Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, May 2001, p. 1528-1534, Vol. 45, No. 5
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.5.1528-1534.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Resistance and Adaptation to Quinidine in Saccharomyces
cerevisiae: Role of QDR1 (YIL120w), Encoding
a Plasma Membrane Transporter of the Major Facilitator
Superfamily Required for Multidrug Resistance
Patrícia A.
Nunes,
Sandra
Tenreiro, and
Isabel
Sá-Correia*
Centro de Engenharia Biológia e
Química, Instituto Superior Técnico, 1049-001 Lisbon,
Portugal
Received 11 December 2000/Returned for modification 22 January
2001/Accepted 20 February 2001
 |
ABSTRACT |
As predicted based on structural considerations, we show results
indicating that the member of the major facilitator superfamily encoded
by Saccharomyces cerevisiae open reading frame
YIL120w is a multidrug resistance determinant. Yil120wp was
implicated in yeast resistance to ketoconazole and quinidine, but not
to the stereoisomer quinine; the gene was thus named QDR1.
Qdr1p was proved to alleviate the deleterious effects of quinidine, revealed by the loss of cell viability following sudden exposure of the
unadapted yeast population to the drug, and to allow the earlier
eventual resumption of exponential growth under quinidine stress.
However, QDR1 gene expression had no detectable effect on
the susceptibility of yeast cells previously adapted to quinidine. Fluorescence microscopy observation of the distribution of the Qdr1-green fluorescent protein fusion protein in living yeast cells
indicated that Qdr1p is a plasma membrane protein. We also show
experimental evidence indicating that yeast adaptation to growth with
quinidine involves the induction of active expulsion of the drug from
preloaded cells, despite the fact that this antiarrhythmic and
antimalarial quinoline ring-containing drug is not present in the yeast
natural environment. However, we were not able to prove that Qdr1p is
directly implicated in this export. Results clearly suggest that there
are other unidentified quinidine resistance mechanisms that can be used
in the absence of QDR1.
 |
INTRODUCTION |
Several transport systems play an
important role in conferring multiple drug resistance (MDR), presumably
due to the catalysis of energy-dependent extrusion of a large number of
structurally and functionally unrelated compounds out of the cells
(3, 4, 25). In Saccharomyces cerevisiae, the
proton motive force-dependent multidrug efflux systems belong to the
major facilitator superfamily (MFS) (21, 22). Other known
determinants associated with MDR are other membrane transporters
belonging to the ATP binding cassette (ABC) superfamily, which utilize
ATP hydrolysis to drive drug extrusion, and factors for transcriptional
regulation of all these putative multidrug transporters
(2). On the basis of the complete yeast genome sequence,
the MFS-MDR homologues comprise a large number of proteins that have
escaped identification by classical approaches (16, 19,
22). However, the involvement of the vast majority as MDR
determinants remains unknown.
Within the context of the European Functional Analysis Network
(EUROFAN), we have identified open reading frame (ORF)
YIL120w, encoding an MFS-MDR homologue, as a
determinant of resistance to quinidine. The gene, named
QDR1, also confers resistance to (at least) ketoconazole.
These conclusions were based on the higher susceptibility to these
compounds of the deletion mutant
qdr1 compared with the
wild-type strain and on the increased resistance of both strains upon
increased expression of QDR1 from a centromeric plasmid
clone. A distinct MFS-MDR homologue encoded by S. cerevisiae ORF YOR273c was previously demonstrated to confer resistance
to quinidine in yeast cells by using a different approach
(11). The strategy used was based on S. cerevisiae transformation with a yeast genomic library and
selection for resistance to elevated levels of quinidine. The only ORF
encoding a member of the MFS-MDR identified was YOR273c,
therefore failing the identification of ORF YIL120w.
The emergence of drug-resistant strains of Plasmodium
falciparum is an obstacle in malaria control (10,
23). The antimalarial effects of quinoline ring-containing drugs
are exerted in Plasmodium cells via physiological mechanisms
that do not exist in yeast cells (10, 15), and the
mechanisms of resistance in S. cerevisiae may not apply to
the malaria parasite. However, the mechanisms of drug resistance have
been conserved among phylogenetically distant organisms (4, 6,
10, 22), and experimental evidence suggests that the mechanisms
of action of quinoline ring-containing drugs in P. falciparum are independent of the mechanisms of resistance (10). During the present study, we tried to gain some
understanding of how Yil120wp confers resistance to quinidine, used for
the treatment of life-threatening infections with P. falciparum and as an antiarrhythmic agent
(http://www.rxmed.com/monographs/quinidin2.html). The role of
QDR1 in alleviating the deleterious effects of quinidine on
unadapted yeast cells suddenly exposed to the drug was examined. Although the adaptation of yeast cells to growth in the presence of
quinidine involves induction of active efflux of quinidine out of the
cell, we were not able to prove that Qdr1p is directly implicated in
this transport across the plasma membrane, where this protein was
localized by fluorescence microscopy.
 |
MATERIALS AND METHODS |
Strains, media, and general methods.
