies of rapamycin analogs: evidence that the C-7 methoxy group is part of the effector domain and positioned at the FKBP12-FRAP interface. Chem. Biol. 2:471-481[CrossRef][Medline]. |
| 43. |
Moore, T. D. E., and J. C. Edman.
1993.
The  -mating type locus of Cryptococcus neoformans contains a peptide pheromone gene.
Mol. Cell. Biol.
13:1962-1970 |
| 44. | National Committee for Clinical Laboratory Standards. 1997. Reference method for broth dilution antifungal susceptibility testing of yeast. Approved standard M27-A. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 45. | Niedenthal, R. K., L. Riles, M. Johnston, and J. H. Hegemann. 1996. Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast. Yeast 12:773-786[CrossRef][Medline]. |
| 46. |
Noda, T., and Y. Ohsumi.
1998.
TOR, a phosphatidylinositol kinase homologue, controls autophagy in yeast.
J. Biol. Chem.
273:3963-3966 |
| 47. | Odom, A., S. Muir, E. Lim, D. L. Toffaletti, J. Perfect, and J. Heitman. 1997. Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J. 16:2576-2589[CrossRef][Medline]. |
| 48. |
Odom, A.,
M. D. Poeta,
J. Perfect, and J. Heitman.
1997.
The immunosuppressant FK506 and its nonimmunosuppressive analog L-685,818 are toxic to Cryptococcus neoformans by inhibition of a common target protein.
Antimicrob. Agents Chemother.
41:156-161 |
| 49. |
Oldham, S.,
J. Montagne,
T. Radimerski,
G. Thomas, and E. Hafen.
2000.
Genetic and biochemical characterization of dTOR, the Drosophila homolog of the target of rapamycin.
Genes Dev.
14:2689-2694 |
| 50. | Patterson, T. F. 1999. Role of newer azoles in surgical patients. J. Chemother. 11:504-512[Medline]. |
| 51. |
Petraitiene, R.,
V. Petraitis,
A. H. Groll,
M. Candelario,
T. Sein,
A. Bell,
C. A. Lyman,
C. L. McMillian,
J. Bacher, and T. J. Walsh.
1999.
Antifungal activity of LY303366, a novel echinocandin B, in experimental disseminated candidiasis in rabbits.
Antimicrob. Agents Chemother.
43:2148-2155 |
| 52. |
Petraitis, V.,
R. Petraitiene,
A. H. Groll,
A. Bell,
D. P. Callender,
T. Sein,
R. L. Schaufele,
C. L. McMillian,
J. Bacher, and T. J. Walsh.
1998.
Antifungal efficacy, safety, and single-dose pharmacokinetics of LY303366, a novel echinocandin B, in experimental pulmonary aspergillosis in persistently neutropenic rabbits.
Antimicrob. Agents Chemother.
42:2898-2905 |
| 53. |
Powers, T., and P. Walter.
1999.
Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae.
Mol. Biol. Cell
10:987-1000 |
| 54. |
Rohde, J.,
J. Heitman, and M. E. Cardenas.
2001.
The Tor kinases link nutrient sensing to cell growth.
J. Biol. Chem.
276:9583-9586 |
| 55. | Rose, M. D., F. Winston, and P. Hieter. 1988. Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 56. | Sabatini, D. M., H. Erdjument-Bromage, M. Lui, P. Tempst, and S. H. Snyder. 1994. RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78:35-43[CrossRef][Medline]. |
| 57. | Saunders, R. N., M. S. Metcalfe, and M. L. Nicholson. 2001. Rapamycin in transplantation: a review of the evidence. Kidney Int. 59:3-16[CrossRef][Medline]. |
| 58. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 59. |
Stan, R.,
M. M. McLaughlin,
R. T. Cafferkey,
R. K. Johnson,
M. Rosenberg, and G. P. Livi.
2030.
