Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, May 2001, p. 1515-1521, Vol. 45, No. 5
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.5.1515-1521.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Genetic Characterization of Highly Fluoroquinolone-Resistant
Clinical Escherichia coli Strains from China: Role of
acrR Mutations
Hui
Wang,1
Joann
L.
Dzink-Fox,2
Minjun
Chen,1 and
Stuart B.
Levy2,3,*
Department of Clinical Laboratory, Peking
Union Medical College Hospital, Chinese Academy of Medical Sciences,
Beijing 100730, People's Republic of China,1
and Center for Adaptation Genetics and Drug Resistance and
the Departments of Molecular Biology and
Microbiology2 and of
Medicine,3 Tufts University School
of Medicine, Boston, Massachusetts 02111
Received 3 November 2000/Returned for modification 12 January
2001/Accepted 16 February 2001
 |
ABSTRACT |
The genetic basis for fluoroquinolone resistance was examined in 30 high-level fluoroquinolone-resistant Escherichia coli clinical isolates from Beijing, China. Each strain also demonstrated resistance to a variety of other antibiotics. PCR sequence analysis of
the quinolone resistance-determining region of the topoisomerase genes
(gyrA/B, parC) revealed three to five mutations known to be
associated with fluoroquinolone resistance. Western blot analysis failed to demonstrate overexpression of MarA, and Northern blot analysis did not detect overexpression of soxS RNA in any
of the clinical strains. The AcrA protein of the AcrAB multidrug efflux pump was overexpressed in 19 of 30 strains of E. coli
tested, and all 19 strains were tolerant to organic solvents. PCR
amplification of the complete acrR (regulator/repressor)
gene of eight isolates revealed amino acid changes in four isolates, a
9-bp deletion in another, and a 22-bp duplication in a sixth strain.
Complementation with a plasmid-borne wild-type acrR gene
reduced the level of AcrA in the mutants and partially restored
antibiotic susceptibility 1.5- to 6-fold. This study shows that
mutations in acrR are an additional genetic basis for
fluoroquinolone resistance.
 |
INTRODUCTION |
Fluoroquinolones are powerful
broad-spectrum antimicrobial agents used for the treatment of a wide
variety of community-acquired and nosocomial infections (35,
45). However, resistance to fluoroquinolones has increased
markedly since their introduction in the late 1980s (1, 7, 26,
32, 39, 44, 49). In Beijing from 1997 to 1999, approximately
60% of Escherichia coli strains isolated from
hospital-acquired infections and 50% of the E. coli
strains isolated from the community were resistant to ciprofloxacin. Of
those fluoroquinolone-resistant strains, 80% exhibited ciprofloxacin
MICs of >32 µg/ml (references 54 and 61 and unpublished
data). These findings contrast with much lower frequencies in other
parts of the world.
Mechanisms of fluoroquinolone resistance fall into two principal
categories: alterations in drug targets (e.g., DNA gyrase or
topoisomerase IV) (12, 19, 34, 52) and decreased cellular accumulation of quinolones involving the major multidrug efflux pump,
AcrAB (23, 37). Mutations causing quinolone resistance occur primarily in a highly conserved region (the quinolone
resistance-determining region [QRDR]) of DNA gyrase and topoisomerase
IV (9, 19, 25, 37, 52, 55, 59, 60). Other secondary
mechanisms, such as those that affect the regulatory gene
marA (multiple antibiotic resistance) (9, 10)
or soxS (superoxide) (2), generally cause
decreased expression of the OmpF porin (11) and
overexpression of the AcrAB efflux pump (40). These porin
and pump changes lead to resistance not only to the quinolones but also
to a number of structurally unrelated compounds (2, 10,
40).
In this study, we sought to determine whether the regulatory genes
(marA, soxS, acrR), in addition to the structural genes (gyrA/B, parC), contained mutations which contribute to the
high-level fluoroquinolone resistance of clinical E. coli
isolates from China.
 |
MATERIALS AND METHODS |
Bacterial strains.
Thirty clinical strains of E. coli with high levels of ciprofloxacin resistance (MIC > 32 µg/ml) were isolated from different patients in different wards from
the 1,000-bed Peking Union Medical College Hospital in Beijing, China,
from May to August 1999. These strains were selected for study because
of their resistance to fluoroquinolones (Table
1). Additional strains used in this study were plasmid-free E. coli K-12 derivatives. Their properties
are described in Table 2. Plasmid
pHRP315, containing a spectinomycin cassette, was used for cloning
(42), since all of the clinical strains were susceptible
to spectinomycin. All isolates were grown in Luria-Bertani (LB) medium
(Difco Laboratories, Detroit, Mich.) at 35°C, unless otherwise noted.
Stock cultures were stored at
80°C in 30% glycerol or were
lyophilized on dry disks until tested.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Sources and antibiotic phenotypes of 30 strains of
ciprofloxacin-resistant clinical E. coli isolates (May
to August 1999)
|
|
Antimicrobial susceptibility testing.
Initial MIC profiles
were screened by the disk diffusion method (M2-A6; National Committee
for Clinical Laboratory Standards) and verified by E-test (AB Biodisk,
Solna, Sweden) or gradient plate methodology (14). The
MICs of ciprofloxacin, cefotaxime, imipenem, gentamicin,
ticarcillin-clavulanic acid, and piperacillin-tazobactam were evaluated
by E-test (a gift from AB Biodisk); in addition, ampicillin (400 µg/ml), tetracycline (250 µg/ml), chloramphenicol (300 µg/ml),
and norfloxacin (250 µg/ml) (Sigma Chemical Co., St. Louis, Mo.)
susceptibilities were tested on LB agar using the gradient plate
method. The results were recorded after 24 h of incubation at
35°C. E. coli strains ATCC 25922 and AG100 were included
as controls. Each assay was performed three times on separate occasions.
Antimicrobial susceptibility of clinical strains bearing
pHRP
acrR was determined using gradient
plates.
Organic solvent tolerance.
Mid-logarithmic-phase cultures
(A530, 0.4 to 0.5) grown in LB broth were
diluted in phosphate-buffered saline to approximately 106
to 107 cells/ml. Five microliters was spotted onto LB agar
and allowed to dry. The surface of the agar was overlaid with either
hexane (99%; Sigma-Aldrich Chemical Co., Milwaukee, Wis.), cyclohexane (Fisher Scientific), or a mixture of hexane and cyclohexane (3:1, 1:1,
or 1:3 [vol/vol]) to a depth of ~2 to 3 mm. The plates were incubated at 30°C in a closed container to prevent evaporation of the
solvent. After 24 to 36 h, the spots were scored for confluent growth,
which demonstrated tolerance to the solvent(s) tested. Tests were run
in duplicate, three times.
PCR amplification and DNA sequencing of gyrA, gyrB,
parC, and acrR.
