Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, February 2001, p. 630-632, Vol. 45, No. 2
Department of Microbiology, Ramón y
Cajal Hospital, National Institute of Health (INSALUD), 28034 Madrid,
Spain
Received 26 July 2000/Returned for modification 13 September
2000/Accepted 19 November 2000
Eighty percent (21 of 26) of macrolide-resistant
Peptostreptococcus strains studied harbored the
ermTR gene. This methyltransferase gene is also the most
frequently found gene among macrolide-lincosamide-streptogramin B-resistant Streptococcus pyogenes strains. Transfer of the
ermTR gene from Peptostreptococcus magnus to
macrolide-susceptible S. pyogenes strains indicates that
this resistance determinant may circulate among gram-positive aerobic
and anaerobic species of the oropharyngeal bacterial flora.
Resistance to macrolides in
Peptostreptococcus species is not a rare event. In our
hospital, susceptibility of clinical isolates has been routinely
studied using the broth microdilution technique (8); the
E-test (AB Biodisk, Solna, Sweden) was used in strains with inadequate
growth in liquid medium. Our rates of erythromycin resistance (MIC Twenty-six high-level macrolide-resistant (erythromycin MIC of Amplification of the DNA from the positive controls with the
corresponding primers generated PCR products of the expected sizes. PCR
products of identical corresponding size were obtained with primers
TR1 and TR2, F1 and F2,
and B1 and B2, and DNA from 21, 5, and 1 Peptostreptococcus strains, respectively. The specific nature of the ermTR, ermF, and ermB amplification
products was controlled by DNA sequencing of one of each PCR product.
In these three cases the amplified sequences corresponded to the
expected amino acid sequence of the different erm genes
(sequences available at the European Bioinformatics Institute website
[http://www.ebi.ac.uk.]). Therefore, 80% (21 of 26) of the
Peptostreptococcus strains studied carried the
ermTR that was found in all species, five strains (19%)
contained the ermF gene (two of P. anaerobius,
one of P. asaccharolyticus, and two of
Peptostreptococcus spp.), and one of them (P. anaerobius) contained both the ermF and the
ermB genes.
The transferability of the ermTR determinant from P. magnus RYC5.257 (erythromycin MIC of >128 µg/ml, inducible
phenotype) to fully macrolide-susceptible S. pyogenes
strains RYC69951 and RYC70632 (erythromycin MICs of 0.047 and 0.064 µg/ml, respectively) was first studied. The conjugation was carried
out on solid media and by adapting previously published procedures
(12, 13). In short, recipient S. pyogenes
strains were grown during the day of mating in brain heart infusion
broth (Oxoid, Basingstoke, United Kingdom). Anaerobic donors were grown
anaerobically on brucella blood agar plates (Oxoid) at 37°C for 24 to
48 h. Turbid suspensions of the agar anaerobic growth were mixed
with equal volumes of the receptor. The mating mixtures were plated on
brucella blood agar plates and incubated under anaerobic conditions
(5% CO2, 10% H2, and 85% N2) at
37°C for 60 h. Transconjugants were selected on aerobically
incubated Columbia blood agar (bioMérieux, Marcy-l'Etoile,
France) plates containing 0.5 µg of erythromycin per ml and were
obtained at frequencies of 10
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.2.630-632.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Macrolide Resistance in
Peptostreptococcus spp. Mediated by ermTR:
Possible Source of Macrolide-Lincosamide-Streptogramin B Resistance in
Streptococcus pyogenes
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
8 µg/ml) in the last 6 years (1994 to 1999) ranged from 30.3 to
61.0%. The rates of the 158 erythromycin-resistant strains isolated in
this period for which erythromycin MICs were 8, 16, 32, 64, 128, and
>128 µg/ml were 13.3, 7.6, 2.5, 3.2, 5.7, and 67.7%, respectively.
In 1992, we showed that both inducible and constitutive
macrolide-lincosamide-streptogramin B (MLS) resistance phenotypes
occurred in Peptostreptoccus, thus indicating the
involvement of an erm mediated mechanism (11).
The fact that these phenotypes were found among different
Peptostreptococcus species suggests that erm
genes are not only common but also circulate among species of this
bacterial genus. In this work, we present evidence that MLS resistance
in Peptostreptococcus is determined by erm genes, most frequently by ermTR, and that these genes can be
conjugatively transferred. As the ermTR determinant is the
erm gene most common among Streptococcus pyogenes
isolates, we hypothesized that Peptostreptococcus could
serve as a potential source of macrolide resistance in group A
beta-hemolytic streptococci.
