Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, November 2001, p. 3246-3249, Vol. 45, No. 11
Rowett Research Institute, Bucksburn,
Aberdeen, United Kingdom AB21 9SB
Received 15 February 2001/Returned for modification 26 April
2001/Accepted 14 August 2001
A novel tetracycline resistance gene, designated
tet(32), which confers a high level of tetracycline
resistance, was identified in the Clostridium-related
human colonic anaerobe K10, which also carries tet(W).
tet(32) was transmissible in vitro to the rumen anaerobe
Butyrivibrio fibrisolvens
2221R. The predicted gene product of
tet(32) has 76% amino acid identity with Tet(O). PCR
amplification indicated that tet(32) is widely distributed in the ovine rumen and in porcine feces.
The widespread use of
antibiotics has resulted in the emergence of antibiotic
resistance in both human and veterinary pathogens, and resistance
mechanisms exist for all antibiotics currently in clinical use
(1). Most resistance genes have been isolated from
pathogenic bacteria or from antibiotic producers, and there has been
comparatively little research on antibiotic resistance in the commensal
flora of the human or animal gut. The dominant microorganisms in gut
ecosystems are obligate anaerobes, specifically low-G+C-content
gram-positive bacteria, bifidobacteria, and members of the
gram-negative Cytophaga-Flavobacter-Bacteroides phylum (11, 16). It is not clear how much genetic exchange occurs between these obligate anaerobes and the smaller populations of facultative anaerobes that include major pathogenic species.
A new ribosome protection (RP) tetracycline resistance
(Tcr) gene, tet(W) (GenBank
accession no. AJ222769), identified recently in a range of rumen
anaerobes from geographically distant locations (3), was
transferable in vitro between strains of Butyrivibrio fibrisolvens (13). tet(W) was also
identified in a Clostridium-related human fecal anaerobe,
K10, and in Bifidobacterium longum isolates (14). We report here a second novel transmissible
Tcr gene, designated tet(32)
(8), in the commensal anaerobe K10.
The anaerobic bacterial strains B. fibrisolvens
2221R, rifampin-resistant strain 2221 (13), and K10 were cultured in M2GSC broths
(10). Transfer of Tcr was
investigated in anaerobic filter matings (13) in the
absence of tetracycline. Transconjugants were selected on M2GSC plates containing 10 µg of tetracycline/ml and 100 µg of rifampin/ml, incubated for 2 days. The level of Tcr was tested
using 16-h cultures to inoculate fresh M2GSC broths containing various
tetracycline concentrations. Minimum inhibitory tetracycline
concentrations, inhibiting 90% of bacterial growth (MIC90), were estimated and confirmed in broth cultures.
DNA was extracted from overnight cultures using either the Wizard
Genomic purification kit or the Wizard Plasmid purification kit
(Promega, Southampton, United Kingdom). DNA for genomic
sequencing was extracted using the QIAGEN Genomic DNA Buffer set
and 100/G tips, and for purification of total DNA from fecal and rumen
fluid samples, the QIAamp DNA Stool mini-kit (Qiagen, Crawley, United Kingdom) was used. Restriction digestion, Southern blotting, and hybridization of genomic DNA followed standard procedures.
PCR amplification was done using various primer combinations: tetWfor
and Tet2, specific for tet(W) (14); degenerate
primers Tet1 and Tet2, which recognize all known RP-type genes
(3); or primers specific for tet(32):
Tet(32)For (5' GAACCAGATGCTGCTCTT 3') and Tet(32)Rev
(5' CATAGCCACGCCCACATGAT 3'). Optimizing the annealing
temperature of the latter amplification to 57°C resulted in no
amplification of the related RP genes, tet(M),
tet(O), tet(Q), or tet(W). PCR
products were sequenced using a Taq ABI PRISM kit (Perkin-Elmer, Warrington, United Kingdom), and for direct
genomic sequencing (7), the Thermofidelase I enzyme
(Fidelity Systems Inc.) was utilized. Sequences were separated on an
ABI377 automated sequencer. Sequences were assembled using UWGCG
software (6), which is available through the HGMP
facility (Human Genome Mapping Project, Cambridge, United Kingdom).