Mutations in the gyrA,
gyrB, parC, and acrR genes of the E. coli
isolates were identified by DNA sequencing of their PCR products. PCR
amplification of the QRDRs of gyrA (nucleotides 100 to 368), gyrB (nucleotides 1223 to 1425), and parC
(nucleotides 138 to 401) was performed with the following
oligonucleotide primer pairs: the gyrA gene was amplified
with 5'-12020TGCCAGATGTCCGAGAT12004-3'
and
5'-11753GTATAACGCATTGCCGC11769-3'
(AE000312; annealing temperature [Tm], 58°C), and
parC was amplified with
5'-4664TATGCGATGTCTGAACTGGG4645-3'
and
5'-4401GCTCAATAGCAGCTCGGAAT4420-3'
(AE000384; Tm, 54°C). Likewise, amplification of
the gyrB gene was with primers
5'-1910CAGACTGCCAGGAACGCGAT1891-3'
and
5'-1707AGCCAAGCGCGGTGATAAGC1726-3'
(AE000447; Tm, 60°C). Wild-type acrR
(DNA from AG100) was amplified in its entirety from bases 9175 to 9822 (AE000152; Tm, 58°C), including the promoter-operator
region, with the oligonucleotide primer pairs
5'-GCTCTAGA
8900ACTGTTACTACGCCAACG8918-3' and
5'-AAACTGCAG
9934CTGAACCTGAAGAACGACCTG9913 - 3'. The
underline denotes the XbaI and PstI sites,
respectively, introduced into each primer for cloning into pHRP315.
A single colony of each bacterial isolate was used as the template for
PCR amplification. The PCRs were performed using high-fidelity
platinum
Taq DNA polymerase (Gibco BRL) in a GeneAmp PCR System
9700 (PE Applied Biosystems). The PCR products were purified using
a
Qiaquick PCR purification kit (Qiagen, Inc.). Direct cycle sequencing
in both directions was performed with the same primers, using
an
automatic 377A DNA Sequencer (Applied Biosystems) at the Tufts
University Core
Facility.
Computer analyses of the sequences were performed using the ClustalW
(version 1.8) multiple sequence alignment program (
51).
Cloning of acrR gene.
The 1.2-kb acrR
PCR fragment was digested by XbaI and PstI, gel
purified (QiaexII Gel Extraction Kit; Qiagen, Inc.), and ligated into
the XbaI- and PstI-digested pHRP315. The
resulting recombinant plasmid (pHRP/acrR) was first isolated
in DH5
cells by selection with spectinomycin (30 µg/ml). It was
then transformed by electroporation into clinical strains of E. coli (CH5, CH10, CH19, CH27, and CH29), with selection on LB agar
plates containing 200 µg of spectinomycin/ml. CH15 was unable to be
transformed using electroporation or CaCl2 heat shock,
perhaps because it contained many endogenous plasmids.
Protein electrophoresis and Western blot analysis.
Freshly
grown E. coli cells were harvested by centrifugation (794 × g, 10 min at 4°C), washed twice in ice-cold
phosphate-buffered saline, resuspended in lysis buffer [20 mM Tris-HCl
(pH 8), 100 mM NaCl, 30% glycerol, 2 mM 4-(2-aminoethyl)
benzenesulfonyl fluoride, 1 mM EDTA (pH 8), 1 mM dithiothreitol], and
sonicated on ice. After centrifugation (4,900 × g, 10 min
at 4°C), the concentration of total whole-cell protein in the
supernatant was assessed (Bio-Rad Protein Assay) using bovine serum
albumin as a standard.
Whole-cell proteins were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a 15%
separating
gel (10% gel was used for detecting AcrA) by standard
methods
(
28). Twenty micrograms of total protein was
loaded for detection
of MarA, while 15 µg was loaded for the
detection of AcrA. The
proteins from the gel were transferred
electrophoretically for
30 min at 25 V (Trans-Blot SD Semi-Dry Transfer
Cell; Bio-Rad)
to a polyvinylidene difluoride membrane (Immobilon-P;
Millipore,
Bedford, Mass.), according to the manufacturer's protocol.
The
membrane was blocked overnight at room temperature in Tris-buffered
saline (TBS; 0.15% NaCl, 10 mM Tris-HCl, pH 7.4) containing 5%
dried
milk, washed three times in wash buffer (0.05% Tween 20
in TBS), and
hybridized at room temperature with anti-MarA polyclonal
antibody
(1:5,000) (
31) or anti-AcrA polyclonal antibody (1:15,000;
gift from H. Nikaido of the University of California, Berkeley)
diluted
in buffer A (0.5% Triton X-100, 0.2% SDS, 0.5% dry milk
[wt/vol]
in TBS) for 1 h with shaking. After three washes in wash
buffer,
the membrane was incubated at room temperature for 1 h
with
horseradish peroxidase conjugated to anti-rabbit immunoglobulin
G
(1:2,000; Life Technologies) diluted in wash buffer. Finally,
after
three additional washes, the blots were developed using
the Renaissance
Western Blot Chemiluminescence Reagent Plus (NEN
Life Science Products,
Inc., Boston, Mass.). AG100 and AG112 were
used as negative and
positive controls, respectively, for the
detection of MarA. For the
detection of AcrA, the following controls
were used: AG100B
(
acrR mutant, AcrA overexpressed) was used to
determine the
location of overexpressed AcrA, and AG100A (
acrAB deleted,
no acrA expression) and AG100 (wild-type expression of
AcrA) were
employed to assess the relative amount of AcrA above
wild-type levels.
All Western blotting was run at least twice
on separate
occasions.
RNA extraction and Northern blot analysis.
soxS
expression in the clinical E. coli strains was detected
by Northern blot analysis. Briefly, total RNA was extracted from bacterial cultures, which were grown at 35°C to an
A530 of 0.4 to 0.5, by using a modified hot
acidic phenol extraction method (Sigma-Genosys Biotechnologies, Inc.,
The Woodlands, Tex.). The concentration of total RNA was determined
spectrophotometrically at 260 nm. Samples of total RNA (5 µg/lane) were fractionated by electrophoresis on a 1.2%
formaldehyde agarose gel and transferred to a nylon membrane (Hybond-N;
Amersham Life Sciences, Inc.) overnight (48).
A 344-bp PCR fragment containing the complete
soxS coding
sequence was amplified from AG100 chromosomal DNA with the SoxS
primer
pair (Sigma-Genosys) according to the manufacturer's instructions.
The
PCR-amplified fragment was gel purified, radiolabeled with
[
32P]dCTP (New England Nuclear), and hybridized to the
membrane-bound
RNA overnight at 65°C, essentially as described by
Barbosa and
Levy (
6). RNA from the strain with
soxRS deleted (DJ901) and
from the
soxS-overexpressing strain (JTG1078) served as negative
and
positive controls, respectively (
17,
18).
Effect of cloned acrR on AcrA expression.
Bacterial strains containing pHRP/acrR bearing the wild-type
acrR gene or the strain alone were grown to an
A600 of 0.6 to 0.8, cells were harvested, and
total proteins were fractionated by SDS-PAGE, Western blotted, and
hybridized with anti-AcrA antibody (see above). Densitometric analysis
of the blot was assessed using the National Institutes of Health
Image program
(http://rsb.info.nih.gov/hih-image/manual/tech.html#analyze). Negative
(AG100A) and positive (AG100B) control strains for acrA were included.
 |
RESULTS |
Antibiotic and organic solvent susceptibility.
