Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, December 2001, p. 3672-3673, Vol. 45, No. 12
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.12.3672-3673.2001
LETTERS TO THE EDITOR
The Newly Described msrC Gene Is Not Equally
Distributed among All Isolates of Enterococcus faecium
 |
LETTER |
Two recent reports have discussed the role of a newly described
enterococcal gene, msrC (3, 5). The
msrC gene possesses 53 to 62% identity with a
staphylococcal gene, msr(A), encoding an ABC porter for
macrolide and streptogramin B antibiotics (3-5). Portillo
et al. (3) found identical msrC genes
distributed among different macrolide resistance phenotypes of
Enterococcus faecium, suggesting a role other than
involvement in antibiotic resistance. However, disruption of
msrC by insertion mutagenesis was associated with two- to
eightfold decreases in MICs of 14-, 15-, and 16-membered macrolides and
streptogramins B (5). The msrC gene was
detected in all of the investigated 256 isolates of E. faecium in both studies (3, 5). In none of the other seven investigated enterococcal species was the corresponding gene
found, suggesting msrC to be an intrinsic property of
E. faecium. With the exception of two isolates from animals
all other tested E. faecium isolates possessing
msrC were from humans.
As reported previously, we have already examined a collection of
streptogramin-resistant E. faecium isolates of the
vat(E) type for the presence of msrC by PCR and
found it in only 45 of 77 isolates (6). However, the
primers were based on the gene sequence for msrC reported by
Portillo et al. (3), which is only 95% identical to the
recently reported sequence of msrC for the two U.S. isolates
(5). New primers corresponding to sites of 100% identity
between all three identified msrC alleles were constructed
(primer msrC3, 5' AAGGAATCCTTCTCTCTCCG; primer msrC4, 5' GTAAACAAAATCGTTCCCG; product, 343 bp). With these primers
we screened seven isolates of E. hirae, E. durans, and E. faecalis as negative controls and a
collection of 139 unrelated E. faecium isolates of sewage,
animal, food, and human origins including 10 macrolide-susceptible
E. faecium isolates for which erythromycin MICs were 
4
mg/liter (including E. faecium ATCC19434). A total of 121 E. faecium isolates, including all 10 erythromycin-susceptible isolates, gave a product for msrC.
The nucleotide composition of the PCR product from six isolates of
different origins was, despite two nucleotide changes, identical to the
allele of msrC described by Portillo et al.
(3).
Eighteen E. faecium isolates (as well as the seven negative
controls) were negative for msrC. The species E. faecium was confirmed for the 18 isolates by a PCR specific for an
unknown fragment of the E. faecium chromosome
(1) and for the E. faecium specific ligase gene
ddl (2). Dot blot hybridizations of genomic DNA from the msrC PCR-negative isolates with a labelled
msrC gene probe were negative for all but three E. faecium isolates. The 15 E. faecium isolates negative
for msrC in PCR and hybridization experiments consisted of
10 of 32 from poultry, 0 of 16 from pigs, 1 of 21 from sewage, and 4 of
70 from humans.
The results of our study show that the msrC gene is not an
intrinsic property of all E. faecium isolates. The data also
suggest that antibiotic use in animals has not been a selective force for msrC.
| |
ACKNOWLEDGMENTS |
The study reported was supported in part by a grant from the
Federal Ministry for Health.
| |
REFERENCES |
| 1.
|
Cheng, S.,
F. K. McCleskey,
M. J. Gress,
J. M. Retroziello,
R. Liu,
H. Namadari,
K. Beninga,
A. Salmen, and V. G. DelVecchio.
1997.
A PCR assay for identification of Enterococcus faecium.
J. Clin. Microbiol.
35:1248-1250[Abstract].
|
| 2.
|
Dutka-Malen, S.,
S. Evers, and P. Courvalin.
1995.
Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR.
J. Clin. Microbiol.
33:24-27[Abstract]. (Erratum 33:1434.)
|
| 3.
|
Portillo, A.,
F. Ruiz-Larrea,
M. Zarazaga,
A. Alonso,
J. L. Martinez, and C. Torres.
2000.
Macrolide resistance genes in Enterococcus spp.
Antimicrob. Agents Chemother.
44:967-971[Abstract/Free Full Text].
|
| 4.
|
Ross, J. I.,
E. A. Eady,
J. H. Cove,
W. J. Cunliffe,
S. Baumberg, and J. C. Wootton.
1990.
Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding transport super-gene family.
Mol. Microbiol.
4:1207-1214[CrossRef][Medline].
|
| 5.
|
Singh, K. V.,
K. Malathum, and B. E. Murray.
2001.
