Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 2001, p. 3427-3432, Vol. 45, No. 12
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.12.3427-3432.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Papillomavirus Microbicidal Activities of
High-Molecular-Weight Cellulose Sulfate, Dextran Sulfate, and
Polystyrene Sulfonate
Neil D.
Christensen,1,2,*
Cynthia A.
Reed,1
Tim D.
Culp,2
Paul L.
Hermonat,3
Mary K.
Howett,2
Robert A.
Anderson,4 and
Lourens
J. D.
Zaneveld4
The Jake Gittlen Cancer Research Institute
and Department of Pathology1 and
Department of Microbiology and
Immunology,2 The Milton S. Hershey Medical
Center, Hershey, Pennsylvania 17033; Department of
Obstetrics-Gynecology, University of Arkansas Medical School, Little
Rock, Arkansas 722053; and Section of
Obstetrics-Gynecology Research, Rush Presbyterian-St. Luke's Medical
Center, Chicago, Illinois 606124
Received 1 June 2001/Returned for modification 7 August
2001/Accepted 10 September 2001
 |
ABSTRACT |
The high-molecular-weight sulfated or sulfonated polysaccharides or
polymers cellulose sulfate, dextran sulfate, and polystyrene sulfonate were tested for microbicidal activity against bovine papillomavirus type 1 (BPV-1) and human papillomavirus type 11 (HPV-11)
and type 40 (HPV-40). In vitro assays included the BPV-1-induced focus-forming assay and transient infection of human A431 cells with
HPVs. The compounds were tested for microbicidal activity directly by
preincubation with virus prior to addition to cell cultures and
indirectly by addition of virus to compound-treated cells and to
virus-coated cells to test inactivation of the virus after virus-cell
binding. The data indicated that all three compounds showed
direct microbicidal activity with 50% effective concentrations between
10 to 100 µg/ml. These concentrations were nontoxic to cell cultures
for both assays. When a clone of C127 cells was tested for microbicidal
activity, approximately 10-fold-less compound was required to achieve a
50% reduction in BPV-1-induced foci than for the uncloned parental
C127 cells. Pretreatment of cells with compound prior to addition of
virus also demonstrated strong microbicidal activity with dextran
sulfate and polystyrene sulfonate, but cellulose sulfate required
several orders of magnitude more compound for virus inactivation.
Polystyrene sulfonate prevented subsequent infection of HPV-11 after
virus-cell binding, and this inactivation was observed up to 4 h
after addition of virus. These data indicate that the polysulfated and
polysulfonated compounds may be useful nontoxic microbicidal compounds
that are active against a variety of sexually transmitted disease
agents including papillomaviruses.
 |
INTRODUCTION |
Genital human papillomavirus
(HPV) infections represent one of the most frequent sexually
transmitted diseases (STDs). Although most infections spontaneously
resolve within a year (12), most likely by host
cell-mediated immunity, a proportion of persistent HPV infections can
progress to invasive cervical cancer. Cervical cancer represents the
second most frequent cause of cancer-related deaths in women,
accounting for more than 200,000 deaths per year worldwide
(21). Compounds with microbicidal activity against papillomaviruses, therefore, may reduce incident infections and decrease the rates of cervical cancer. To date, very few reagents with
microbicidal activity against HPV infections have been described. These
reagents include those that specifically target HPVs, such as
monoclonal antibodies (MAbs) with virus-neutralizing activity (2,
3), and non-virus-specific agents, such as povidone-iodine (25), alkyl sulfates (13, 14), and monocaprin
(14). Several reagents that have microbicidal activity
against a broad range of STDs such as N-9 and C31G have proven to be
ineffective against papillomaviruses (9, 13). Some of
these latter agents also induce significant cellular cytotoxicity at
high concentrations, although alkyl sulfates such as sodium dodecyl
sulfate (SDS) were significantly less toxic than N-9 (13,
20).
The purpose of this study is to present data on papillomavirus
microbicidal activity of a class of high-molecular-weight sulfated or
sulfonated polysaccharides or polymers that do not show cellular cytotoxicity even at high concentrations and that have not been previously tested for microbicidal activity against either animal or
human papillomaviruses. These reagents, which include cellulose sulfate
(CS), dextran sulfate (DS), and polystyrene sulfonate (PSS), have been
tested for microbicidal activity against a variety of STD agents, such
as the enveloped viruses human immunodeficiency virus and herpesvirus 1 and 2, gonococci, chlamydia, and for sperm inactivation (1, 10,
11, 20, 29). PSS and CS are being developed as vaginal
microbicides by the Program for the Topical Prevention of Conception
and Disease (TOPCAD, Chicago, Ill.), in collaboration with the
Contraceptive Research and Development (CONRAD) program (Washington,
D.C.), and both are now in clinical trials (7). The
mechanism by which these agents effect microbicidal activity against
STDs could be either by binding directly to the infectious agent or by
binding to the target cell, thus preventing successful infection of
susceptible host cells or tissues. We found that these compounds
strongly inhibited infection of mouse C127 cells by bovine
papillomavirus type 1 (BPV-1) and blocked infection of human A431
epithelial cells by HPV type 11 (HPV-11) and HPV type 40 (HPV-40) as
measured by an in vitro transient-infection assay (17,
23).
 |
MATERIALS AND METHODS |
Compounds tested for microbicidal activity.