Thirty
fluoroquinolone-resistant E. coli isolates were
obtained from a variety of clinical specimens from 13 different wards in one hospital, including samples of urine (nine samples),
tissue drainage and abscess (seven samples), blood (six samples), and vaginal swabs (three samples). Each E. coli strain
demonstrated high-level multidrug resistance (resistance to three or
more structurally unrelated antibiotics) (Table 1). All 30 strains were highly resistant to ampicillin, and a large majority of
the strains were resistant to tetracycline (28 of 30), chloramphenicol
(23 of 30), gentamicin (23 of 30), ticarcillin-clavulanic acid (27 of
30), and piperacillin-tazobactam (24 of 30). Most strains were
susceptible to cefotaxime, although four strains were highly resistant.
All strains were resistant to ciprofloxacin (MIC, >32 µg/ml) and
norfloxacin (MIC,
21 µg/ml) (Table 1).
All strains grew on LB agar overlaid with 99% hexane (log
P
ow, 3.9). However, only 19 of the 30 strains were able to
grow
in a mixture of 3:1 hexane:cyclohexane (log P
ow, 3.4),
and of
these, only two strains (CH5 and CH29) could tolerate a 1:1
hexane:cyclohexane
mixture (Table
3).
These 19 strains were designated organic solvent
tolerant (OST). None
of the strains was able to grow in >50% cyclohexane.
Identification of mutations in DNA gyrA, gyrB, and
parC.
DNA sequencing of the 268-bp PCR product
covering the entire QRDR of gyrA demonstrated the presence
of mutations at codons 83 and 87 in all 30 of the isolates when
compared to wild-type E. coli K-12. A third mutation in
gyrA was also noted in six isolates (Table 3). In every
case, the mutation at codon 83 was a C
T transversion in the codon
TCG, resulting in the substitution of leucine for serine.
For 27 strains, a mutation at codon 87 (G
A transversion of codon
GAC) resulted in an asparagine substitution for an
aspartate. In the remaining three strains, Asp-87 was replaced by Tyr
(G
T transversion of codon GAC). Isolates CH3, CH9, CH11, CH14, and CH21 contained a third mutation, Ala-93 Thr substitution due
to a G
A transversion at codon GCG, whereas one strain
(CH16) substituted a Ser for Ala at position 93 (GCG
TCG). Of note, 23 of 30 isolates had the same nucleotide changes at positions 255 (CAG
CAA), 273 (GCG
GCA), 300 (TAT
TAC), and 333 (AGA
AGG), none of which resulted
in amino acid substitutions.
Analogous to the Ser-83 Leu substitution in
gyrA, 83% of
the isolates (25 of 30) contained a mutation (G

T) at codon 80 in
the
QRDR of
parC, resulting in the substitution of isoleucine
for serine (Table
3). The remaining five isolates demonstrated
a Glu-84
Lys replacement (analogous to Asp-87 in
gyrA). Among
the 25 strains with a Ser-80 Ile substitution, six isolates had
additional
mutations: three had an Ala-108 Val substitution, and
three had a
Glu-84 Gly
substitution.
The QRDR of the
gyrB gene (204-bp fragment) was amplified
from four strains with norfloxacin MICs of >200 µg/ml (CH2, CH6,
CH10, CH27), as well as from one strain for which the MIC of
norfloxacin
was 19.4 µg/ml (CH24). No mutations were found (Table
3).
Expression of marA and soxS.
Overexpression of MarA protein was not observed in any of the 30 strains of E. coli by Western blot analysis, while MarA
overexpression was clearly identified in the control Mar mutant strain,
AG112 (data not shown). Likewise, Northern blot analysis was unable to
detect the overexpression of soxS RNA in any of the clinical strains, while the 400-bp soxS-hybridizing band was easily
detected in the control strain, JTG1078 (data not shown).
Genetic analysis of acrR.
As measured by Western
blot analysis, AcrA protein was overexpressed in 19 of the 30 strains
of E. coli (Table 3 and Fig. 1), compared to control (AG100) levels
and the Mar mutant AG112. All 19 of these strains were tolerant to
organic solvents and, with the exception of five strains (CH15, CH17,
CH19, CH21, and CH24), all demonstrated norfloxacin MICs of
100
µg/ml (Table 1 and 2). In contrast, none of the remaining 11 strains
lacking AcrA overexpression could grow in the presence of organic
solvents.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 1.
Western blot analysis of AcrA prepared from clinical
E. coli strains, separated by SDS-PAGE, blotted, and
developed by chemiluminescence. AG100B (AcrR mutant, AcrA
overexpressed) was used to determine the location of AcrA; AG100A
(acrAB deleted, no AcrA expression) was a negative control;
and AG100 (wild-type expression of AcrA) was used to assess the
relative amount of AcrA above wild-type levels. AG112 (a MarR mutant)
was included to examine AcrA levels in a constitutive MarA background.
The arrow points to the 50-kDa AcrA protein. MW = molecular mass
markers of 62 and 51 kDa. Western analysis was performed at least twice
for each series.
|
|
Strains demonstrating overexpression of AcrA (but not MarA or
soxS) were selected for evaluation of
acrR (the
repressor/regulator
for
acrAB, the genes encoding the major
multidrug efflux pump).
PCR amplification of the complete
acrR gene was performed on eight
clinical strains
overproducing AcrA. DNA sequencing revealed that
four isolates
contained point mutations (CH5, CH10, CH15, and
CH29) (Table
4). In addition, CH19 had a 9-bp deletion
and CH27
had a 22-bp duplication. The mutations were random throughout
the repressor and were not localized to one region (Fig.
2 and
Table
4). CH24 had three silent
mutations. Silent mutations were
also noted in all but two strains
tested. Strain CH21, in which
AcrA was elevated, had no mutations in
the repressor or the operator-promoter
region for
acrR (Fig.
2).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Mutations within acrR, the repressor of the
acrAB locus. The operator-promoter region is indicated by a
hatched box, and nucleotide locations are indicated by the arrows.
|
|
Complementation studies were undertaken in these eight strains to
determine if wild-type AcrR protein would restore antibiotic
susceptibility and, in addition, lower the expression of AcrA.
Only
five of the eight strains accepted the complementing plasmid.
Sensitivity to the tested antibiotic was partially restored when
the
clinical strain was complemented with the wild-type
acrR
gene
on pHRP/
acrR (Table
5).
Resistance to chloramphenicol decreased
by 2- to 3.5-fold, and
tetracycline resistance decreased 1.3-
to 3-fold. Norfloxacin
resistance decreased 1.5- to 6-fold. Kanamycin
and gentamicin
resistances were not affected by the AcrAB efflux
pump, as expected
(
47).
View this table:
[in this window]
[in a new window]
|
TABLE 5.
Restoration of sensitivity to select antibiotics in
clinical E. coli strains complemented with wild-type
acrR
|
|
AcrA protein expression was examined in the
complemented strains by Western blot analysis and
compared to its isogenic clinical
strain by densitometry. In every
case, AcrA was reduced in the
complemented strain compared to its
isogenic parent (Fig.