Disruption of ORF
YIL120w was carried out in two S. cerevisiae
strains: FY73 (MAT
ura3-52 his3
200 GAL2+),
closely related to the sequenced strain FY1679, and W303.1b (MAT
ura3-1 leu2-3,112, his3-11,15,15 trp1-1 ade1-2
can1-100), another EUROFAN strain, used extensively in our
laboratory to assess drug susceptibility phenotypes (7,
31). Escherichia coli strains and the routine growth
media used were described before (7, 31). Cloning
procedures were carried out by standard methods (29).
Transformation of yeast cells was performed by the method of Gietz et
al. (14), slightly modified.
Disruption and cloning of ORF YIL120w.
Disruption of ORF YIL120w in S. cerevisiae FY73
was performed using a disruption cassette, consisting of the dominant
resistance marker loxP-kanMX4-loxP flanked by short flanking
homology regions to the target ORF. This was prepared by DNA
amplification by PCR, using plasmid pUG6 (17, 33) as a
template and the following primers:
5'-ATG ACCAAACAACAAACTTCTGTAATGCGTAACGCATCTATAGCCAAGG CGGCCGCTTCGTACGCTGCAGGTCGAC-3'
and
5'-GTTATAAAATATA GATATCTGTTTCTGGAAAGTGGGGGCAGAGACGCGGCCGCGCATA GGCCACTAGTGGATCTG-3', where the sequence complementary to pUG6 is underlined. These primers
included at the 5' end 48 and 45 nucleotides, respectively, homologous
to the flanking region of the ORF followed by the NotI site
and, at the 3' end, 20 and 22 nucleotides, respectively, homologous to
pUG6. The PCR product of 1,690 bp, generated using the amplification
conditions described before (7), was purified and used to
transform strain FY73. Transformants were selected on YPD plates with
geneticin (200 mg/liter), and the correct replacement of the gene was
confirmed by two independent PCRs (7).
A replacement cassette was also prepared to be used for systematic
inactivation of ORF YIL120w in any S. cerevisiae
strain, in particular strain W303.1b, by creating longer homologous
sequences on both sides of the loxP-kanMX4-loxP module. This
YIL120w replacement cassette (long flanking homology) was
obtained by PCR amplification with Pwo using genomic DNA
isolated from the deletant strain and the following primers:
5'-GGCGCATGCGACATCTACGGCTACGGGAT-3' and 5'-GCGGCATGCTGGATACCAAAGGAGAACCA-3', designed to be located
765 and 872 bp upstream and downstream of the start and the stop codon, respectively. The PCR product was cloned in the SphI site of
pFL38 (5), generating plasmid pYORC_YIL120w.
ORF
YIL120w was cloned by the gap repair technique
(
27) into pFL38, using plasmid pYORC_
YIL120w,
as described before (
7),
giving rise to plasmid
pFL38_
YIL120w.
Growth media and drug susceptibility tests.