1994. Interaction between FKBP12-rapamycin and TOR involves a conserved serine residue.
J. Biol. Chem.
269:32027-32033 |
| 60. | Thompson, J. R., E. Register, J. Curotto, M. Kurtz, and R. Kelly. 1998. An improved protocol for the preparation of yeast cells for transformation by electroporation. Yeast 14:565-571[CrossRef][Medline]. |
| 61. |
Toffaletti, D. L.,
T. H. Rude,
S. A. Johnston,
D. T. Durack, and J. R. Perfect.
1993.
Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA.
J. Bacteriol.
175:1405-1411 |
| 62. |
van der Horst, C. M.,
M. S. Saag,
G. A. Cloud,
R. J. Hamill,
J. R. Graybill,
J. D. Sobel,
P. C. Johnson,
C. U. Tuazon,
T. Kerkering,
B. L. Moskovitz,
W. G. Powderly, and W. E. Dismukes.
1997.
Treatment of Cryptococcal meningitis associated with the acquired immunodeficiency syndrome.
N. Engl. J. Med.
337:15-21 |
| 63. | Vezina, C., A. Kudelski, and S. N. Sehgal. 1975. Rapamycin (AY-22,989), a new antifungal antibiotic. I. Taxonomy of the producing Streptomycete and isolation of the active principle. J. Antibiot. 28:721-726[Medline]. |
| 64. |
Weisman, R., and M. Choder.
2001.
The fission yeast TOR homolog, tor1+, is required for the response to starvation and other stresses via a conserved serine.
J. Biol. Chem.
276:7027-7032 |
| 65. |
Weisman, R.,
M. Choder, and Y. Koltin.
1997.
Rapamycin specifically interferes with the developmental response of fission yeast to starvation.
J. Bacteriol.
179:6325-6334 |
| 66. |
White, T. C.,
K. A. Marr, and R. A. Bowden.
1998.
Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.
Clin. Microbiol. Rev.
11:382-402 |
| 66a. |
Wilson, R. B.,
D. Davis, and A. P. Mitchell.
1999.
Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.
J. Bacteriol.
181:1868-1874 |
| 67. | Wong, G. K., S. Griffith, I. Kojima, and A. L. Demain. 1998. Antifungal activities of rapamycin and its derivatives, prolylrapamycin, 32-desmethylrapamycin, and 32-desmethoxyrapamycin. J. Antibiot. 51:487-491[Medline]. |
| 68. |
Zaragoza, D.,
A. Ghavidel,
J. Heitman, and M. C. Schultz.
1998.
Rapamycin induces the G0 program of transcriptional repression in yeast by interfering with the TOR signaling pathway.
Mol. Cell. Biol.
18:4463-4470 |
| 69. | Zheng, X.-F., D. Fiorentino, J. Chen, G. R. Crabtree, and S. L. Schreiber. 1995. TOR kinase domains are required for two distinct functions, only one of which is inhibited by rapamycin. Cell 82:121-130[CrossRef][Medline]. |
Antimicrobial Agents and Chemotherapy, November 2001, p. 3162-3170, Vol. 45, No. 11
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.11.3162-3170.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fuchs, B. B., Mylonakis, E.
(2009). Our Paths Might Cross: the Role of the Fungal Cell Wall Integrity Pathway in Stress Response and Cross Talk with Other Stress Response Pathways. Eukaryot Cell
8: 1616-1625
[Abstract] [Full Text] -
Dannaoui, E., Schwarz, P., Lortholary, O.
(2009). In Vitro Interactions between Antifungals and Immunosuppressive Drugs against Zygomycetes. Antimicrob. Agents Chemother.
53: 3549-3551
[Abstract] [Full Text] -
Toenjes, K. A., Stark, B. C., Brooks, K. M., Johnson, D. I.
(2009). Inhibitors of cellular signalling are cytotoxic or block the budded-to-hyphal transition in the pathogenic yeast Candida albicans. J Med Microbiol
58: 779-790
[Abstract] [Full Text] -
Uppuluri, P., Nett, J., Heitman, J., Andes, D.