Sodium cellulose
sulfate (known as Ushercell J) (called cellulose sulfate or CS in this
study) was synthesized under good manufacturing procedure (GMP)
conditions by Dextran Products, Ltd. (Scarborough, Ontario, Canada) and
has a peak molecular mass of 2,300 kDa and an average molecular
mass of 1,900 kDa. DS was obtained from Dextran Products and has
a peak molecular mass of 500 kDa. PSS was manufactured under GMP
conditions by TOPCAD and has a peak molecular mass of 864 kDa and an
average molecular mass of 751 kDa.
Microbicidal testing using the BPV-1 focus-forming assay.
Microbicidal activity of compounds was first tested using the
well-characterized BPV-1 focus-forming assay (5), with
modifications for microbicide testing (9, 13). Aliquots of
BPV-1 containing approximately 100 to 200 focus-forming units were
preincubated with dilutions of compounds for 10 min at 37°C prior to
addition to cultures of mouse C127 cells. A 10-min preincubation period was chosen based on our previous studies with microbicide testing (13, 14). Cultures of C127 cells were set up in T25 tissue culture flasks (Corning Glass Works, Corning, N.Y.), containing 3 × 105 cells per flask. Virus-compound mixtures
in a total volume of 50 µl were then added to flasks containing 1 ml
of medium each, and an additional 3 ml of medium was added after
24 h of culture. The medium was changed every 3 or 4 days
for a period of 2 weeks. Foci were enumerated by staining the monolayer
with crystal violet and counting stained foci microscopically. Each
concentration of compound was tested in duplicate, and the mean ± standard deviation (SD) of the number of foci was plotted against the
preincubation virus-drug concentration for each compound.
Microbicidal activity of compounds was also tested by preincubation of
cells with compounds followed by addition of virus to compound-coated
C127 cells. In these experiments, dilutions of compounds were added to
cultures of C127 cells, incubated for 1 h at 37°C, washed three
times with medium to remove unbound compound, prior to addition of
approximately 100 focus-forming units of BPV-1. The cultures were
incubated for an additional hour and washed three times to remove
unbound virus, and then the incubation was continued for 2 weeks with
changes of the medium every 3 or 4 days and foci were counted as
described above.
Microbicidal testing using transient infection with HPV-11 and
HPV-40.
Compounds were tested for microbicidal activity using the
in vitro HPV transient-infection assay originally described by Smith and colleagues (23) with some modifications
(17). An enzyme-linked immunosorbent assay (ELISA)-based
readout of optical density (OD) values using alkaline phosphatase
cleavage of the substrate p-nitrophenyl phosphate was also
used to measure HPV infection as described below.
In the standard reverse transcription-PCR (RT-PCR) assay (
17,
23,
24) for detection of HPV-11 infection, aliquots of
HPV-11 were
preincubated with dilutions of compounds for 30 min
at 37°C and then
the mixtures were added to cultures of human
A431 cells. Replicate
cultures of A431 cells were set up by plating
5 × 10
5 cells per well into six-well culture plates.
Virus-compound mixtures
were added to individual A431 cultures, and the
cultures were
incubated for a further 4 days. Cells were harvested in 1 ml of
Trizol (GIBCO/BRL), and then total RNA was prepared for RT and
production of viral cDNA from spliced viral transcripts spanning
a
major splice site between E1 and E4 (
17,
18,
23). Two
rounds of PCR amplification using nested primers (see below) were
conducted for detection of the spliced viral transcript, and the
PCR
products were detected as ethidium bromide-stained bands on
agarose
gels (
17,
23). PCR products were cloned and sequenced
to
confirm the viral origin of the PCR product. The presence of
the
correct-size viral PCR product, as well as a failure to inactivate
and/or block the virus by the test compound, was used to confirm
successful infection by HPV-11 In contrast, the lack of a viral
PCR
product was interpreted to indicate virus inactivation and/or
a failure
of the virus to infect A431 cells. Amplified

-actin
transcripts
(
23) were used as a control to establish the integrity
of
RNA isolation and RT-PCR procedures for uninfected cells and
for
cultures in which HPV-11 inactivation was
achieved.