3),
showing that
the wild-type AcrR supplanted the host mutant AcrR
and that the region
regulating
acrAB in the host was susceptible
to wild-type
AcrR.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of wild-type AcrR on the expression of AcrA
protein. Hatched bars indicate AcrA expression in the clinical E. coli strains relative to that in AG100B (mutant in AcrR), the
positive control. Solid bars denote AcrA expression in each isogenic
strain when complemented with the wild-type acrR on
pHRP/acrR. AG100B (acrR mutant) served as the
positive control.
|
|
 |
DISCUSSION |
High-level fluoroquinolone resistance in E. coli has
become a major problem in China and other countries. In the present
study, 30 clinical E. coli isolates from a hospital in China
showed multiple chromosomal mutations, including mutations in the
topoisomerase genes, gyrA and parC, a finding in
accord with other studies of fluoroquinolone-resistant E. coli (8, 19-21, 46, 50). While silent mutations in
gyrA suggest some strains may be related, the variation of
silent mutations in acrR and the different phenotypes and
mutant genotypes indicate that more than one clone is involved.
Point mutations in GyrA of Ser-83 to either Tyr or Leu (both of which
convert the polar amino acid serine to a nonpolar amino acid
[13, 22, 41, 58, 60]), or a double mutation of Ser-83
Leu and Asp-87 Gly (53), are the most frequent bases for
fluoroquinolone resistance in clinical E. coli isolates. In addition, mutations in ParC at Ser-80, Gly-78, and Glu-84
(corresponding to Ser-83, Gly-81, and Asp-87 of GyrA, respectively)
have also been noted (27). Higher levels of quinolone
resistance (MICs, 8 to 64 µg/ml) in E. coli result from
double mutations in gyrA (Ser-83 Leu and Asp-87 Gly) with a
single parC mutation (Ser-80 or Glu-84) (5, 15, 18,
19, 23, 24, 52). The highest level of resistance generally
results from four mutations: two in gyrA and two in
parC (52). Such findings are supported by studies of sequential mutations of gyrA in laboratory
strains (4, 24), which correlate higher levels of
resistance with increasing numbers of mutations.
In the present study, all 30 clinical strains of E. coli had
at least three mutations in the target genes; all shared the common
mutations at Ser83 and Asp87 in GyrA. Most notably, 11 strains had more
than three mutations (10 strains with four mutations, and five
mutations in 1 strain) (Table 3). This number of multiple mutations
from individual clinical strains has not been reported before and
undoubtedly contributes to the high resistance to fluoroquinolones observed (Table 1). Importantly, mutations affecting Ala-93 in gyrA and Ala-108 in parC have not been described previously.
Although less common, mutations in the QRDR of gyrB have
been found by others (34, 46, 57, 58), but no mutations
were found in gyrB in the isolates studied here. A study by
Everett et al. (15) examining high-level fluoroquinolone
resistance in E. coli isolates from humans and animals was
also unable to detect mutations in either gyrB or
parE.
Besides target gene mutations (gyrAB, parC/E), studies have
shown that high-level fluoroquinolone resistance can be influenced, at
least in part, by mutations in one or more of the known global regulator loci (24), such as marA (9, 10,
16), soxS (2, 56), and robA
(3, 33). Mutations in the repressors of these loci lead to
overexpression of the transcriptional activator marA or
soxS (36). When overexpressed, MarA or SoxS
decreases the synthesis of OmpF porin (responsible for outer membrane
permeability of low-molecular-weight hydrophilic molecules, including
many antibiotics) (11) and increases the expression of the
multidrug efflux pump, AcrAB/TolC (40), ultimately
resulting in increased resistance to fluoroquinolones and other
structurally unrelated antibiotics. In the present study, we were
unable to detect overexpression of either MarA protein or
soxS RNA, although 63% of the strains (19 of 30) were
resistant to organic solvents and overexpressed AcrA (Table 2).
Therefore, another mechanism for AcrA overexpression was involved. The
AcrAB efflux pump has been associated with increased OST
(55). Studies by Kern et al. (24) and
Oethinger et al. (36) found that while half of high-level
fluoroquinolone-resistant E. coli clinical strains were OST,
only a proportion of the strains overexpressed marA or
soxS genes. The acrAB locus was not examined.
We looked for possible mutations in acrR, the regulator of
acrAB, that might be the basis for increased AcrA
expression. Of eight strains tested, six demonstrated different amino
acid substitutions, deletions, or duplications in the AcrR repressor.
When the six were complemented with a wild-type repressor, AcrA levels
decreased, in most cases, by half. Of interest were the two strains
(CH21 and CH24) where no mutations could be found in the
acrR gene or the acrAB promoter/operator region,
yet they overexpressed AcrA, were OST, and were highly resistant to
multiple antimicrobials, including the fluoroquinolones. That other
unidentified genes may be involved in the up-regulation of AcrA has
been reported in an earlier study in which general stress signals were
able to regulate the acrAB operon lacking a functional
repressor (29). In that study, deletion of
marRAB or soxRS had little effect on the
transcription of acrAB, demonstrating that
up-regulation of acrAB expression was not mediated by the
known global regulators, MarA and SoxS. By utilizing gel mobility shift
assays, Ma and colleagues suggested that a factor other than AcrR was
able to bind to the promoter region in response to global stress
conditions (29). This unknown factor, or another, may be
operational in CH21 and CH24. While our work was under review, another
group (30) reported the overexpression of AcrA in clinical
E. coli isolates, but the genetic basis, e.g., mutations in
acrR or in a regulatory locus, was not described. This
present study demonstrates that acrR gene mutations can now
be included with other known chromosomal mutations to explain
high-level fluoroquinolone resistance in clinical strains of E. coli.
 |
ACKNOWLEDGMENTS |
We thank Vincent Perreten and Teresa Barbosa for their advice and
intellectual input into this study and Laura McMurry for suggestions
and critical reading. We also thank Xie Xiuli and Xu Yingchun and their
group for collecting and identifying the clinical E. coli strains.
This work was supported in part by a grant from the U.S. National
Institutes of Health (GM 51661) and a travel grant from the American
Society for Microbiology (H.W.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Adaptation Genetics and Drug Resistance, Tufts University School of
Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6764. Fax: (617) 636-0458. E-mail: slevy{at}opal.tufts.edu.
 |
REFERENCES |
| 1.
|
Aguiar, J. M.,
J. Chacon,
R. Canton, and F. Baquero.
1992.
The emergence of highly fluoroquinolone-resistant Escherichia coli in community-acquired urinary tract infections.
J. Antimicrob. Chemother.
29:349-350[Free Full Text].
|
| 2.
|
Amábile-Cuevas, C. F., and B. Demple.
1991.
Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon.
Nucleic Acids Res.
19:4479-4484[Abstract/Free Full Text].
|
| 3.
|
Ariza, R. R.,
Z. Li,
N. Ringstad, and B. Demple.
1995.
Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein.
J. Bacteriol.
177:1655-1661[Abstract/Free Full Text].
|
| 4.
|
Bachoual, R.,
J. Tankovic, and C. J. Soussy.
1998.
Analysis of mutations involved in fluoroquinolone resistance of in vivo and in vitro mutants of Escherichia coli.
Microb. Drug Resist.
4:271-276[Medline].
|
| 5.
|
Bagel, S.,
V. Hüllen,
B. Wiedemann, and P. Heisig.
1999.
Impact of gyrA and parC mutations on quinolone resistance, doubling time, and supercoiling degree of Escherichia coli.
Antimicrob. Agents Chemother.
40:868-875[Abstract/Free Full Text].
|
| 6.
|
Barbosa, T. M., and S. B. Levy.
2000.
Differential expression of over 60 chromosomal genes in Escherichia coli by constitutive expression of MarA.