The
susceptibility tests for several metabolic inhibitors were carried out
first by comparing the susceptibilities of the wild-type strain
(W303.1b) and the mutant
yil120w strain (W303.1b
yil120w). Whenever a consistent phenotype was detected,
these tests were followed by comparison of the susceptibility of the wild-type (W303.1b) and the mutant
yil120w strain
transformed with pFL38_YIL120w or the cloning vector. Cells
were grown on minimal medium (MM2 or MM2 lacking uracil [MM2-U] for
plasmid maintenance) agar plates supplemented with suitable
concentrations of the different compounds. MM2 medium contained (per
liter): 1.7 g of yeast nitrogen base without amino acids or
NH4+ (Difco), 20 g of glucose, 2.65 g
of (NH4)2SO4, 80 mg of adenine, 10 mg of histidine, 10 mg of leucine, 20 mg of tryptophan, and 20 mg of
uracil. The ranges of drug concentrations tested in agar plates were
0.11 to 0.18 µM for cycloheximide, 52 to 69 µM for benomyl, 22 to
35 µM for methotrexate, and 0.9 to 1.1 µM for
4-nitroquinoline-N-oxide (all from Sigma, stock dissolved in
dimethyl sulfoxide [DMSO]); 3.7 to 6.1 µM for crystal violet and
3.2 to 5.4 µM for malachite green (obtained from Merck, dissolved in
water); 2.3 to 3.0 µM for fluconazole (Diflucan, in saline solution);
1.4 to 2.8 µM for itraconazole and 1.9 to 2.9 µM for ketoconazole
(kindly supplied by Janssen Research Foundation, dissolved in DMSO); 24 to 100 nM for miconazole (Sigma, stock in DMSO); 3.0 to 4.0 mM for
quinine and 3.0 to 3.8 mM for quinidine (sulfate salt dehydrate) (both from Sigma, dissolved in 70% ethanol). DMSO and ethanol concentrations in the growth media (including the control medium lacking the growth
inhibitors) were kept below 0.1% (wt/vol) and 1.4% (vol/vol), respectively; these concentrations had no detectable effect on yeast
growth kinetics. Cells used to inoculate the agar plates were
mid-exponential-phase cells grown without drugs until a culture optical
density at 600 nm (OD600) of 0.2 ± 0.02 was reached
and resuspended in sterile H2O to obtain cell suspensions
with an OD600 of 0.05 ± 0.005. These and diluted (1:2
and 1:4) cell suspensions were applied as spots (4 µl) onto the
surface of the agar media and incubated at 30°C for 3 to 5 days,
depending on the severity of growth inhibition. Conclusions on drug
susceptibility were based on consistent results from several
independent spot assay experiments carried out with recently
transformed yeast cells.
The effect of quinidine on growth kinetics was additionally assessed
using minimal liquid medium supplemented with quinidine.
A volume of
500 ml of this medium in 1-liter Erlenmeyer flasks
was inoculated with
cells that were either unadapted or previously
adapted to growth with
quinidine (3 mM). Cells in the inocula
were exponential-phase cells
harvested from quinidine-supplemented
or unsupplemented growth medium
at the standardized culture OD
600 of 0.2 ± 0.01. Cultures
were grown at 30°C with orbital agitation
(250 rpm), and growth was
monitored by measuring culture OD
600.
The concentration of
viable cells during yeast cultivation was
assessed as the number of CFU
on minimal medium agar plates (triplicate)
incubated at 30°C for 3 days. Under the standardized conditions
indicated above, the many
independent growth experiments carried
out gave rise to identical
growth
curves.
Subcellular localization of Yil120w-GFP fusion protein.
The
subcellular localization of Yil120wp was based on the observation, by
fluorescence microscopy, of the distribution of Yil120w-green
fluorescent protein (GFP) fusion protein in S. cerevisiae living cells. The YIL120w-GFP fusion plasmid was prepared by
using the multicopy expression vector pMET25_GFP, kindly provided by E. Boles (University of Düsseldorf, Düsseldorf, Germany), and the protocol described before (31). The two primers used
in the present work
(5'-GATACATAGATACAATTCTATTACCCCCATCCATACTCTAGAAAATGACCAAACAACAAACTTC-3' and
5'-GTGAAAAGTTCTTCTCCTTTACTCATACCAGCACCAGCGGCCGCCGTCGAAACTTTTTCTGAATTTT-3') were designed to have the first 44 bp complementary to the end of
the MET25 promoter (sequence underlined) followed by the
first 20 bp of ORF YIL120w, starting at the ATG. The 3'
primer was designed to have the first 44 bp complementary to the
beginning of the GFP gene (sequence underlined) followed by
the last 23 bp of ORF YIL120w before the stop codon, which
was not included.
Accumulation assays and energy-dependent efflux of
[9-3H]quinidine.