The tet(32) gene was identified during investigations into
the transmission of tet(W) from the human isolate K10 to a
Rifr mutant of the rumen anaerobe B. fibrisolvens 2221R.
Tcr transferred at frequencies of
10 The complete sequence of tet(32) contains an ORF whose
product of 594 amino acids has 76% identity to Tet(O), 71% to
Tet(M), and 68% to Tet(W) and Tet(S) (Fig.
1). tet(32) has a G+C content of only 40%, which is considerably lower than that of
tet(W) (53%) but is similar to that of tet(M)
(35%) and tet(O) (40%). The sequence upstream of the
tet(32) start codon contains a GGAGG ribosome binding site
(+7 nt) and two sets of inverted repeats forming secondary stem-loop
structures with
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.11.3246-3249.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Novel Tetracycline Resistance Gene,
tet(32), in the Clostridium-Related Human
Colonic Anaerobe K10 and Its Transmission In Vitro to the Rumen
Anaerobe Butyrivibrio fibrisolvens
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
4 per donor cell. Surprisingly, although the
donor K10 gave the expected tet(W) PCR product of 1.8 kb,
the transconjugants did not. However, both donor and transconjugants
gave the expected 1.3-kb product in PCR amplifications using degenerate
RP primers. We concluded that the transferable
Tcr gene in K10 was not tet(W) but was
a second Tcr gene, tet(32).
G values of 
20.6 and 14.0 kcal
(17). The sequence of this upstream region is virtually identical to that of Campylobacter jejuni tet(O) (GenBank
accession no. M18896; 4 in 150 nt differences), including the
transcription initiation sites and promoter regions (18).
View larger version (10K):
[in a new window]
FIG. 1.
Phylogenetic tree showing the evolutionary relationships
of RP-type Tcr proteins. The amino acid sequence of the
Aquifex aeolicus fusA gene
(accession no. AE000657) for translation factor EF-G was used to root
the tree. GenBank accession numbers are as follows: Tet(O),
Y07780; Tet(M), U58986; Tet(S), X92946; Tet(W), AJ222769; Tet(Q),
X58717; Tet(T), L42544; TetB(P), L20800; and Otr(A), X53401. Figures
beside nodes indicate bootstrap values when greater than 95% (based on
500 trials). Percent G+C content and percent amino acid sequence
identity for each sequence relative to tet(32) are
indicated.
Additional plasmid DNA was not detected in transconjugants, and
hybridization of genomic DNA to tet(32) identified bands
from 9 to 12 kb in size (Fig. 2),
implying that tet(32) is chromosomally encoded.
Hybridization of the same 12-kb SmaI fragment in the donor
and transconjugants implicated an element of at least this size in
tet(32) transfer. There was no cross-hybridization to a
B. fibrisolvens 2221R transconjugant
containing tet(W) (3). Transconjugant DNA
failed to hybridize to probes specific to regions of conjugative
transposons Tn916 (15) or TnB1230
(13), indicating that tet(32) transfer does not
involve similar mobile elements.
|
The presence of tet(32) in other gut environments was tested by PCR amplification of total bacterial DNA using specific tet(32) primers. Six out of 9 rumen samples from cannulated sheep and 8 out of 11 pig fecal samples, all from different animals, gave PCR products. Selected products were sequenced and confirmed to be tet(32), suggesting that tet(32) is abundant in farm animals. There were 25 in 584 nt differences between the porcine amplicon sequences and the K10 tet(32) gene, corresponding to a 4% sequence divergence.
The resistance profiles of B. fibrisolvens
2221R transconjugants expressing Tet(W) or
Tet(32) were compared. Tetracycline concentrations above 20 µg/ml
gave a progressive reduction in growth (Fig.