The RT-PCR assay to detect HPV-40 infection was designed similarly for
the detection of HPV-11 infection as described above.
Primers were
prepared from the published sequence of HPV-40 (
4)
for
amplification of a spliced E1

E4 viral
transcript for HPV-40. The RT reactions were primed using
the
downstream reverse primer
3570GGCGTGCGTGTTCTGTCT
3554.The
first PCR amplification used the following primers: for HPV-40
upstream, the outside primer was
817GGGCACATTACATATAGTGT
836;
for HPV-40 downstream, the outside primer was
3570GGCGTGCGTGTTCTGTCT
3554.
The second PCR amplification used inside (nested) primers: for
HPV-40
upstream, the inside primer was
838CCCCAACTGTGCAGCTACA
857;
for HPV-40 downstream, the inside primer was
3520TGCCCACAGTAGTGGTGAT
3502.
A modification of the RT-PCR assay that incorporates an ELISA-based
readout (Boehringer-Mannheim) was also included to assess
microbicidal
activity. Replicate cell cultures of A431 cells were
infected with an
aliquot of infectious HPV virions as described
above. After 4 days of
culture, cells were harvested and RNA was
extracted. RNA was subjected
to RT using downstream antisense
(reverse) primers for HPV-11 or HPV-40
and

-actin (as a control
or housekeeping cellular transcript) to
initiate cDNA synthesis.
The cDNA was processed through two sets of 30 cycles of PCR amplification
using nested primers: the second set of
cycles used digoxigenin
(DIG)-labeled dUTP to label the PCR products
with DIG. DIG-labeled
PCR products were denatured and then renatured
together with a
biotinylated oligonucleotide specific for the targeted
PCR product
(biotin-GCAGACTCTCCAGTACTATCGAGGAACAA for
HPV-11, biotin-GGCGGACGATTCAGCACTGTACGAGAAGTA
for HPV-40,
and biotin-GGCCCGGACCTGACTGACTACCTCATGAAG for

-actin).
Biotinylated products were detected by an ELISA with plates coated
with
streptavidin (to capture the biotinylated target PCR product)
and then
with anti-DIG antibody and substrate. Labeled PCR products
were added
directly to ELISA plates or titrated at 10-fold dilutions
in duplicate
for each cell culture for each virus
dilution.
ELISA values above the background level were interpreted to indicate
the presence of the viral (or

-actin) spliced cDNA fragment
and
thus, successful infection by HPV-11 or -40. Only semiquantitative
data
on viral infection were obtained because these assays (standard
RT-PCR
and ELISA-based RT-PCR) used nested PCR with two sets of
amplifications
following the RT
steps.
Microbicidal activity of PSS after virus-cell binding.
Prevention of subsequent infection of postattachment HPV-11 or
cell-surface-bound HPV-11 was tested using PSS in a manner similar to
that described for the testing of postattachment neutralization by
neutralizing MAbs (N-MAbs) (2). Aliquots of HPV-11 were added to cultures of A431 cells, and then PSS (100 µg/ml) was added
at different time intervals from 10 min to 8 h after virus addition. All cultures were maintained at 37°C throughout the postattachment treatment periods. Four days later, the cultures were
processed for the RT-PCR assay for detection of virus infection as
described above.
Microbicidal activity.
The prevention of virus infection in
the two in vitro assays (described above) by the tested compounds was
interpreted as the compounds having microbicidal (virucidal) or
virus-inactivating activity. This broad definition does not imply that
the mechanism of action of the compounds on the virus and/or the
mechanism of virus inactivation is known. The term microbicide (rather
than virucide) for these compounds is used throughout this report
because these compounds have shown activity against nonviral STD agents such as gonococci and chlamydia (1, 10, 11).
 |
RESULTS |
Microbicidal activity of CS, DS, and PSS on BPV-1.
CS, DS, and
PSS were tested for direct microbicidal activity against BPV-1 using
the focus-forming assay described in Materials and Methods. Dilutions
of compounds were incubated with aliquots of BPV-1 prior to addition to
C127 cell cultures, and foci were counted after a 2-week culture
period. The mean number of foci was plotted against drug concentration
for each compound (Fig. 1). The results
demonstrated that all three compounds showed microbicidal activity
against BPV-1. The concentrations for CS, DS, and PSS that led to a
50% reduction in foci from cultures of C127 cells were between 10 and
100 µg/ml, with CS showing the strongest microbicidal activity. We
also derived clones from the parental C127 cell line because of the
consistent failure of BPV-1 to induce foci following several cell
passages of the uncloned parental cell line. One clone, named C127-D10,
which produced foci upon BPV-1 infection, was chosen for a repeat
testing of the microbicide compounds. When this clone was tested for
microbicidal activity, approximately 10-fold-less compound was required
to achieve a 50% reduction in BPV-1-induced foci than for the uncloned
parental C127 cells (Fig. 1). Concentrations of compounds required to
reduce foci numbers by 50% in clone C127-D10 cells were between 1 and
10 µg/ml. Several other C127 clones failed to produce foci after
BPV-1 infection (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Microbicidal activities of CS (A), DS (B), and PSS (C)
against BPV-1. The number of foci (mean ± SD; expressed as a
percentage of foci in untreated control cultures) for each dilution of
compound were plotted against the concentration of compound (in
micrograms per milliliter) for parental C127 cells and clone C127-D10
cells. The number of foci in these experiments ranged from 100 to 200 per culture. A second experiment produced similar results.