To estimate quinidine accumulation
and its eventual active export from yeast cells, cells of the wild type
or the
yil120w mutant were grown in minimal medium to an
OD600 of 0.7 ± 0.05 and then introduced into the same
medium supplemented with 3 mM quinidine or unsupplemented (initial pH
of the growth medium was adjusted to pH 5.5 with NaOH to consider the
alkalinizing effect of quinidine supplementation) and harvested, during
cultivation with orbital agitation at 30°C, at time zero (immediately
before inoculation), after 2 h of incubation or during exponential
growth, at the standardized culture OD600 of 0.2 ± 0.01. These cells were washed twice with ice-cold water and resuspended
in TM buffer (0.1 M MES [morpholineethanesulfonic acid; Sigma], 41 mM
Tris [Sigma] adjusted to pH 5.5 with HCl) to obtain dense cell
suspensions (OD600, 5.0 ± 0.1, equivalent to
approximately 2.2 mg [dry weight] ml
1). After 5 min of
incubation in buffer at 30°C with agitation (150 rpm), 0.2 µM
[9-3H]quinidine (ICN; 37 MBq/ml) was added to the cell
suspensions, and incubation proceeded for an additional 15 min, found
to be enough for reaching equilibrium. To follow intracellular
accumulation of labeled quinidine in the absence of glucose, 200 µl
of that cell suspension was taken at adequate time intervals, filtered through prewetted glass microfiber filters (Whatman GF/C), and washed
with ice-cold TM buffer, and the radioactivity was measured in a
Beckman LS 5000TD scintillation counter. The eventual active efflux of
the labeled quinidine, accumulated beforehand, was followed, after the
addition of a pulse of glucose (1%, wt/vol), by measuring cell
radioactivity for an additional period of 45 min. The effect on
quinidine-induced active efflux of the addition of 0.35 mM cycloheximide to the quinidine-supplemented growth medium was also
examined. Nonspecific [9-3H] quinidine adsorption to the
filters and to the cells (less than 5% of the total radioactivity) was
assessed and taken into consideration. The extracellular concentration
of labeled quinidine was estimated by the radioactivity of 100 µl of
the supernatant. To calculate the intracellular concentration of
labeled quinidine, the internal cell volume (Vi)
was considered constant and equal to 2.5 µl (mg [dry
weight])
1 (26). Transport assays were
repeated at least twice using cells from at least two independent
growth experiments. Results are means (± standard deviation) of these
repeats or are values from selected representative and complete experiments.
Intracellular pH.
The comparison of the average
intracellular pH (pHi) of wild-type and
yil120w exponential-phase cell populations grown in the
absence or presence of 3 mM quinidine and used to calculate
intracellular/extracellular quinidine concentrations was based on the
relative distribution of [2-14C]propionic acid between
the cytoplasm and the extracellular medium (26, 31) using
the same Vi used to estimate quinidine
intracellular concentration.
 |
RESULTS |
ORF YIL120w is an MDR determinant.
S.
cerevisiae W303.1b deleted for ORF YIL120w did not
display any evident growth phenotype on minimal medium. Also, we could not find any evidence for the involvement of Yil120wp in yeast resistance to benomyl, methotrexate,
4-nitroquinoline-N-oxide, crystal violet, malachite green,
cycloheximide, miconazole, or itraconazole, based on the
supplementation of minimal medium with inhibitory concentrations of
these compounds within the ranges of interest, as determined before
(7, 31). Susceptibility assays revealed, however, the
involvement of ORF YIL120w in yeast resistance to quinidine
(Fig. 1) but not to quinine, and to
ketoconazole and fluconazole, although the phenotypic differences with
fluconazole were more subtle (Fig. 1 and results not shown). These
conclusions were based on the increased resistance to the referred
compounds upon increased expression of this ORF in plasmid pFL38,
either in the deletion mutant or in the wild-type strain (Fig. 1).
Based on the resistance phenotype observed with quinidine, ORF
YIL120w was named QDR1.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
ORF YIL120w is required for resistance to
quinidine and ketoconazole. Comparison of susceptibility to the drugs,
at the indicated concentrations, of S. cerevisiae W303.lb
(wild type, WT) and the deletion mutant yil120w harboring
either recombinant plasmid pFL38_YIL120w (ORF
YIL120w inserted into pFL38) or the cloning vector. The cell
suspensions used to prepare the spots in lanes b and c were 1:2 and 1:4
dilutions of the cell suspension used in lanes a, respectively.
|
|
Effects of QDR1 expression level on quinidine-stressed
cultivation.
The role of QDR1 as a determinant of
resistance to quinidine in yeast cells was confirmed in minimal liquid
medium. The comparison of cell viability during cultivation of
unadapted wild-type and
qdr1 cells under mild stress
imposed by 3 mM quinidine indicated that QDR1 expression
reduced the period of adaptation to exponential growth with quinidine
by decreasing quinidine-induced death following sudden exposure of
these unadapted cells to the drug (Fig.