J. Bacteriol.
182:3467-3474[Abstract/Free Full Text].
|
| 7.
|
Blumberg, H. M.,
D. Rimland,
D. J. Carroll,
P. Terry, and I. K. Wachsmuth.
1991.
Rapid development of ciprofloxacin resistance in methicillin-susceptible and -resistant Staphylococcus aureus.
J. Infect. Dis.
163:1279-1285[Medline].
|
| 8.
|
Cambau, E., and L. Gutmann.
1993.
Mechanisms of resistance to quinolones.
Drugs
45(Suppl. 3):5-23.
|
| 9.
|
Cohen, S. P.,
H. Hächler, and S. B. Levy.
1993.
Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli.
J. Bacteriol.
175:1484-1492[Abstract/Free Full Text].
|
| 10.
|
Cohen, S. P.,
L. M. McMurry,
D. C. Hooper,
J. S. Wolfson, and S. B. Levy.
1989.
Cross-resistance to fluoroquinolone in multiple-antibiotic-resistant (Mar) Escherichia coli selected by tetracycline or chloramphenicol: decreased drug accumulation associated with membrane changes in addition to OmpF reduction.
Antimicrob. Agents Chemother.
33:1318-1325[Abstract/Free Full Text].
|
| 11.
|
Cohen, S. P.,
L. M. McMurry, and S. B. Levy.
1988.
marA locus causes decreased expression of OmpF porin in multiple-antibiotic-resistant (Mar) mutants of Escherichia coli.
J. Bacteriol.
170:5416-5422[Abstract/Free Full Text].
|
| 12.
|
Conrad, S.,
M. Oethinger,
K. Kaifel,
G. Klotz,
R. Marre, and W. V. Kern.
1996.
gyrA mutations in high-level fluoroquinolone-resistant clinical isolates of Escherichia coli.
J. Antimicrob. Chemother.
38:443-455[Abstract/Free Full Text].
|
| 13.
|
Cullen, M. E.,
A. W. Wyke,
R. Kuroda, and L. M. Fisher.
1989.
Cloning and characterization of a DNA gyrase A gene from Escherichia coli that confers clinical resistance to 4-quinolones.
Antimicrob. Agents Chemother.
33:886-894[Abstract/Free Full Text].
|
| 14.
|
Curiale, M. S., and S. B. Levy.
1982.
Two complementation groups mediate tetracycline resistance determined by Tn10.
J. Bacteriol.
151:209-215[Abstract/Free Full Text].
|
| 15.
|
Everett, M. J.,
Y. F. Jin,
V. Ricci, and L. J. V. Piddock.
1996.
Contributions of individual mechanisms to fluoroquinolone resistance in 36 strains of Escherichia coli isolated from humans and animals.
Antimicrob. Agents Chemother.
40:2380-2386[Abstract].
|
| 16.
|
George, A. M., and S. B. Levy.
1983.
Amplifiable resistance to tetracycline, chloramphenicol, and other antibiotics in Escherichia coli: involvement of a non-plasmid-determined efflux of tetracycline.
J. Bacteriol.
155:531-540[Abstract/Free Full Text].
|
| 17.
|
Greenberg, J. T.,
J. H. Chou,
P. A. Monach,
J. H. Chou, and B. Demple.
1991.
Activation of oxidative stress genes by mutations at soxQ/cfxB/marA locus in Escherichia coli.
J. Bacteriol.
173:4433-4439[Abstract/Free Full Text].
|
| 18.
|
Greenberg, J. T.,
P. A. Monach,
J. H. Chou,
P. D. Josephy, and B. Demple.
1990.
Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli.
Proc. Natl. Acad. Sci. USA
87:6181-6185[Abstract/Free Full Text].
|
| 19.
|
Heisig, P.
1996.
Genetic evidence for a role of parC mutation in the development of high-level fluoroquinolone resistance in Escherichia coli.
Antimicrob. Agents Chemother.
40:879-885[Abstract].
|
| 20.
|
Heisig, P.,
H. Schedletzky, and H. Falkenstein-Paul.
1993.
Mutations in the gyrA gene of a highly fluoroquinolone-resistant clinical isolate of Escherichia coli.
Antimicrob. Agents Chemother.
37:696-701[Abstract/Free Full Text].
|
| 21.
|
Heisig, P., and R. Tschorny.
1994.
Characterization of fluoroquinolone-resistant mutants of Escherichia coli selected in vitro.
Antimicrob. Agents Chemother.
38:1284-1291[Abstract/Free Full Text].
|
| 22.
|
Hooper, D. C.
1993.
Quinolone mode of action new aspects.
Drugs
45(Suppl. 3):8-14.
|
| 23.
|
Hooper, D. C.
1999.
Mechanisms of fluoroquinolone resistance.
Drug Resist. Updates
2:38-55[CrossRef][Medline].
|
| 24.
|
Kern, W. V.,
M. Oethinger,
A. S. Jellen-Ritter, and S. B. Levy.
2000.
Non-target gene mutations in the development of fluoroquinolone resistance in Escherichia coli.
Antimicrob. Agents Chemother.
44:814-820[Abstract/Free Full Text].
|
| 25.
|
Khodursky, A. B.,
E. L. Zechiedrich, and N. R. Cozzarelli.
1995.
Topoisomerase IV is a target of quinolones in Escherichia coli.
Proc. Natl. Acad. Sci. USA
92:11801-11805[Abstract/Free Full Text].
|
| 26.
|
Kresken, M., and B. Wiedemann.
1988.
Development of resistance to nalidixic acid and the fluoroquinolones after the introduction of norfloxacin and ofloxacin.
Antimicrob. Agents Chemother.
32:1285-1288[Abstract/Free Full Text].
|
| 27.
|
Kumagai, Y.,
J. Kato,
K. Hoshino,
T. Akasaka,
K. Sato, and H. Ikeda.
1996.
Mutants of Escherichia coli DNA topoisomerase IV parC gene.
Antimicrob. Agents Chemother.
40:710-714[Abstract].
|
| 28.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 29.
|
Ma, D.,
M. Alberti,
C. Lynch,
H. Nikaido, and J. E. Hearst.
1996.
The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals.
Mol. Microbiol.
19:101-112[CrossRef][Medline].
|
| 30.
|
Mazzariol, A.,
Y. Tokue,
T. M. Kanegawa,
G. Cornaglia, and H. Nakaido.
2000.
High-level fluoroquinolone-resistant clinical isolates of Escherichia coli overproduce multidrug efflux protein AcrA.
Antimicrob. Agents Chemother.
44:3441-3443[Abstract/Free Full Text].
|
| 31.
|
McDermott, P. F.,
D. G. White,
I. Podglajen,
M. N. Alekshun, and S. B. Levy.
1998.
Multidrug resistance following expression of the Escherichia coli marA gene in Mycobacterium smegmatis.
J. Bacteriol.
180:2995-2998[Abstract/Free Full Text].
|
| 32.
|
Muder, R. R.,
C. Brennen,
A. M. Goetz,
M. M. Wagener, and J. D. Rihs.
1991.
Association with prior fluoroquinolone therapy of widespread ciprofloxacin resistance among gram-negative isolates in a Veterans Affairs medical center.
Antimicrob. Agents Chemother.