|
|
Microbicidal activity of CS, DS, and PSS on HPV-11 and HPV-40.
CS, DS, and PSS were tested for microbicidal activity against HPV-11
and -40. The in vitro transient-infection assay described in Materials
and Methods was performed. These tests were conducted to determine
whether the microbicidal activity of these compounds against BPV-1
could extend to activity against HPVs. Dilutions of compounds were
preincubated with aliquots of either HPV-11 or HPV-40 prior to addition
to cultures of A431 cells. The microbicidal activity was assessed
either as the detection of ethidium bromide-stained PCR products or as
an ELISA-based readout as described above. Virus inactivation or lack
of virus infection was evidenced by the failure to detect viral spliced
RT-PCR products and/or the absence of ELISA values above the background
level when the ELISA assay was used to detect labeled PCR products. An
initial experiment was conducted to test the specificity of the
ELISA-based RT-PCR assay by using HPV-11 and HPV-40 infection of A431
cells (Table 1). Highly specific
detection of either HPV-11 or -40 was observed by the presence of high
ELISA ODs for the HPV-11 probe from HPV-11-infected but not
HPV-40-infected cultures and vice versa.
All three compounds demonstrated strong microbicidal activity against
both HPV-11 and HPV-40, and representative experiments
are summarized
in Table
2. The results showed that
RT-PCR products
from cells alone or from uninfected cultures treated
with compounds
consistently demonstrated low OD readings in the ELISA
assay for
the HPV products and high OD readings for the

-actin
product.
Upon HPV-11 and/or HPV-40 infection, cultures showed high
levels
of ELISA-detectable viral products, and addition of microbicides
decreased the signal back to background (uninfected) levels. In
tests
for microbicidal activity against HPV-11 for CS, this occurred
at 100 and 1,000 µg/ml; for DS, this occurred at 10 and 100 µg/ml;
and for
PSS, this occurred at 10, 100, and 1,000 µg/ml (100 µg/ml
for
experiment 2). In assays for HPV-40 infectivity, CS was microbicidal
at
100 and 1,000 µg/ml, DS was microbicidal at 10 and 1,000 µg/ml,
and
PSS was microbicidal at 1,000 µg/ml. There was no cellular
cytotoxicity for any of the doses of compounds as determined by
microscopic examination of the cell cultures. In summary, the
concentrations of CS, DS, and PSS required for complete inactivation
of
the HPV virions ranged from 10 to 100 µg/ml for both HPV-11
and
HPV-40.
Blockage of infection by CS, DS, and PSS.
Preincubation of
C127-D10 cells with compounds prior to addition of BPV-1 was tested to
determine whether the microbicidal effects of CS, DS, and PSS extended
to a blockage of virus interaction with cell surfaces. In these
experiments, titrations of compounds were added to cell cultures,
followed by washing away unbound reagent prior to addition of virus.
After a 1-h incubation with virus, unbound virus was removed by washing
and the cultures were monitored for foci after 2 weeks. The results
(Fig. 2) indicated that these reagents
showed some interference of virus with host cell surfaces, as evidenced
by a dose-dependent reduction of BPV-1-induced foci. DS and PSS showed
the strongest interference, with substantial reduction in foci at doses
of 10 µg/ml. In contrast, CS showed only weak microbicidal effects
when C127-D10 cells were pretreated with this compound.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Inactivation of postattachment BPV-1 following
pretreatment of C127-D10 cells with CS, DS, or PSS. The number of foci
(mean ± SD) from duplicate cultures of C127-D10 cells was plotted
against the cell preincubation dose of compound. A second experiment
produced similar results.
|
|
Postattachment inactivation of HPV-11 by PSS.
N-MAbs have been
previously shown to effect a postattachment neutralization of BPV-1,
cottontail rabbit papillomavirus (CRPV), and HPV-11, in which
the postattachment neutralization could occur up to 8 h after
addition of virus to susceptible cells or tissues (2).
This postneutralization activity occurred in conditions in which the
cell cultures were metabolically active (37°C). The mechanism by
which this postattachment neutralization occurs is poorly understood.