2). However, after this initial period of
adaptation, the exponential growth of both strains in the presence of 3 mM quinidine resumed, exhibiting indistinguishable kinetics independent
of QDR1 expression (Fig. 2). The increased expression of
QDR1 in a plasmid in the wild-type strain exerted additional
protection for growth under high quinidine stress (Fig.
3). At 3.8 mM quinidine supplementation and after 30 h of cultivation, the strain expressing wild-type levels of QDR1 did not recover from the initial period of
viability loss to resume exponential growth in the presence of the drug (Fig. 3). This contrasted with the behavior of the recombinant strain,
expressing increased levels of QDR1, which resumed growth after approximately 12 h of adaptation (Fig. 3).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of QDR1 gene expression on yeast
viability and growth under quinidine stress. Growth curves were
followed by (A) culture OD600 and (B) concentration of
viable cells. The growth curves of the wild-type ( , ) and the
deletion mutant qdr1 ( , ) in the absence ( , )
or presence of 3 mM quinidine ( , ) are compared. Cells used as
inoculum were exponential-phase cells cultivated in the absence of
quinidine. Viable cell values are the means of at least two independent
growth experiments done in triplicate.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of increased expression of QDR1 on
quinidine-stressed yeast growth. Comparison of the growth curves in
MM2-U medium supplemented with 3.5 mM (A) or 3.8 mM (B) quinidine of
the wild-type strain W303.lb transformed with the cloning vector pFL38
( ) or the recombinant plasmid pFL38_QDR1, with the
QDR1 gene inserted ( ). Cells used as inoculum were
exponential-phase cells grown in the absence of quinidine
supplementation.
|
|
The role of
QDR1 expression in alleviating the deleterious
effects of quinidine in unadapted yeast cells was not detectable
in
cells previously adapted to the drug (Fig.
4). Indeed, when
cells used as the
inoculum were previously adapted to growth with
3 mM quinidine by their
cultivation in the presence of the drug
to the standardized culture
OD
600 of 0.2, the growth curves of
the wild-type and the
mutant strain devoid of the
QDR1 gene in
the presence of
either 3 or 3.2 mM quinidine were absolutely coincident
(Fig.
4).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Quinidine effect on the growth curve of yeast cells
previously adapted to the drug is independent of QDR1 gene
expression. Comparison of the growth curves in minimal medium
supplemented with 3 mM (A and B) or 3.2 mM (C and D) quinidine of
S. cerevisiae W303.lb (wild type) ( ) and
qdr1 mutant ( ). Cells used as inoculum were
exponential-phase cells (at culture OD600 of 0.2 ± 0.01) cultivated in the absence of quinidine (A and C) or in the
presence of 3 mM quinidine (B and D).
|
|
Localization of Qdr1p-GFP fusion protein in plasma membrane.
The fluorescence of exponential-phase cells of S. cerevisiae
W303.1b expressing Qdr1-GFP fusion protein from plasmid
pMET25_YIL120w_GFP was predominantly localized to the cell
periphery, while control cells, expressing GFP alone from plasmid
pMET25_GFP, exhibited a slight and uniform distribution of
green fluorescence throughout the cell (Fig.
5), similar to the autofluorescence of
the host cells. The strong ring-like fluorescence staining around the
cell was observed for the majority of the cells from an
exponential-phase culture of transformants expressing Qdr1p-GFP protein
(Fig. 5B and C) but was absent from the control cells (Fig. 5A). As
observed before (31), some heterogeneity in the signal
intensity in the periphery of cells expressing Qdr1-GFP protein was
detected, possibly due to plasmid copy number differences. Since ORF
YIL120w was predicted to code for an integral membrane
protein (1, 19, 20, 22), these results strongly suggest
that Qdr1p is a plasma membrane protein.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
Fluorescence of exponential-phase cells of S. cerevisiae W303.lb (A) harboring the expression vector
pMET25_GFP (control cells) or (B and C) transformed with the
multicopy plasmid pMET25_YIL120w_GFP, indicating
that Qdr1-GFP fusion protein is found in the plasma membrane.
|
|
Quinidine-induced active efflux of drug: role of QDR1
gene expression.