3). Broth cultures based on growth data
(Fig. 3) confirmed that the MIC90 of tetracycline
for bacteria expressing Tet(W) was much lower (90 µg/ml) than that
for bacteria expressing Tet(32) (200 µg/ml). For strain K10,
which encodes both genes, the MIC90 of tetracycline was even higher (270 µg/ml). As with all RP proteins, Tet(32) also confers resistance to minocycline (10 µg/ml).
|
The identification of a second novel Tcr gene, tet(32), from an anaerobic commensal gut bacterium following the identification of tet(W) (3, 14) demonstrates that the gut microflora harbors novel antibiotic resistance genes. It is important to determine the distribution of these novel resistance genes, in both obligate and facultative anaerobes from different gut and nongut habitats. We have shown that tet(32) is present among the gut microflora of human, ruminant, and porcine hosts and we know that tet(W) has a similar distribution (2, 14). These novel genes could contribute significantly to tetracycline resistance among clinical pathogens where specific resistance genes are currently unidentified (12).
This work provides a third case in which two RP-type Tcr genes are present in the same bacterium. B. fibrisolvens 1.230 carries a mobile tet(W) gene and a nonmobile tet(O) gene (3); strain K10 carries a mobile tet(32) gene and a nonmobile tet(W) gene; Streptococcus pneumoniae contains both tet(M) and tet(O) genes (9). This phenomenon could result from intense selection pressure during the evolution of tetracycline resistance and may contribute to higher resistance levels.
The mechanism of transfer of tet(32) from strain K10 is unknown but may involve a mobile chromosomal element, as shown for many RP-type Tcr genes, including tet(W) (3), tet(Q), and tet(M) (12). Although it was first identified as Fusobacterium prausnitzii, full-length 16S ribosomal DNA sequencing shows that K10 has less than 95% identity with known species but belongs to the Cluster XIVa Clostridium subphylum of low-G+C-content gram-positive bacteria (5). This bacterial cluster includes B. fibrisolvens and many other abundant colonizers of the human colon and rumen (4, 19).
This work provides the first direct experimental evidence that genetic exchange can occur between gram-positive obligate anaerobes from the human colon and those from the rumen. Evidence for transfer between commensal anaerobes and pathogenic gut bacteria is limited, but identical tet(O) genes are present in the rumen anaerobe B. fibrisolvens and the human pathogen S. pneumoniae (3). The species distribution and sequence diversity of the novel tet(32) and tet(W) genes, and of tet(O), should contribute significantly to our understanding of gene flow within and between gut microbial communities.
Nucleotide sequence accession number. The complete sequence of the tet(32) gene was submitted to the GenBank database (accession no. AJ295238).
| |
ACKNOWLEDGMENTS |
|---|
We thank SEERAD (Scottish Executive Environmental Rural Affairs Department) and FSA (Food Standards Agency) for their financial support.
We thank Pauline Young for the automated sequencing.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Rowett Research Institute, Greenburn Road, Bucksburn, Aberdeen AB21 9SB, United Kingdom. Phone: 44 (0) 1224 712751. Fax: 44 (0) 1224 716687. E-mail: kps{at}rri.sari.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Aarestrup, F. M. 1999. Association between the consumption of antimicrobial agents in animal husbandry and the occurrence of resistant bacteria among food animals. Int. J. Antimicrob. Agents 12:279-285[CrossRef][Medline]. |
| 2. | Aminov, R. I., N. Garrigues-Jeanjean, and R. I. Mackie. 2001. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Antimicrob. Agents Chemother. 67:22-32. |
| 3. | Barbosa, T. M., K. P. Scott, and H. J. Flint. 1999. Evidence for recent intergeneric transfer of a new tetracycline resistance gene tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O) in ruminal bacteria. Environ. Microbiol. 1:53-64[CrossRef][Medline]. |
| 4. |
Barcenilla, A.,
S. E. Pryde,
J. C. Martin,
S. H. Duncan,
C. S. Stewart,
C. Henderson, and H. J. Flint.
2000.
Phylogenetic relationships of butyrate-producing bacteria from the human gut.
Appl. Environ. Microbiol.