We tested PSS in a similar assay system to determine whether a compound
other than an N-MAb could also effect a postattachment inactivation of
a papillomavirus. HPV-11 virions were added to cultures of A431 cells,
the cells were washed, and then a fixed concentration of PSS was added
at different times after the addition of virus. The cultures were
assayed for transient HPV-11 infection 4 days later using the RT-PCR
assay described above, and the results are shown in Fig.
3. PSS inactivated HPV-11 when added as
late as 4 h after virus addition. Two bands for detection of the
spliced HPV-11 E1
E4 transcript were
occasionally detected because the PCR used nested primer sets, giving
PCR products of 399 and 273 bp (17).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
Postattachment inactivation of HPV-11 infection by PSS.
Cultures of A431 cells were infected with HPV-11, and at set time
points, 100 µg of PSS per ml was added. After 4 days of incubation,
the cultures were assessed for E1 E4 spliced viral mRNA
using the RT-PCR assay described in Materials and Methods. Ethidium
bromide-stained PCR products were detected on agarose gels. A 273-bp
HPV-11 PCR product (A) and a 429-bp -actin PCR product (B) can be
seen. The leftmost lane contains molecular size markers. The other
lanes contain the following: cells only; cells and HPV-11; or cells,
HPV-11, and PSS (100 µg/ml) added at different time points after
virus addition.
|
|
 |
DISCUSSION |
Reports describing compounds with effective microbicidal activity
against HPV types have been limited to N-MAbs (2, 3), and
SDS (13). A limited number of other compounds have shown microbicidal activity against BPV-1 and include povidone-iodine (25), monocaprin (14), SDS (13),
and other members of the alkyl sulfate family (13).
Together, these observations indicate that there is a dearth of
identified compounds that are effective agents for the inactivation or
blocking of infectious HPVs.
In this study, we have determined that several sulfated and/or
sulfonated compounds have strong microbicidal activity against several
papillomaviruses including BPV-1, HPV-11, and HPV-40. The BPV-1
focus-forming assay determined that three compounds, CS, DS, and PSS,
had strong microbicidal activities with microbicidal 50% effective
concentrations (EC50s) between 1 and 10 µg/ml.
Transient-infection assays using human epithelial cells infected with
HPV-11 and -40 showed microbicidal activity at concentrations between
10 and 100 µg/ml for these same compounds. These data indicated that the three compounds had microbicidal activity against papillomaviruses in general and validated the BPV-1 focus-forming assay as a relevant surrogate assay for testing non-virus-specific microbicidal agents for
activity against infectious HPVs.
We conducted several experiments to begin to elucidate the mechanism by
which these compounds inactivate infectious papillomaviruses. Pretreatment of infectious virions with compound led to strong virus
inactivation. The microbicidal action therefore appeared to represent
virus inactivation by direct association of the compounds with
infectious virion. An alternative hypothesis is that the compounds
prevented infection by attaching first to the cell surface and
subsequently preventing infectious virus from binding. Both mechanisms
may contribute to the prevention of papillomavirus infection in the in
vitro assays. To determine whether the latter possible mechanism
predominates, cells were pretreated with compound and washed multiple
times, and then infectious virus was added. Under these conditions, all
three compounds retained virus inactivation activity. CS pretreatment
of cells required concentrations greater than 1,000 µg/ml for virus
inactivation, and the effects obtained may simply have been
accomplished by residual compound remaining in the culture dishes after
the three washing steps. In contrast, strong virus inactivation by
cells pretreated with DS and PSS was observed; this inactivation was
equivalent to that obtained when BPV-1 was first incubated with
compound. These data indicated that for the latter two compounds,
significant virus inactivation activity occurred by blocking the
attachment of (non-compound-coated) infectious virions to
compound-coated cell surfaces. Blocking of the attachment of virus to
cell surfaces cannot be the exclusive mechanism of action of these
compounds however, because one of the compounds (PSS) was able to
prevent infection of virus after the virus had attached to the cell surface.
We have conducted a number of focus-forming assays (in this and other
studies) with cultures of C127 cells. However, the C127 parental cells
often became unreliable after several passages such that the cultures
appeared transformed without BPV-1 and/or no foci were discernible
after a 2-week culture with BPV-1 (data not shown). We therefore
subcloned the parental C127 cell cultures and derived several clones
that were pretested for the maintenance of stable monolayers and for
the ability to develop foci after BPV-1 infection. One clone, C127-D10,
produced foci after BPV-1 infection, but several other clones did not
(data not shown). When clone C127-D10 was tested for microbicidal
activity, there was an approximate 10-fold decrease in the
concentration of compound that was required to achieve a 50% reduction
in BPV-1-induced foci from that for the uncloned parental C127 cells.