Since Qdr1p was localized in the plasma membrane,
we examined its possible involvement in the reduction of quinidine
accumulation in the cell by active transport of the drug out of the
cell. After a pulse of glucose, both the
qdr1 mutant and
wild-type cells grown in the absence of quinidine supplementation were
unable to export the labeled quinidine that rapidly entered the cell beforehand and reached an intracellular concentration ranging from 1- to 1.6-fold the concentration in the surrounding medium (Fig. 6A, E,
and F). However, after 2 h of
cultivation in medium supplemented with 3 mM quinidine, wild-type cells
became capable of actively reducing the concentration of quinidine
accumulated in the cell before a glucose pulse (Fig. 6B). This rapid
induction of quinidine active export detected in wild-type cells was
impaired by the addition of cycloheximide to the growth medium with the drug (Fig. 6D), indicating that the observed phenomenon depends on de
novo protein synthesis induced by the drug. Evidence for the induction
of a putative quinidine transporter(s) were, however, not obtained
using cells devoid of QDR1 gene after the same 2 h of
incubation with the drug, being the values of quinidine accumulation, in the absence or presence of glucose, above the corresponding values
in the wild-type cells (Fig. 6B and C). These results were consistent
with our first expectations that QDR1 might encode an
H+-dependent exporter for quinidine, thus modulating the
concentration of the drug accumulated in the cell. However, after a
more extended period of adaptation to quinidine, the more susceptible
qdr1 culture also resumed exponential growth (Fig. 2),
and the quinidine-adapted exponential-phase cells devoid of
QDR1, harvested at the standardized culture
OD600 of 0.2, were also capable of active expulsion of the
quinidine accumulated beforehand (Fig. 6H). Nevertheless, the amount of
quinidine accumulated in
qdr1 cells in the absence of
glucose was significatively above that accumulated in wild-type cells
(threefold compared with twofold), although, at the equilibrium following the glucose pulse, the concentration of labeled quinidine accumulated in the deletion mutant reached a value closer to the corresponding wild-type value (Fig. 6F and H).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Time course of [9-3H]quinidine
accumulation in the absence of glucose ( , , ) and its eventual
subsequent expulsion after a glucose (Glc) pulse ( , , ).
Quinidine accumulation values are means or representative values of at
least two independent experiments using cells of wild-type (wt) ( ,
, , ) or qdr1 ( , ) strains that had been
grown in the absence of quinidine (QD), used to inoculate
quinidine-supplemented or unsupplemented media, and harvested during
the growth curves documented in Fig. 2 at time zero (A), after 2 h of
cultivation in quinidine-supplemented medium (B and C), and at the
exponential phase (exp) (culture OD600 of 0.2) of
cultivation in unsupplemented medium (E and G) or
quinidine-supplemented medium (F and H). In panel D we show the results
obtained using wild-type cells incubated for 2 h in the absence
( , ) (as in B) or presence ( , ) of 0.35 mM cycloheximide
(CYH).
|
|
The cells used in the accumulation-active efflux assays were harvested
at the same standardized culture OD
600 of 0.2. In spite
of
the attempt to standardize the cell populations examined, it
is clear
from the viability curves in Fig.
2 that these populations
exhibit a
slightly different number of viable cells. This value
was minimal for
the quinidine-susceptible
qdr1 population grown
with
quinidine and maximal for both the wild-type and the
qdr1 populations grown in the absence of stress and shows an intermediate
value for the quinidine-stressed wild-type population. Moreover,
the
average pH
i values for quinidine-stressed
exponential-phase
populations (6.4 ± 0.02 and 6.2 ± 0.02 for the wild type and mutant,
respectively) were below the value in
unstressed cell populations
(6.6 ± 0.02 for both the wild type
and mutant), reaching the lowest
value in the stressed
qdr1 mutant. We conclude that the stress
imposed by
quinidine on yeast cells led to a slight global acidification
of the
cell interior, even though the accumulation of this weak
base is more
compatible with alkalization of the cell interior.
Since yeast growth
medium is acidic (pH 5.5), these results strongly
suggest that
quinidine led to plasma membrane permeabilization
with a consequent
increase in the H
+ influx rate. The relative average
pH
i estimates are
consistent with lower
susceptibility to the deleterious effects
of quinidine of the unadapted
wild-type population compared with
the deletion mutant
qdr1 population. They are also consistent
with the
passive accumulation of labeled quinidine being minimal
for both the
wild-type and
qdr1 cell populations grown in the
absence
of quinidine and maximal for the
qdr1 mutant cell
population
grown with the drug, as it would be expected from the higher
protonation
of this weak base in the more acidic cell
interior.