35:256-258[Abstract/Free Full Text].
|
| 33.
|
Nakajima, H.,
K. Kobayashi,
M. Kobayashi,
H. Asako, and R. Aono.
1995.
Overexpression of the robA gene increases organic solvent tolerance and multiple antibiotic and heavy metal ion resistance in Escherichia coli.
Appl. Environ. Microbiol.
61:2302-2307[Abstract].
|
| 34.
|
Nakamura, S.,
M. Nakmura,
T. Kojima, and H. Yoshida.
1989.
gyrA and gyrB mutations in quinolone-resistant clinical isolates of Escherichia coli.
Antimicrob. Agents Chemother.
33:254-255[Abstract/Free Full Text].
|
| 35.
|
Oethinger, M.,
S. Conrad,
K. Kaifel,
A. Cometta,
J. Belle,
G. Klotz,
M. P. Glauser,
R. Marre,
The International Antimicrobial Therapy Cooperative Group of the European Organization for Research and Treatment of Cancer, and W. V. Kern.
1996.
Molecular epidemiology of fluoroquinolone-resistant Escherichia coli bloodstream isolates from patients admitted to European cancer centers.
Antimicrob. Agents Chemother.
40:387-392[Abstract].
|
| 36.
|
Oethinger, M.,
W. V. Kern,
J. D. Goldman, and S. B. Levy.
1998.
Association of organic solvent tolerance and fluoroquinolone resistance in clinical isolates of Escherichia coli.
J. Antimicrob. Chemother.
41:111-114[Abstract/Free Full Text].
|
| 37.
|
Oethinger, M.,
W. V. Kern,
A. S. Jellen-Ritter,
L. M. McMurry, and S. B. Levy.
2000.
Ineffectiveness of topoisomerase mutations in mediating clinically significant fluoroquinolone resistance in Escherichia coli in the absence of the AcrAB efflux pump.
Antimicrob. Agents Chemother.
44:10-13[Abstract/Free Full Text].
|
| 38.
|
Oethinger, M.,
I. Podglajen,
W. V. Kern, and S. B. Levy.
1998.
Overexpression of the marA or soxS regulatory gene in clinical topoisomerase mutants of Escherichia coli.
Antimicrob. Agents Chemother.
42:2089-2094[Abstract/Free Full Text].
|
| 39.
|
Ogle, J. W.,
L. B. Reller, and M. L. Vasil.
1988.
Development of resistance in Pseudomonas aeruginosa to imipenem, norfloxacin, and ciprofloxacin during therapy: proof provided by typing with a DNA probe.
J. Infect. Dis.
157:743-748[Medline].
|
| 40.
|
Okusu, H.,
D. Ma, and H. Nikaido.
1996.
AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants.
J. Bacteriol.
178:306-308[Abstract/Free Full Text].
|
| 41.
|
Oram, M., and L. M. Fisher.
1991.
4-Quinolone resistance mutations in the DNA gyrase of Escherichia coli clinical isolates identified by using the polymerase chain reaction.
Antimicrob. Agents Chemother.
35:387-389[Abstract/Free Full Text].
|
| 42.
|
Parales, R. E., and C. S. Harwood.
1993.
Construction and use of a new broad-host-range lacZ transcriptional fusion vector, pHRP309, for Gram-negative bacteria.
Gene
133:23-30[CrossRef][Medline].
|
| 43.
|
Park, Y. H.,
J. H. Yoo,
D. H. Huh,
Y. K. Cho,
J. H. Choi, and W. S. Shin.
1998.
Molecular analysis of fluoroquinolone-resistance in Escherichia coli. On the aspect of gyrase and multiple antibiotic resistance (mar) genes.
Yonsie Med. J.
39:534-540.
|
| 44.
|
Pea, C.,
J. M. Albareda,
R. Pallares,
M. Pujol,
F. Tubau, and J. Ariza.
1995.
Relationship between quinolone use and emergence of ciprofloxacin-resistant Escherichia coli in bloodstream infections.
Antimicrob. Agents Chemother.
39:520-524[Abstract/Free Full Text].
|
| 45.
|
Peterson, L. R.
1993.
Quinolone resistance in clinical practice: occurrence and importance, p. 119-137.
In
D. C. Hooper, and J. S. Wolfson (ed.), Quinolone antimicrobial agents, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 46.
|
Quabdesselam, S.,
D. C. Hooper,
J. Tankovic, and C. J. Soussy.
1995.
Detection of gyrA and gyrB mutations in quinolone-resistant clinical isolates of Escherichia coli by single-strand conformational polymorphism analysis and determination of levels of resistance conferred by two different single gyrA mutations.
Antimicrob. Agents Chemother.
39:1667-1670[Abstract].
|
| 47.
|
Rosenberg, E. Y.,
D. Ma, and H. Nikaido.
2000.
AcrD of Escherichia coli is an aminoglycoside efflux pump.
J. Bacteriol.
182:1754-1756[Abstract/Free Full Text].
|
| 48.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 49.
|
Tanaka, M.,
H. Nakayama,
M. Haraoka,
T. Saika,
I. Kobayashi, and S. Naito.
2000.
Antimicrobial resistance of Neisseria gonorrhoeae and high prevalence of ciprofloxacin-resistant isolates in Japan, 1993 to 1998.
J. Clin. Microbiol.
38:521-525[Abstract/Free Full Text].
|
| 50.
|
Tavío, M. del M.,
J. Vila,
J. Ruiz,
A. M. Martín-Sánchez, and M. T. J. de Anta.
1999.
Mechanisms involved in the development of resistance to fluoroquinolone in Escherichia coli.
J. Antimicrob. Chemother.
44:735-742[Abstract/Free Full Text].
|
| 51.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 52.
|
Vila, J.,
J. Ruiz,
P. Goñi, and M. T. J. de Anta.
1996.
Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli.
Antimicrob. Agents Chemother.
40:491-493[Abstract].
|
| 53.
|
Vila, J.,
J. Ruiz,
F. Marco,
A. Barcelo,
P. Goín,
E. Giralt, and T. J. de Anta.
1994.
Association between double mutations in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs.
Antimicrob. Agents Chemother.
38:2477-2479[Abstract/Free Full Text].
|
| 54.
|
Wang, H.,
X. Xie,
Y. Xu,
X. Zhang,
B. Ren, and C. Chen.
1997.
Resistant rates of Gram-negative bacilli to 12 antibiotics by using Etest.
Chin. J. Med. Lab. Sci.
20:265-267.
|
| 55.
|
White, D. G.,
J. D. Goldman,
B. Demple, and S. B. Levy.
1997.
Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli.
J. Bacteriol.
179:6122-6126[Abstract/Free Full Text].
|
| 56.
|
Wu, J., and B. Weiss.
1991.
Two divergently transcribed genes, soxR and soxS, control a superoxide response regulon of Escherichia coli.
J. Bacteriol.
173:2864-2871[Abstract/Free Full Text].
|
| 57.
|
Yamagishi, J.,
H. Yoshida,
M. Yamayoshi, and S. Nakamura.
1986.
Nalidixic acid-resistant mutations of the gyrB gene of Escherichia coli.
Mol. Gen. Genet.
204:367-373[CrossRef][Medline].
|
| 58.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272[Abstract/Free Full Text].
|
| 59.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura,
L. M. Yamanaka, and S. Nakamura.
1991.