The failure of several other C127 clones to produce foci upon BPV-1
infection would suggest that more BPV-1 virus is required to
produce the same number of foci in the parental C127 cell
cultures. In parental C127 cultures, therefore, the
EC50 microbicidal dose would be expected to be
greater (i.e., more compound is needed) because more virus is required
to produce the same number of focus-forming units compared to that
obtained in cultures of clone C127-D10. Other potential contributing
mechanisms to explain the different EC50 doses
include more-efficient infection of C127-D10 cells and/or
more-efficient transformation of C127-D10 cells by infectious BPV-1.
When PSS was added to cultures of HPV-11-infected A431 cells, there was
a similar postattachment inactivation to that observed with N-MAbs
(2). These data confirmed previous observations that
infectious papillomaviruses bind rapidly to cell surfaces but remain on
the surface of the cell for several hours prior to internalization
(2). The reason for the delay in internalization is
unclear but may be related to a "dual" binding step in which virions first interact nonspecifically with cell surface
glycosaminoglycans (8, 15) and then interact with a more
specific receptor such
6 integrin
(6). The importance of
6 integrin
for papillomavirus binding, however, remains controversial (8,
22). Both nonspecific and specific coreceptor interactions
between cell surfaces and viruses have been proposed in other virus
infection systems (16, 19, 26-28). The microbicidal
action of the three compounds against BPV-1 and HPVs (Fig. 1 and Table
2) therefore support previous observations that high-molecular-weight
DS blocked binding of HPV-11 L1 virus-like particles to
epithelial cells (15) and that HS blocked the infectivity
of HPV-16 and -33 pseudovirions (8).
In summary, we describe three new compounds that show microbicidal
activity against BPV-1, HPV-11, and HPV-40. The mechanism of inhibition
of infection appears to include both direct interaction of the
compounds with infectious virions and a blocking effect at the cell
surface. The lack of significant cellular toxicity of CS, DS, and PSS
make these compounds attractive potential microbicides for a variety of
infectious pathogens including HPV.
 |
ACKNOWLEDGMENTS |
This work was supported in part by Public Health Service Program
Project grant PO1 AI37829 from the National Institutes of Allergy and
Infectious Diseases and by the Jake Gittlen Memorial Golf Tournament.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Jake Gittlen
Cancer Research Institute and Departments of Pathology and of
Microbiology and Immunology, The Milton S. Hershey Medical Center, 500 University Dr., Hershey, PA 17033. Phone: (717) 531-6185. Fax: (717)
531-5634. E-mail: ndc1{at}psu.edu.
 |
REFERENCES |
| 1.
|
Anderson, R. A.,
K. Feathergill,
X. Diao,
M. Cooper,
R. Kirkpatrick,
P. Spear,
D. P. Waller,
C. Chany,
G. F. Doncel,
B. Herold, and L. J. D. Zaneveld.
2000.
Evaluation of poly(styrene-4-sulfonate) as a preventative agent for conception and sexually transmitted diseases.
J. Androl.
21:862-870[Abstract].
|
| 2.
|
Christensen, N. D.,
N. M. Cladel, and C. A. Reed.
1995.
Postattachment neutralization of papillomaviruses by monoclonal and polyclonal antibodies.
Virology
207:136-142[CrossRef][Medline].
|
| 3.
|
Christensen, N. D.,
J. W. Kreider,
N. M. Cladel,
S. D. Patrick, and P. A. Welsh.
1990.
Monoclonal antibody-mediated neutralization of infectious human papillomavirus type 11.
J. Virol.
64:5678-5681[Abstract/Free Full Text].
|
| 4.
|
de Villiers, E.-M.,
A. Hirsch-Behnam,
C. Von Knebel-Doeberitz,
C. Neumann, and H. zur Hausen.
1989.
Two newly identified human papillomavirus types (HPV 40 and 57) isolated from mucosal lesions.
Virology
171:248-253[CrossRef][Medline].
|
| 5.
|
Dvoretzky, I.,
R. Shober,
S. K. Chattopadhyay, and D. R. Lowy.
1980.
A quantitative in vitro focus assay for bovine papilloma virus.
Virology
103:369-375[CrossRef][Medline].
|
| 6.
|
Evander, M.,
I. H. Frazer,
E. Payne,
Y. M. Qi,
K. Hengst, and N. A. J. McMillan.
1997.
Identification of the 6 integrin as a candidate receptor for papillomaviruses.
J. Virol.
71:2449-2456[Abstract/Free Full Text].
|
| 7.
|
Gabelnick, H. L., and M. J. K. Harper.
1999.
The promise of public/private sector collaboration in the development of microbicides.
Int. J. Gynecol. Obstet.
67:S31-S38.
|
| 8.
|
Giroglou, T.,
L. Florin,
F. Schafer,
R. E. Streeck, and M. Sapp.
2001.