66:1654-1661 |
| 5. |
Collins, M. D.,
P. A. Lawson,
A. Willems,
J. J. Cordoba,
J. Fernandez-Garayzabal,
P. Garcia,
J. Cai,
H. Hippe, and J. A. E. Farrow.
1994.
The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations.
Int. J. Syst. Bacteriol.
44:812-826 |
| 6. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 7. |
Heiner, C. R.,
K. L. Hunkapiller,
S. M. Chen,
J. I. Glass, and E. Y. Chen.
1998.
Sequencing multimegabase-template DNA with BigDye terminator chemistry.
Genome Res.
8:557-561 |
| 8. |
Levy, S. B.,
L. M. McMurry,
T. M. Barbosa,
V. Burdett,
P. Courvalin,
W. Hillen,
M. C. Roberts,
J. I. Rood, and D. E. Taylor.
1999.
Nomenclature for new tetracycline resistance determinants.
Antimicrob. Agents Chemother.
43:1523-1524 |
| 9. |
Luna, V. A., and M. C. Roberts.
1998.
The presence of the tet(O) gene in a variety of tetracycline-resistant Streptococcus pneumoniae serotypes from Washington State.
Int. J. Antimicrob. Chemother.
42:613-619 |
| 10. | Miyazaki, K., J. C. Martin, R. Marinsek-Logar, and H. J. Flint. 1997. Degradation and utilization of xylans by the rumen anaerobe Prevotella bryantii (formerly P. ruminicola subsp. brevis) B14. Anaerobe 3:373-381[CrossRef][Medline]. |
| 11. |
Pryde, S. E.,
A. J. Richardson,
C. S. Stewart, and H. J. Flint.
1999.
Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.
Appl. Environ. Microbiol.
65:5372-5377 |
| 12. | Roberts, M. C. 1996. Tetracycline resistance determinants: mechanism of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19:1-24[CrossRef][Medline]. |
| 13. | Scott, K. P., T. M. Barbosa, K. J. Forbes, and H. J. Flint. 1997. High frequency transfer of a naturally occurring chromosomal tetracycline resistance element in the ruminal anaerobe Butyrivibrio fibrisolvens. Appl. Environ. Microbiol. 63:3405-3411[Abstract]. |
| 14. |
Scott, K. P.,
C. M. Melville,
T. M. Barbosa, and H. J. Flint.
2000.
Occurrence of the new tetracycline resistance gene tet(W) in bacteria from the human gut.
Antimicrob. Agents Chemother.
44:775-777 |
| 15. |
Senghas, E.,
J. M. Jones,
M. Jamamoto,
C. Gawron-Burke, and D. B. Clewell.
1988.
Genetic organisation of the bacterial conjugative transposon Tn916.
J. Bacteriol.
170:245-249 |
| 16. | Suau, A., R. Bonnet, M. Sutren, J. Godon, G. Gibson, M. Collins, and J. Doré. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 66:4799-4807. |
| 17. | Tinoco, I., P. N. Borer, B. Dengler, and M. D. Levine. 1973. Improved estimation of secondary structure in ribonucleic acids. Nature 14:40-41. |
| 18. |
Wang, Y., and D. E. Taylor.
1991.
A DNA sequence upstream of the tet(O) gene is required for full expression of tetracycline resistance.
Antimicrob. Agents Chemother.
35:2020-2025 |
| 19. |
Willems, A.,
M. Amat-Marco, and M. D. Collins.
1996.
Phylogenetic analysis of Butyrivibrio strains reveals three distinct groups of species within the Clostridium subphylum of the Gram-positive bacteria.
Int. J. Syst. Bacteriol.
46:195-199 |
Antimicrobial Agents and Chemotherapy, November 2001, p. 3246-3249, Vol. 45, No. 11
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.11.3246-3249.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kazimierczak, K. A., Scott, K. P., Kelly, D., Aminov, R. I.
(2009). Tetracycline Resistome of the Organic Pig Gut. Appl. Environ. Microbiol.
75: 1717-1722
[Abstract] [Full Text] -
Warburton, P., Roberts, A. P., Allan, E., Seville, L., Lancaster, H., Mullany, P.