Quinolone resistance-determining region in the DNA gyrase gyrB gene of Escherichia coli.
Antimicrob. Agents Chemother.
35:1647-1650[Abstract/Free Full Text].
|
| 60.
|
Yoshida, H.,
T. Kojima,
J. Yamagishi, and S. Nakamura.
1988.
Quinolone resistant mutations of the gyrase gyrA gene of Escherichia coli.
Mol. Gen. Genet.
211:1-7[CrossRef][Medline].
|
| 61.
|
Zhang, X.,
H. Wang,
Y. Hu,
X. Xie,
Y. Xu,
M. Chen,
G. Zhou,
J. Wu,
S. Xu,
S. Zhang,
Q. Wang, and X. Du.
1997.
Susceptibility of 5374 isolates to 18 antibiotics from 5 hospitals in Beijing.
Natl. Med. J. China
77:543-544.
|
Antimicrobial Agents and Chemotherapy, May 2001, p. 1515-1521, Vol. 45, No. 5
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.5.1515-1521.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cavaco, L. M., Aarestrup, F. M.
(2009). Evaluation of Quinolones for Use in Detection of Determinants of Acquired Quinolone Resistance, Including the New Transmissible Resistance Mechanisms qnrA, qnrB, qnrS, and aac(6')Ib-cr, in Escherichia coli and Salmonella enterica and Determinations of Wild-Type Distributions. J. Clin. Microbiol.
47: 2751-2758
[Abstract]
[Full Text]
-
Webber, M. A., Bailey, A. M., Blair, J. M. A., Morgan, E., Stevens, M. P., Hinton, J. C. D., Ivens, A., Wain, J., Piddock, L. J. V.
(2009). The Global Consequence of Disruption of the AcrAB-TolC Efflux Pump in Salmonella enterica Includes Reduced Expression of SPI-1 and Other Attributes Required To Infect the Host. J. Bacteriol.
191: 4276-4285
[Abstract]
[Full Text]
-
Spigaglia, P., Barbanti, F., Louie, T., Barbut, F., Mastrantonio, P.
(2009). Molecular Analysis of the gyrA and gyrB Quinolone Resistance-Determining Regions of Fluoroquinolone-Resistant Clostridium difficile Mutants Selected In Vitro. Antimicrob. Agents Chemother.
53: 2463-2468
[Abstract]
[Full Text]
-
Martin, F. A., Posadas, D. M., Carrica, M. C., Cravero, S. L., O'Callaghan, D., Zorreguieta, A.
(2009). Interplay between Two RND Systems Mediating Antimicrobial Resistance in Brucella suis. J. Bacteriol.
191: 2530-2540
[Abstract]
[Full Text]
-
Morgan-Linnell, S. K., Becnel Boyd, L., Steffen, D., Zechiedrich, L.
(2009). Mechanisms Accounting for Fluoroquinolone Resistance in Escherichia coli Clinical Isolates. Antimicrob. Agents Chemother.
53: 235-241
[Abstract]
[Full Text]
-
Yang, H., Chen, H., Yang, Q., Chen, M., Wang, H.
(2008). High Prevalence of Plasmid-Mediated Quinolone Resistance Genes qnr and aac(6')-Ib-cr in Clinical Isolates of Enterobacteriaceae from Nine Teaching Hospitals in China. Antimicrob. Agents Chemother.
52: 4268-4273
[Abstract]
[Full Text]
-
Fricke, W. F., Wright, M. S., Lindell, A. H., Harkins, D. M., Baker-Austin, C., Ravel, J., Stepanauskas, R.
(2008). Insights into the Environmental Resistance Gene Pool from the Genome Sequence of the Multidrug-Resistant Environmental Isolate Escherichia coli SMS-3-5. J. Bacteriol.
190: 6779-6794
[Abstract]
[Full Text]
-
Hirakawa, H., Takumi-Kobayashi, A., Theisen, U., Hirata, T., Nishino, K., Yamaguchi, A.
(2008). AcrS/EnvR Represses Expression of the acrAB Multidrug Efflux Genes in Escherichia coli. J. Bacteriol.
190: 6276-6279
[Abstract]
[Full Text]
-
Cagnacci, S., Gualco, L., Debbia, E., Schito, G. C., Marchese, A.
(2008). European Emergence of Ciprofloxacin-Resistant Escherichia coli Clonal Groups O25:H4-ST 131 and O15:K52:H1 Causing Community-Acquired Uncomplicated Cystitis. J. Clin. Microbiol.
46: 2605-2612
[Abstract]
[Full Text]
-
Bohnert, J. A., Schuster, S., Fahnrich, E., Trittler, R., Kern, W. V.
(2007). Altered spectrum of multidrug resistance associated with a single point mutation in the Escherichia coli RND-type MDR efflux pump YhiV (MdtF). J Antimicrob Chemother
59: 1216-1222
[Abstract]
[Full Text]
-
Quinn, T., Bolla, J.-M., Pages, J.-M., Fanning, S.
(2007). Antibiotic-resistant Campylobacter: could efflux pump inhibitors control infection?. J Antimicrob Chemother
59: 1230-1236
[Abstract]
[Full Text]
-
Nicoloff, H., Perreten, V., Levy, S. B.
(2007). Increased Genome Instability in Escherichia coli lon Mutants: Relation to Emergence of Multiple-Antibiotic-Resistant (Mar) Mutants Caused by Insertion Sequence Elements and Large Tandem Genomic Amplifications. Antimicrob. Agents Chemother.
51: 1293-1303
[Abstract]
[Full Text]
-
Lautenbach, E., Tolomeo, P., Mao, X., Fishman, N. O., Metlay, J. P., Bilker, W. B., Nachamkin, I.
(2006). Duration of Outpatient Fecal Colonization Due to Escherichia coli Isolates with Decreased Susceptibility to Fluoroquinolones: Longitudinal Study of Patients Recently Discharged from the Hospital. Antimicrob. Agents Chemother.
50: 3939-3943
[Abstract]
[Full Text]
-
Udani, R. A., Levy, S. B.
(2006). MarA-Like Regulator of Multidrug Resistance in Yersinia pestis.. Antimicrob. Agents Chemother.
50: 2971-2975
[Abstract]
[Full Text]
-
Zimhony, O., Chmelnitsky, I., Bardenstein, R., Goland, S., Hammer Muntz, O., Navon Venezia, S., Carmeli, Y.
(2006). Endocarditis Caused by Extended-Spectrum-{beta}-Lactamase-Producing Klebsiella pneumoniae: Emergence of Resistance to Ciprofloxacin and Piperacillin-Tazobactam during Treatment despite Initial Susceptibility.. Antimicrob. Agents Chemother.
50: 3179-3182
[Abstract]
[Full Text]
-
Pumbwe, L., Chang, A., Smith, R. L., Wexler, H. M.
(2006). Clinical significance of overexpression of multiple RND-family efflux pumps in Bacteroides fragilis isolates. J Antimicrob Chemother
58: 543-548
[Abstract]
[Full Text]
-
Oteo, J., Navarro, C., Cercenado, E., Delgado-Iribarren, A., Wilhelmi, I., Orden, B., Garcia, C., Miguelanez, S., Perez-Vazquez, M., Garcia-Cobos, S., Aracil, B., Bautista, V., Campos, J.