(2008). Synergistic Effect of Calcineurin Inhibitors and Fluconazole against Candida albicans Biofilms. Antimicrob. Agents Chemother.
52: 1127-1132
[Abstract] [Full Text] -
Kontoyiannis, D. P., Lewis, R. E., Alexander, B. D., Lortholary, O., Dromer, F., Gupta, K. L., John, G. T., del Busto, R., Klintmalm, G. B., Somani, J., Lyon, G. M., Pursell, K., Stosor, V., Munoz, P., Limaye, A. P., Kalil, A. C., Pruett, T. L., Garcia-Diaz, J., Humar, A., Houston, S., House, A. A., Wray, D., Orloff, S., Dowdy, L. A., Fisher, R. A., Heitman, J., Albert, N. D., Wagener, M. M., Singh, N.
(2008). Calcineurin Inhibitor Agents Interact Synergistically with Antifungal Agents In Vitro against Cryptococcus neoformans Isolates: Correlation with Outcome in Solid Organ Transplant Recipients with Cryptococcosis. Antimicrob. Agents Chemother.
52: 735-738
[Abstract] [Full Text] -
Stie, J., Fox, D.
(2008). Calcineurin Regulation in Fungi and Beyond. Eukaryot Cell
7: 177-186
[Full Text] -
Sugita, T., Tajima, M., Ito, T., Saito, M., Tsuboi, R., Nishikawa, A.
(2005). Antifungal Activities of Tacrolimus and Azole Agents against the Eleven Currently Accepted Malassezia Species. J. Clin. Microbiol.
43: 2824-2829
[Abstract] [Full Text] -
Ren, P., Rossettini, A., Chaturvedi, V., Hanes, S. D.
(2005). The Ess1 prolyl isomerase is dispensable for growth but required for virulence in Cryptococcus neoformans. Microbiology
151: 1593-1605
[Abstract] [Full Text] -
Steinbach, W. J., Singh, N., Miller, J. L., Benjamin, D. K. Jr., Schell, W. A., Heitman, J., Perfect, J. R.
(2004). In Vitro Interactions between Antifungals and Immunosuppressants against Aspergillus fumigatus Isolates from Transplant and Nontransplant Patients. Antimicrob. Agents Chemother.
48: 4922-4925
[Abstract] [Full Text] -
Steinbach, W. J., Schell, W. A., Blankenship, J. R., Onyewu, C., Heitman, J., Perfect, J. R.
(2004). In Vitro Interactions between Antifungals and Immunosuppressants against Aspergillus fumigatus. Antimicrob. Agents Chemother.
48: 1664-1669
[Abstract] [Full Text] -
Gupta, S. S., Ton, V.-K., Beaudry, V., Rulli, S., Cunningham, K., Rao, R.
(2003). Antifungal Activity of Amiodarone Is Mediated by Disruption of Calcium Homeostasis. J. Biol. Chem.
278: 28831-28839
[Abstract] [Full Text] -
Onyewu, C., Blankenship, J. R., Del Poeta, M., Heitman, J.
(2003). Ergosterol Biosynthesis Inhibitors Become Fungicidal when Combined with Calcineurin Inhibitors against Candida albicans, Candida glabrata, and Candida krusei. Antimicrob. Agents Chemother.
47: 956-964
[Abstract] [Full Text] -
Kontoyiannis, D. P., Lewis, R. E., Osherov, N., Albert, N. D., May, G. S.
(2003). Combination of caspofungin with inhibitors of the calcineurin pathway attenuates growth in vitro in Aspergillus species. J Antimicrob Chemother
51: 313-316
[Abstract] [Full Text] -
Crespo, J. L., Hall, M. N.
(2002). Elucidating TOR Signaling and Rapamycin Action: Lessons from Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
66: 579-591
[Abstract] [Full Text] -
Cutler, N. S., Pan, X., Heitman, J., Cardenas, M. E.
(2001). The TOR Signal Transduction Cascade Controls Cellular Differentiation in Response to Nutrients. Mol. Biol. Cell
12: 4103-4113
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»