32
µg/ml) clinical strains of different species in the
Peptostreptococcus genus (eight of Peptostreptococcus
magnus, six of Peptostreptococcus asaccharolyticus,
five of Peptostreptococcus spp., three of
Peptostreptococcus anaerobius, three of
Peptostreptococcus prevotii, and one of
Peptostreptococcus tetradius) were studied. As deduced from
their erythromycin and clindamycin MICs and the double-disk test (in
situ induction of resistance on solid medium with erythromycin disks
apposed to clindamycin disks) (14, 17), constitutive and
inducible resistance phenotypes were found in 16 and 10 strains,
respectively. To identify the class of the presumed erm
genes involved in Peptostreptococcus MLS resistance,
specific PCR amplification of the genes ermA, ermB, ermC, ermF,
ermG, ermQ, and ermTR was performed with the DNA from
the 26 selected resistant strains and from known
erm-positive control strains. Total genomic DNA was obtained
using either the InstaGene matrix (Bio-Rad Laboratories, Hercules,
Calif.) or the proteinase K treatment method (2). Primers
used for detection of the ermA, ermB, ermC, and
ermTR genes were as previously described (6,
16). Primers for ermF, ermG, ermQ, and again for
ermTR genes were designed in our laboratory on the basis of
their published sequences (1, 7, 10, 15). The sequences of
these primers were as follows: F1, 5'
TTACGGGTCAGCACTTTACTA 3'; F2, 5'
ACTTTCAGGACCTACCTCATA 3'; G1, 5'
AGGGAAAGGTCATTTTACTGC 3'; G2, 5'CCC
TACCTATAACTAAACATT 3'; Q1, 5'
TAATAATTATAGAGGAAAAGT 3'; Q2, 5'
TATCCAATCATTATAAGAAAC 3'; TR'1, 5'
AGAAGGTTATAATGAAACAGAA 3'; TR'2, 5'
GGCATGACATAAACCTTCAT 3'. The PCR mixture and the
amplification programs were as previously described (6,
16). In each case, annealing temperatures were adjusted for the
nucleotide composition of the different primers. Electrophoresis was
carried out on 1.5 and 2% agarose gels stained with ethidium bromide,
and the sizes of PCR products were determined using standard
molecular weight markers (Boehringer GmbH, Mannheim, Germany). Control strains were as follows: Staphylococcus
aureus RN1389 (ermA), S. aureus RN4220
(ermC), and S. pyogenes 02C1061:AC1 (ermB), provided by J. Sutcliffe (Pfizer, Groton, Conn.);
Bacteroides fragilis V479 (ermF), provided by
C. J. Smith (East Carolina University); Bacillus
subtilis JIR1021:BD1146 (ermG),
Escherichia coli JIR2038:MC1022 (ermQ), and
E. coli JIR1974:JM105 (ermQ), provided by J. I. Rood (Monash University, Clayton, Australia); and S. pyogenes S211 (ermTR), provided by C. Torres (La
Rioja University, Logroño, Spain).
6 per recipient. This
frequency was consistently found in three replicate experiments. To
rule out the possibility of an inadvertent transformation, the mating
studies were repeated in parallel in the presence or absence of DNase
(400 U/ml) (Boehringer). The erythromycin MICs (E-test) (Fig.
1) for S. pyogenes
transconjugants from both mating pairs were 1 and 1.5 µg/ml,
respectively, and their inducible MLS phenotype was confirmed by the
double-disk test. The presence of the ermTR gene in S. pyogenes transconjugants was verified by PCR using the
TR'1 and TR'2 primers (Fig.
2). PCR products were sequenced and the
identities of the donor and transconjugant amplified products were thus
confirmed.
View larger version (151K):
[in a new window]
FIG. 1.
Erythromycin E-test with S. pyogenes RYC70632
(left) and transconjugant from the P. magnus
RYC5.257-S. pyogenes RYC70632 mating (right).
View larger version (82K):
[in a new window]
FIG. 2.
Agarose gel electrophoresis. Lane 1, DNA molecular
weight marker V. The other lanes represent the products of PCR results
with TR'1 and TR'2 primers and DNA from the
following strains: lane 2, S. pyogenes S211 (TR-positive
control strain); lane 4, P. magnus RYC5.257 (inducible
MLS-resistant strain); lanes 5 and 7, S. pyogenes
RYC69951 and RYC70632 (erythromycin-susceptible strains); lanes 6 and
8, transconjugants from P. magnus
RYC5.257-S. pyogenes RYC69951 and P. magnus RYC5.257-S. pyogenes RYC70632 matings.