 |
DISCUSSION |
As predicted from structural considerations (1, 16, 19, 20,
22), we show results indicating that the MFS-MDR homologue encoded by ORF YIL120w, here named QDR1, is an
MDR determinant. Indeed, the expression of QDR1 was
implicated in yeast resistance to ketoconazole, fluconazole, and
quinidine, but not its stereoisomer quinine. Like Yil120wp, the first
MFS-MDR homologue implicated in quinidine resistance,
Yor273cp, belongs to the 12-spanner family 1, although to a
different cluster of proteins (16, 19, 22). ORF
YOR273c was identified based on functional overexpression in
a hypersensitive S. cerevisiae strain of genes from a yeast genomic library and selection of transformants that grew in the presence of elevated levels of quinidine (11). However,
the authors failed to isolate ORF YIL120w in this screening;
among other reasons, it is possible that the conditions used for their screen might have been too stringent. Interestingly, Yor273cp is also
very specific for quinidine, displaying no cross-resistance to any of
the other quinoline-containing antimalarial drugs tested, including
quinine and chloroquine (11), which could not be tested in
the present work due to very high concentrations of chloroquine necessary for growth inhibition of the yeast strains examined. On the
basis of high sequence homology of Yil120wp with other putative drug
transporters of the MFS and of its subcellular localization, QDR1 was expected to encode an H+-dependent
exporter for quinidine through the plasma membrane. However, we show
results that do not confirm this mode of action. Indeed, the
differences registered in the active efflux of quinidine from cells of
the wild type and the mutant devoid of the QDR1 gene were
essentially detected during the initial period of adaptation to the
drug, while exponential-phase cells of both strains adapted to the drug
were able to actively pulse quinidine out of the cell. The detection of
an active quinidine efflux in the wild-type population but not in the
population devoid of QDR1 after the same 2 h of incubation following the sudden exposure of cells to quinidine may be
the result of the higher susceptibility of the unadapted
qdr1 population, revealed by the higher quinidine-induced
viability loss during this adaptation period. In fact, after surpassing a shorter or longer initial period of adaptation, exponential growth
with quinidine was resumed in both populations, and these adapted cells
became capable of active expulsion of the drug independent of
QDR1 expression. It is intriguing why quinidine, which is
not present in the yeast natural environment, may induce its active expulsion from cells which are actively dividing in its presence. QDR1 gene transcription levels do not increase in cells
cultivated with quinidine (P. Nunes, M. Teixeira, and I. Sá-Correia, unpublished results), consistent with other
indications suggesting that this gene is not involved in the induction
of quinidine export by the drug. Nevertheless, the level of expression
of QDR1 is critical to surpass the viability loss during the
initial period of adaptation to quinidine and to eventually resume
exponential growth, which depends on the remaining viable population.
Results also suggest that there are other resistance mechanisms that
can be used when QDR1 is absent, possibly involving other
MFS-MDR and/or ABC transporters.
Quinidine accumulation assays were carried out at an external pH of
5.5, and the uptake of labeled quinidine into the yeast cell was
extremely rapid. However, at this pH quinidine, which is a weak base
with two protonation sites with pKas of 5.4 and 10.0 (8), is basically in the singly protonated form and not in
the highly lipophilic unprotonated form which would pass freely through
biological membranes by passive diffusion. A very rapid uptake rate of
chloroquine into Plasmodium cells was also observed phase
and a similar question was raised (10, 13, 15). The internal pH (pHi) of exponential-phase yeast
cells was estimated to be within the range from 6.2 to 6.6, depending
on the presence or absence of the drug or of a functional
QDR1 gene; cells grown under quinidine stress exhibited an
average pHi slightly below the
pHi of cells grown in the absence of drug. This
observation is consistent with the disturbing effect of quinidine on
plasma membrane spatial organization and the consequent increase in
H+ passive influx, with the acidification of the interior
of cells incubated at pH 5.5, even though quinidine accumulation,
presumably into the slightly acidic yeast vacuole (9, 10, 15,
18), is expected to lead to alkalinization. At high
concentrations, chloroquine also has a demonstrable negative effect on
Plasmodium membrane stability, and the protonated form may
interact with various phospholipids by both hydrophobic and
electrostatic forces (15). Therefore, the slightly lower
pHi exhibited by the exponential-phase
qdr1 population compared with the wild-type population,
both grown under identical quinidine stress, is consistent with the
higher susceptibility of unadapted cells devoid of QDR1 to
the deleterious effects of quinidine during the initial period of
adaptation to the drug. Since the average pHi of
the
qdr1 population used in the accumulation-active
efflux assays was slightly below the average pHi
of the wild-type population harvested at the same culture OD
(pHi 6.2 compared with 6.4), the higher
accumulation of quinidine in the absence of glucose into the more
acidic interior of
qdr1 cells may merely be a consequence of the weak base properties of this drug. This hypothesis is also consistent with the apparently unexpected lower intracellular accumulation of quinidine (around onefold) in exponential-phase cells
of both strains grown in the absence of quinidine compared with the
values calculated for quinidine-adapted cells with a more acidic
interior (two- or threefold).