Disruption of an Enterococcus faecium species-specific gene, a homologue of acquired macrolide resistance genes of staphylococci, is associated with an increase in macrolide susceptibility.
Antimicrob. Agents Chemother.
45:263-266[Abstract/Free Full Text].
|
| 6.
|
Werner, G.,
B. Hildebrandt,
I. Klare, and W. Witte.
2000.
Linkage of determinants for streptogramin A, macrolide-lincosamide-streptogramin B, and chloramphenicol resistance on a conjugative plasmid in Enterococcus faecium and dissemination of this cluster among streptogramin-resistant enterococci.
Int. J. Med. Microbiol.
290:543-548[Medline].
|
| | | | |
Guido Werner
Bianca Hildebrandt
Wolfgang Witte
Robert Koch-Institut Wernigerode Branch
Burgstrasse 37
38855 Wernigerode
Germany
|
Ed. Note: The authors of the other published
article, Portillo et al. (reference 3), declined to
respond.
| |
AUTHORS' REPLY (REFERENCE 5) |
The letter from Werner and colleagues reports the interesting finding
that a gene, msrC, previously identified in 100% of over
250 isolates of Enterococcus faecium, was not found in 15 (4 of which were from humans) of 139 isolates of E. faecium
currently studied. Overall, in the three studies combined,
msrC was documented by PCR or hybridization in 98.7% of
approximately 320 human isolates. While one could question whether the
msrC gene probe covered the entire gene or if it might have
missed evidence suggesting a partial deletion of the gene, it
nonetheless appears that a small percentage of E. faecium
isolates are not able to make MsrC. So, while msrC still
appears to be specific for identifying E. faecium, it is not
sufficiently sensitive for identifying all isolates of this species,
which could well be a limitation with any single-gene species
identification method, particularly for a nonessential gene, such as
this one.
Whether msrC represents a gene that has been acquired
horizontally by E. faecium at some time in the past, or
whether it represents an endogenous gene that has been lost by a small
percentage of isolates during the evolution of the species, remains to
be seen. If the former is true, the presence of the gene in >95%
isolates suggests either that it was acquired very early in the
species' history or that it offers some substantial advantage. Since
the gene is not essential for survival in vitro, as shown in our study (nor did disruption result in a difference in growth curves), it would
seem that whatever function msrC normally provides to the
cell is ancillary to cell survival and/or can be assumed by another
cell component. The presence of multiple potential ABC transporters in
the genome of Enterococcus faecalis (1), and of
at least some in our preliminary sequence of E. faecium
(www.hgsc.bcm.tmc.edu/microbial /efaecium), suggests that there
may be many other candidates for products that may provide a similar
function. Sequencing in the regions surrounding msrC may
reveal the presence of elements suggesting horizontal movement of this
gene between strains or, alternatively, may find remnants of
msrC, suggesting deletion of what once was a gene endogenous
to this species. Such studies, and similar ones with other genes,
should help shed light on how enterococcal species have evolved.
| |
REFERENCE |
| 1.
|
Davis, D. R.,
J. B. McAlpine,
C. J. Pazoles,
M. K. Talbot,
E. A. Alder,
C. White,
B. M. Jonas,
B. E. Murray,
G. M. Weinstock, and B. L. Rogers.
2001.
Enterococcus faecalis multi-drug resistance transporters: application for antibiotic discovery.
J. Mol. Microbiol. Biotechnol.
3:179-184[CrossRef][Medline].
|
| | | | |
Barbara E. Murray
Kavindra V. Singh
University of Texas-Houston Medical School
Houston, Texas
|
Antimicrobial Agents and Chemotherapy, December 2001, p. 3672-3673, Vol. 45, No. 12
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.12.3672-3673.2001
This article has been cited by other articles:
-
McDermott, P. F., Cullen, P., Hubert, S. K., McDermott, S. D., Bartholomew, M., Simjee, S., Wagner, D. D.
(2005). Changes in Antimicrobial Susceptibility of Native Enterococcus faecium in Chickens Fed Virginiamycin. Appl. Environ. Microbiol.
71: 4986-4991
[Abstract]
[Full Text]
-
Simjee, S., White, D. G., Meng, J., Wagner, D. D., Qaiyumi, S., Zhao, S., Hayes, J. R., McDermott, P. F.
(2002). Prevalence of streptogramin resistance genes among Enterococcus isolates recovered from retail meats in the Greater Washington DC area. J Antimicrob Chemother
50: 877-882
[Abstract]
[Full Text]