(2006). Spread of Escherichia coli Strains with High-Level Cefotaxime and Ceftazidime Resistance between the Community, Long-Term Care Facilities, and Hospital Institutions.. J. Clin. Microbiol.
44: 2359-2366
[Abstract]
[Full Text]
-
Nicoloff, H., Perreten, V., McMurry, L. M., Levy, S. B.
(2006). Role for Tandem Duplication and Lon Protease in AcrAB-TolC- Dependent Multiple Antibiotic Resistance (Mar) in an Escherichia coli Mutant without Mutations in marRAB or acrRAB.. J. Bacteriol.
188: 4413-4423
[Abstract]
[Full Text]
-
Ellington, M. J., Woodford, N.
(2006). Fluoroquinolone resistance and plasmid addiction systems: self-imposed selection pressure?. J Antimicrob Chemother
57: 1026-1029
[Abstract]
[Full Text]
-
Choi, S.-H., Woo, J. H., Lee, J. E., Park, S. J., Choo, E. J., Kwak, Y. G., Kim, M.-N., Choi, M.-S., Lee, N. Y., Lee, B. K., Kim, N. J., Jeong, J.-Y., Ryu, J., Kim, Y. S.
(2005). Increasing incidence of quinolone resistance in human non-typhoid Salmonella enterica isolates in Korea and mechanisms involved in quinolone resistance. J Antimicrob Chemother
56: 1111-1114
[Abstract]
[Full Text]
-
Webber, M. A., Talukder, A., Piddock, L. J. V.
(2005). Contribution of Mutation at Amino Acid 45 of AcrR to acrB Expression and Ciprofloxacin Resistance in Clinical and Veterinary Escherichia coli Isolates. Antimicrob. Agents Chemother.
49: 4390-4392
[Abstract]
[Full Text]
-
Drews, S. J., Poutanen, S. M., Mazzulli, T., McGeer, A. J., Sarabia, A., Pong-Porter, S., Rzayev, Y., Willey, B., Green, K., Low, D. E.
(2005). Decreased Prevalence of Virulence Factors among Ciprofloxacin-Resistant Uropathogenic Escherichia coli Isolates. J. Clin. Microbiol.
43: 4218-4220
[Abstract]
[Full Text]
-
Poole, K.
(2005). Efflux-mediated antimicrobial resistance. J Antimicrob Chemother
56: 20-51
[Abstract]
[Full Text]
-
Lindgren, P. K., Marcusson, L. L., Sandvang, D., Frimodt-Moller, N., Hughes, D.
(2005). Biological Cost of Single and Multiple Norfloxacin Resistance Mutations in Escherichia coli Implicated in Urinary Tract Infections. Antimicrob. Agents Chemother.
49: 2343-2351
[Abstract]
[Full Text]
-
Chuanchuen, R., Gaynor, J. B., Karkhoff-Schweizer, R., Schweizer, H. P.
(2005). Molecular Characterization of MexL, the Transcriptional Repressor of the mexJK Multidrug Efflux Operon in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.
49: 1844-1851
[Abstract]
[Full Text]
-
Kumar, A., Worobec, E. A.
(2005). Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens. Antimicrob. Agents Chemother.
49: 1495-1501
[Abstract]
[Full Text]
-
Dutta, S., Kawamura, Y., Ezaki, T., Nair, G. B., Iida, K.-I., Yoshida, S.-I.
(2005). Alteration in the GyrA Subunit of DNA Gyrase and the ParC Subunit of Topoisomerase IV in Quinolone-Resistant Shigella dysenteriae Serotype 1 Clinical Isolates from Kolkata, India. Antimicrob. Agents Chemother.
49: 1660-1661
[Full Text]
-
Lin, J., Akiba, M., Sahin, O., Zhang, Q.
(2005). CmeR Functions as a Transcriptional Repressor for the Multidrug Efflux Pump CmeABC in Campylobacter jejuni. Antimicrob. Agents Chemother.
49: 1067-1075
[Abstract]
[Full Text]
-
Hata, M., Suzuki, M., Matsumoto, M., Takahashi, M., Sato, K., Ibe, S., Sakae, K.
(2005). Cloning of a Novel Gene for Quinolone Resistance from a Transferable Plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother.
49: 801-803
[Abstract]
[Full Text]
-
Yang, H., Chen, S., White, D. G., Zhao, S., McDermott, P., Walker, R., Meng, J.
(2004). Characterization of Multiple-Antimicrobial-Resistant Escherichia coli Isolates from Diseased Chickens and Swine in China. J. Clin. Microbiol.
42: 3483-3489
[Abstract]
[Full Text]
-
Komp Lindgren, P., Karlsson, A., Hughes, D.
(2003). Mutation Rate and Evolution of Fluoroquinolone Resistance in Escherichia coli Isolates from Patients with Urinary Tract Infections. Antimicrob. Agents Chemother.
47: 3222-3232
[Abstract]
[Full Text]
-
Schneiders, T., Amyes, S. G. B., Levy, S. B.
(2003). Role of AcrR and RamA in Fluoroquinolone Resistance in Clinical Klebsiella pneumoniae Isolates from Singapore. Antimicrob. Agents Chemother.
47: 2831-2837
[Abstract]
[Full Text]
-
Wang, M., Tran, J. H., Jacoby, G. A., Zhang, Y., Wang, F., Hooper, D. C.
(2003). Plasmid-Mediated Quinolone Resistance in Clinical Isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother.
47: 2242-2248
[Abstract]
[Full Text]
-
Bina, X., Perreten, V., Levy, S. B.
(2003). The Periplasmic Protein MppA Requires an Additional Mutated Locus To Repress marA Expression in Escherichia coli. J. Bacteriol.
185: 1465-1469
[Abstract]
[Full Text]
-
Webber, M. A., Piddock, L. J. V.
(2003). The importance of efflux pumps in bacterial antibiotic resistance. J Antimicrob Chemother
51: 9-11
[Full Text]
-
Grkovic, S., Brown, M. H., Skurray, R. A.
(2002). Regulation of Bacterial Drug Export Systems. Microbiol. Mol. Biol. Rev.
66: 671-701
[Abstract]
[Full Text]
-
Pradel, E., Pages, J.-M.
(2002). The AcrAB-TolC Efflux Pump Contributes to Multidrug Resistance in the Nosocomial Pathogen Enterobacter aerogenes. Antimicrob. Agents Chemother.
46: 2640-2643
[Abstract]
[Full Text]
-
Lin, J., Michel, L. O., Zhang, Q.
(2002). CmeABC Functions as a Multidrug Efflux System in Campylobacter jejuni. Antimicrob. Agents Chemother.
46: 2124-2131
[Abstract]
[Full Text]
-
McDonald, L. C., Chen, F.-J., Lo, H.-J., Yin, H.-C., Lu, P.-L., Huang, C.-H., Chen, P., Lauderdale, T.-L., Ho, M.
(2001). Emergence of Reduced Susceptibility and Resistance to Fluoroquinolones in Escherichia coli in Taiwan and Contributions of Distinct Selective Pressures. Antimicrob. Agents Chemother.
45: 3084-3091
[Abstract]
[Full Text]