Human papillomavirus infection requires cell surface heparan sulfate.
J. Virol.
75:1565-1570[Abstract/Free Full Text].
|
| 9.
|
Hermonat, P. L.,
R. W. Daniel, and K. V. Shah.
1992.
The spermicide nonoxynol-9 does not inactivate papillomavirus.
Sex. Transm. Dis.
19:203-205[Medline].
|
| 10.
|
Herold, B. C.,
N. Bourne,
D. Marcellino,
R. Kirkpatrick,
D. M. Strauss,
L. J. D. Zaneveld,
D. P. Waller,
R. A. Anderson,
C. J. Chany,
B. J. Barham,
L. R. Stanberry, and M. D. Cooper.
2000.
Poly(sodium 4-styrene sulfonate): an effective candidate topical antimicrobial for the prevention of sexually transmitted diseases.
J. Infect. Dis.
181:770-773[CrossRef][Medline].
|
| 11.
|
Herold, B. C.,
A. Siston,
J. Bremer,
R. Kirkpatrick,
G. Wilbanks,
P. Fugedi,
C. Peto, and M. Cooper.
1997.
Sulfated carbohydrate compounds prevent microbial adherence by sexually transmitted disease pathogens.
Antimicrob. Agents Chemother.
41:2776-2780[Abstract/Free Full Text].
|
| 12.
|
Ho, G. Y. F.,
R. Bierman,
L. Beardsley,
C. J. Chang, and R. D. Burk.
1998.
Natural history of cervicovaginal papillomavirus infection in young women.
N. Engl. J. Med.
338:423-428[Abstract/Free Full Text].
|
| 13.
|
Howett, M. K.,
E. B. Neely,
N. D. Christensen,
B. Wigdahl,
F. C. Krebs,
D. Malamud,
S. D. Patrick,
M. D. Pickel,
P. A. Welsh,
C. A. Reed,
M. G. Ward,
L. R. Budgeon, and J. W. Kreider.
1999.
A broad-spectrum microbicide with virucidal activity against sexually transmitted viruses.
Antimicrob. Agents Chemother.
43:314-321[Abstract/Free Full Text].
|
| 14.
|
Howett, M. K.,
B. Wigdahl,
D. Malamud,
N. D. Christensen,
P. B. Wyrick,
F. C. Krebs, and B. J. Catalone.
2000.
Alkyl sulfates: a new family of broad spectrum microbicides, p. 707-712.
. Proceedings of the XIII International AIDS Conference 2000. Monduzzi Editoire, Durban, South Africa.
|
| 15.
|
Joyce, J. G.,
J. S. Tung,
C. T. Przysiecki,
J. C. Cook,
E. D. Lehman,
J. A. Sands,
K. U. Jansen, and P. M. Keller.
1999.
The L1 major capsid protein of human papillomavirus type 11 recombinant virus-like particles interacts with heparin and cell-surface glycosaminoglycans on human keratinocytes.
J. Biol. Chem.
274:5810-5822[Abstract/Free Full Text].
|
| 16.
|
Liu, C. K.,
G. Wei, and W. J. Atwood.
1998.
Infection of glial cells by the human polyomavirus JC is mediated by an N-linked glycoprotein containing terminal (2-6)-linked sialic acids.
J. Virol.
72:4643-4649[Abstract/Free Full Text].
|
| 17.
|
Ludmerer, S. W.,
W. L. McClements,
X. M. Wang,
J. C. Ling,
K. U. Jansen, and N. D. Christensen.
2000.
HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain.
Virology
266:237-245[CrossRef][Medline].
|
| 18.
|
Nasseri, M.,
R. Hirochika,
T. R. Broker, and L. T. Chow.
1987.
A human papilloma virus type 11 transcript encoding an El E4 protein.
Virology
159:433-439[CrossRef][Medline].
|
| 19.
|
Pho, M. T.,
A. Ashok, and W. J. Atwood.
2000.
JC virus enters human glial cells by clathrin-dependent receptor-mediated endocytosis.
J. Virol.
74:2288-2292[Abstract/Free Full Text].
|
| 20.
|
Piret, J.,
J. Lamontagne,
J. Bestman-Smith,
S. Roy,
P. Gourde,
A. Desormeaux,
R. F. Omar,
J. Juhasz, and M. G. Bergeron.
2000.
In vitro and in vivo evaluations of sodium lauryl sulfate and dextran sulfate as microbicides against herpes simplex and human immunodeficiency viruses.
J. Clin. Microbiol.
38:110-119[Abstract/Free Full Text].
|
| 21.
|
Pisani, P.,
D. M. Parkin, and J. Ferlay.
1993.
Estimates of the worldwide mortality from eighteen major cancers in 1985. Implications for prevention and projections of future burden.