(2009). Characterization of tet(32) Genes from the Oral Metagenome. Antimicrob. Agents Chemother.
53: 273-276
[Abstract] [Full Text] -
Kazimierczak, K. A., Rincon, M. T., Patterson, A. J., Martin, J. C., Young, P., Flint, H. J., Scott, K. P.
(2008). A New Tetracycline Efflux Gene, tet(40), Is Located in Tandem with tet(O/32/O) in a Human Gut Firmicute Bacterium and in Metagenomic Library Clones. Antimicrob. Agents Chemother.
52: 4001-4009
[Abstract] [Full Text] -
Hunter, P. R., Wilkinson, D. C., Catling, L. A., Barker, G. C.
(2008). Meta-Analysis of Experimental Data Concerning Antimicrobial Resistance Gene Transfer Rates during Conjugation. Appl. Environ. Microbiol.
74: 6085-6090
[Abstract] [Full Text] -
Scott, K. P., Martin, J. C., Mrazek, J., Flint, H. J.
(2008). Transfer of Conjugative Elements from Rumen and Human Firmicutes Bacteria to Roseburia inulinivorans. Appl. Environ. Microbiol.
74: 3915-3917
[Abstract] [Full Text] -
van Hoek, A. H. A. M., Mayrhofer, S., Domig, K. J., Florez, A. B., Ammor, M. S., Mayo, B., Aarts, H. J. M.
(2008). Mosaic Tetracycline Resistance Genes and Their Flanking Regions in Bifidobacterium thermophilum and Lactobacillus johnsonii. Antimicrob. Agents Chemother.
52: 248-252
[Abstract] [Full Text] -
Patterson, A. J., Rincon, M. T., Flint, H. J., Scott, K. P.
(2007). Mosaic Tetracycline Resistance Genes Are Widespread in Human and Animal Fecal Samples. Antimicrob. Agents Chemother.
51: 1115-1118
[Abstract] [Full Text] -
Kazimierczak, K. A., Flint, H. J., Scott, K. P.
(2006). Comparative Analysis of Sequences Flanking tet(W) Resistance Genes in Multiple Species of Gut Bacteria.. Antimicrob. Agents Chemother.
50: 2632-2639
[Abstract] [Full Text] -
Spigaglia, P., Barbanti, F., Mastrantonio, P.
(2005). Horizontal Transfer of Erythromycin Resistance from Clostridium difficile to Butyrivibrio fibrisolvens. Antimicrob. Agents Chemother.
49: 5142-5145
[Abstract] [Full Text] -
Lancaster, H., Bedi, R., Wilson, M., Mullany, P.
(2005). The maintenance in the oral cavity of children of tetracycline-resistant bacteria and the genes encoding such resistance. J Antimicrob Chemother
56: 524-531
[Abstract] [Full Text] -
Stanton, T. B., Humphrey, S. B., Scott, K. P., Flint, H. J.
(2005). Hybrid tet Genes and tet Gene Nomenclature: Request for Opinion. Antimicrob. Agents Chemother.
49: 1265-1266
[Full Text] -
Melville, C. M., Brunel, R., Flint, H. J., Scott, K. P.
(2004). The Butyrivibrio fibrisolvens tet(W) Gene Is Carried on the Novel Conjugative Transposon TnB1230, Which Contains Duplicated Nitroreductase Coding Sequences. J. Bacteriol.
186: 3656-3659
[Abstract] [Full Text] -
Stanton, T. B., Humphrey, S. B.
(2003). Isolation of Tetracycline-Resistant Megasphaera elsdenii Strains with Novel Mosaic Gene Combinations of tet(O) and tet(W) from Swine. Appl. Environ. Microbiol.
69: 3874-3882
[Abstract] [Full Text] -
Villedieu, A., Diaz-Torres, M. L., Hunt, N., McNab, R., Spratt, D. A., Wilson, M., Mullany, P.
(2003). Prevalence of Tetracycline Resistance Genes in Oral Bacteria. Antimicrob. Agents Chemother.
47: 878-882
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»