Lane 3 represents the negative control without DNA template.
The proportion of ermTR harboring Peptostreptococcus strains able to transfer macrolide resistance to S. pyogenes may be low. No transconjugants were obtained by mating four more P. magnus, two more P. prevotii, and one more P. asaccharolyticus strains. Nevertheless, the fact that ermTR determinant could be transferred in the case described in this paper suggests that this gene may circulate among both aerobic and anaerobic cocci of the oropharyngeal flora. Macrolide resistance in S. pyogenes is a problem of growing concern. Interestingly, ermTR is the most common 23S rRNA methylase-encoding gene in S. pyogenes (3, 4, 5, 9). Peptostreptococcus is considered a normal inhabitant of pharyngeal, dental, and gingival flora. Considering that macrolide-selective pressure is preferentially exerted on the more frequent bacterial populations, Peptostreptococcus could serve as an important reservoir for ermTR-mediated macrolide resistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Ramón y Cajal Hospital, C. Colmenar km 9, 100, 28034 Madrid, Spain. Phone: (34) 91.336.8330. Fax: (34) 91.336.8809. E-mail: mreig{at}hrc.insalud.es.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Berryman, D. I.,
M. Lyristis, and J. I. Rood.
1994.
Cloning and sequence analysis of ermQ, the predominant macrolide-lincosamide-streptogramin B resistance gene in Clostridium perfringens.
Antimicrob. Agents Chemother.
38:1041-1046 |
| 2. |
Chung, W. O.,
C. Werckenthin,
S. Schwarz, and M. C. Roberts.
1999.
Host range of the ermF rRNA methylase gene in bacteria of human and animal origin.
J. Antimicrob. Chemother.
43:5-14 |
| 3. |
De Azavedo, J. C.,
R. H. Yeung,
D. J. Bast,
C. L. Duncan,
S. B. Borgia, and D. E. Low.
1999.
Prevalence and mechanisms of macrolide resistance in clinical isolates of group A streptococci from Ontario, Canada.
Antimicrob. Agents Chemother.
43:2144-2147 |
| 4. |
Giovanetti, E.,
M. P. Montanari,
M. Mingoia, and P. E. Varaldo.
1999.
Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains in Italy and heterogeneity of inducibly resistant strains.
Antimicrob. Agents Chemother.
43:1935-1940 |
| 5. |
Kataja, J.,
P. Huovinen,
M. Skurnik,
The Finnish Study Group for Antimicrobial Resistance, and H. Seppälä.
1999.
Erythromycin resistance genes in group A streptococci in Finland.
Antimicrob. Agents Chemother.
43:48-52 |
| 6. |
Kataja, J.,
H. Seppälä,
M. Skurnik,
H. Sarkkinen, and P. Huovinen.
1998.
Different erythromycin resistance mechanisms in group C and group G streptococci.
Antimicrob. Agents Chemother.
42:1493-1494 |
| 7. |
Monod, M.,
S. Mohan, and D. Dubnau.
1987.
Cloning and analysis of ermG, a new macrolide-lincosamide-streptogramin B resistance element from Bacillus sphaericus.
J. Bacteriol.
169:340-350 |
| 8. | National Committee for Clinical Laboratory Standards. 1997. Methods for antimicrobial susceptibility testing of anaerobic bacteria, 4th ed. Approved standard M11-A4. National Committee for Clinical Laboratory Standards, Wayne, Pa. |
| 9. | Portillo, A., M. Lantero, M. J. Gastanares, F. Ruiz-Larrea, and C. Torres. 1999. Macrolide resistance phenotypes and mechanisms of resistance in Streptococcus pyogenes in La Rioja, Spain. Int. J. Antimicrob. Agents 13:137-140[CrossRef][Medline]. |
| 10. |
Rasmussen, J. L.,
D. O. Odelson, and F. L. Macrina.
1986.
Complete nucleotide sequence and transcription of ermF, a macrolide-lincosamide-streptogramin B resistance determinant from Bacteroides fragilis.
J. Bacteriol.
168:523-533 |
| 11. |
Reig, M.,
A. Moreno, and F. Baquero.
1992.
Resistance of Peptostreptococcus spp. to macrolides and lincosamides: inducible and constitutive phenotypes.
Antimicrob. Agents Chemother.
36:662-664 |
| 12. |
Roberts, M. C.