Int. J. Cancer
55:891-903[Medline].
|
| 22.
|
Sibbet, G.,
C. Romero-Graillet,
G. Meneguzzi, and M. S. Campo.
2000.
Alpha6 integrin is not the obligatory cell receptor for bovine papillomavirus type 4.
J. Gen. Virol.
81:327-334[Abstract/Free Full Text].
|
| 23.
|
Smith, L. H.,
C. Foster,
M. E. Hitchcock, and R. Isseroff.
1993.
In vitro HPV-11 infection of human foreskin.
J. Invest. Dermatol.
101:292-295[CrossRef][Medline].
|
| 24.
|
Smith, L. H.,
C. Foster,
M. E. Hitchcock,
G. S. Leiserowitz,
K. Hall,
R. Isseroff,
N. D. Christensen, and J. W. Kreider.
1995.
Titration of HPV-11 infectivity and antibody neutralization can be measured in vitro.
J. Invest. Dermatol.
105:438-444[CrossRef][Medline].
|
| 25.
|
Sokal, D. C., and P. L. Hermonat.
1995.
Inactivation of papillomavirus by low concentrations of povidone-iodine.
Sex Transm. Dis.
22:22-24[Medline].
|
| 26.
|
Stehle, T., and S. C. Harrison.
1996.
Crystal structures of murine polyomavirus in complex with straight-chain and branched-chain sialyloligosaccharide receptor fragments.
Structure
4:183-194[Medline].
|
| 27.
|
Summerford, C.,
J. S. Bartlett, and R. J. Samulski.
1999.
AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection.
Nat. Med.
5:78-82[CrossRef][Medline].
|
| 28.
|
Summerford, C., and R. J. Samulski.
1998.
Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions.
J. Virol.
72:1438-1445[Abstract/Free Full Text].
|
| 29.
|
Zeitlin, L.,
K. J. Whaley,
T. A. Hegarty,
T. R. Moench, and R. A. Cone.
1997.
Tests of vaginal microbicides in the mouse genital herpes model.
Contraception
56:329-335[CrossRef][Medline].
|
Antimicrobial Agents and Chemotherapy, December 2001, p. 3427-3432, Vol. 45, No. 12
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.12.3427-3432.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lembo, D., Donalisio, M., Rusnati, M., Bugatti, A., Cornaglia, M., Cappello, P., Giovarelli, M., Oreste, P., Landolfo, S.
(2008). Sulfated K5 Escherichia coli Polysaccharide Derivatives as Wide-Range Inhibitors of Genital Types of Human Papillomavirus. Antimicrob. Agents Chemother.
52: 1374-1381
[Abstract]
[Full Text]
-
Selinka, H.-C., Florin, L., Patel, H. D., Freitag, K., Schmidtke, M., Makarov, V. A., Sapp, M.
(2007). Inhibition of Transfer to Secondary Receptors by Heparan Sulfate-Binding Drug or Antibody Induces Noninfectious Uptake of Human Papillomavirus. J. Virol.
81: 10970-10980
[Abstract]
[Full Text]
-
Buck, C. B., Day, P. M., Thompson, C. D., Lubkowski, J., Lu, W., Lowy, D. R., Schiller, J. T.
(2006). Human {alpha}-defensins block papillomavirus infection. Proc. Natl. Acad. Sci. USA
103: 1516-1521
[Abstract]
[Full Text]
-
Patterson, N. A., Smith, J. L., Ozbun, M. A.
(2005). Human Papillomavirus Type 31b Infection of Human Keratinocytes Does Not Require Heparan Sulfate. J. Virol.
79: 6838-6847
[Abstract]
[Full Text]
-
Selinka, H.-C., Giroglou, T., Nowak, T., Christensen, N. D., Sapp, M.
(2003). Further Evidence that Papillomavirus Capsids Exist in Two Distinct Conformations. J. Virol.
77: 12961-12967
[Abstract]
[Full Text]
-
Shafti-Keramat, S., Handisurya, A., Kriehuber, E., Meneguzzi, G., Slupetzky, K., Kirnbauer, R.
(2003). Different Heparan Sulfate Proteoglycans Serve as Cellular Receptors for Human Papillomaviruses. J. Virol.
77: 13125-13135
[Abstract]
[Full Text]
-
Simoes, J. A., Citron, D. M., Aroutcheva, A., Anderson, R. A. Jr., Chany II, C. J., Waller, D. P., Faro, S., Zaneveld, L. J. D.
(2002). Two Novel Vaginal Microbicides (Polystyrene Sulfonate and Cellulose Sulfate) Inhibit Gardnerella vaginalis and Anaerobes Commonly Associated with Bacterial Vaginosis. Antimicrob. Agents Chemother.
46: 2692-2695
[Abstract]
[Full Text]