1991.
Tetracycline resistance in Peptostreptococcus species.
Antimicrob. Agents Chemother.
35:1682-1684 |
| 13. |
Roberts, M. C., and J. Lansciardi.
1990.
Transferable Tet M in Fusobacterium nucleatum.
Antimicrob. Agents Chemother.
34:1836-1838 |
| 14. |
Seppälä, H.,
A. Nissinen,
Q. Yu, and P. Huoniven.
1993.
Three different phenotypes of erythromycin-resistant Streptococcus pyogenes in Finland.
J. Antimicrob. Chemother.
32:885-891 |
| 15. |
Seppälä, H.,
M. Skurnik,
H. Soini,
M. C. Roberts, and P. Huovinen.
1998.
A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes.
Antimicrob. Agents Chemother.
42:257-262 |
| 16. | Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566[Abstract]. |
| 17. |
Weisblum, B.,
M. Y. Graham,
T. Gryczan, and D. Dubnau.
1979.
Plasmid copy number control: isolation and characterization of high-copy-number mutants of plasmid pE194.
J. Bacteriol.
137:635-643 |
Antimicrobial Agents and Chemotherapy, February 2001, p. 630-632, Vol. 45, No. 2
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.2.630-632.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Camilli, R., Del Grosso, M., Iannelli, F., Pantosti, A.
(2008). New Genetic Element Carrying the Erythromycin Resistance Determinant erm(TR) in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
52: 619-625
[Abstract] [Full Text] -
Shin, J. H., Jung, H. J., Kim, H. R., Jeong, J., Jeong, S. H., Kim, S., Lee, E. Y., Lee, J. N., Chang, C. L.
(2007). Prevalence, Characteristics, and Molecular Epidemiology of Macrolide and Fluoroquinolone Resistance in Clinical Isolates of Streptococcus pneumoniae at Five Tertiary-Care Hospitals in Korea. Antimicrob. Agents Chemother.
51: 2625-2627
[Abstract] [Full Text] -
Woo, P. C. Y., Tse, H., Wong, S. S. Y., Tse, C. W. S., Fung, A. M. Y., Tam, D. M. W., Lau, S. K. P., Yuen, K.-y.
(2005). Life-Threatening Invasive Helcococcus kunzii Infections in Intravenous-Drug Users and ermA-Mediated Erythromycin Resistance. J. Clin. Microbiol.
43: 6205-6208
[Abstract] [Full Text] -
Seppala, H., Haanpera, M., Al-Juhaish, M., Jarvinen, H., Jalava, J., Huovinen, P.
(2003). Antimicrobial susceptibility patterns and macrolide resistance genes of viridans group streptococci from normal flora. J Antimicrob Chemother
52: 636-644
[Abstract] [Full Text] -
Brazier, J. S., Hall, V., Morris, T. E., Gal, M., Duerden, B. I.
(2003). Antibiotic susceptibilities of Gram-positive anaerobic cocci: results of a sentinel study in England and Wales. J Antimicrob Chemother
52: 224-228
[Abstract] [Full Text] -
Morosini, M.-I., Canton, R., Loza, E., del Campo, R., Almaraz, F., Baquero, F.
(2003). Streptococcus pyogenes isolates with characterized macrolide resistance mechanisms in Spain: in vitro activities of telithromycin and cethromycin. J Antimicrob Chemother
52: 50-55
[Abstract] [Full Text] -
Giovanetti, E., Magi, G., Brenciani, A., Spinaci, C., Lupidi, R., Facinelli, B., Varaldo, P. E.
(2002). Conjugative transfer of the erm(A) gene from erythromycin-resistant Streptococcus pyogenes to macrolide-susceptible S. pyogenes, Enterococcus faecalis and Listeria innocua. J Antimicrob Chemother
50: 249-252
[Abstract] [Full Text] -
Bingen, E., Leclercq, R., Fitoussi, F., Brahimi, N., Malbruny, B., Deforche, D., Cohen, R.
(2002). Emergence of Group A Streptococcus Strains with Different Mechanisms of Macrolide Resistance. Antimicrob. Agents Chemother.
46: 1199-1203
[Abstract] [Full Text] -
de Azavedo, J. C. S., McGavin, M., Duncan, C., Low, D. E., McGeer, A.
(2001). Prevalence and Mechanisms of Macrolide Resistance in Invasive and Noninvasive Group B Streptococcus Isolates from Ontario, Canada. Antimicrob. Agents Chemother.
45: 3504-3508
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»