Studies carried out before to gain some understanding of how another
plasma membrane MFS-MDR homologue, encoded by ORF YGR224w (AZR1 gene), facilitates yeast adaptation to inhibitory
concentrations of acetic acid also failed to directly implicate this
protein in the active export of acetate (31). It is
possible that a number of the MFS-MDR homologues may play other roles
in yeast cells than detoxification, such as the transport of a specific molecule unrelated to the drugs to which they confer resistance. This
is apparently the case for polyamine transport by YlI028cp (32) or the transport of dityrosine precursors by Ybr180wp
Dtr1p (12). It is possible that Qdr1p could alter ion
fluxes that indirectly control drug accumulation in yeast cells by
affecting pH and/or membrane potential (25). Further
studies are required to find out the natural physiological role of
Qdr1p as a plasma membrane transporter of the MFS and to establish the
precise biochemical mechanisms whereby this putative transporter
functions in alleviating the toxic effects of, at least, quinidine,
ketoconazole, and fluconazole in S. cerevisiae. The
elucidation of these mechanisms may provide useful information for the
understanding of the physiological functions of the poorly
characterized family of MFS-MDR transporters that have largely escaped
identification by classical approaches. The quinidine concentrations
used in the present work to inhibit yeast growth were much higher than
the one required for killing Plasmodium cells, consistent
with the idea that the antimalarial effects of quinoline
ring-containing drugs are exerted via physiological processes that do
not exist in S. cerevisiae (10, 15). However, the expression in yeast cells of the P. faciparum pfmdr1
gene, a member of the ABC superfamily of transporters that confers
resistance to multiple antimalarials in the malaria parasite
(24), was associated with decreased cellular accumulation
and a concomitant increase in resistance to quinoline-containing drugs
in yeast transformants (28). Nevertheless, it is clear
that this gene cannot also be the sole cause of chloroquine resistance
in P. falciparum (30). Since the mechanisms of
multidrug resistance are apparently conserved among phylogenetically
distant organisms (4, 6, 10, 22), the characterization of
drug resistance determinants and of the mechanisms of multidrug
resistance in yeast cells may contribute to the understanding of these
mechanisms in more complex and less easily accessible eukaryotes, such
as those underlying the resistance to quinoline-containing drugs in the
malaria parasite.
 |
ACKNOWLEDGMENTS |
We thank R. Nelhas and R. Vargas for their contribution to ORF
YIL120w disruption and QDR1 gene cloning.
This research was supported by the European Union BIOTECH EUROFAN I and
II projects (contracts BIO4-CT95-0080 and BIO4-CT97-2294) and by
Fundação para a Ciência e Tecnologia, FEDER, and
PRAXIS XXI Programme (projects PRAXIS/PCN/C/BIO/79/96 and Ph.D.
[BD/9633/96] and M.Sc. [BM/19146/99] scholarships to S. Tenreiro
and P. Nunes, respectively).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centro de
Engenharia Biológia e Química, Instituto Superior
Técnico, Av. Rovisco Pais, 1049-001 Lisbon, Portugal.
Phone: 351-218417682. Fax: 351-218480072. E-mail:
pcisc{at}popsrv.ist.utl.pt.
 |
REFERENCES |
| 1.
|
André, B.
1995.
An overview of membrane transport proteins in Saccharomyces cerevisiae.
Yeast
11:1575-1611[CrossRef][Medline].
|
| 2.
|
Balzi, E., and A. Goffeau.
1994.
Genetics and biochemistry of yeast multidrug resistance.
Biochim. Biophys. Acta
1187:152-162[Medline].
|
| 3.
|
Balzi, E., and A. Goffeau.
1995.
Yeast multidrug resistance: the PDR network.
J. Bioenerg. Biomembr.
27:71-76[CrossRef][Medline].
|
| 4.
|
Bolhuis, H.,
H. W. van Veen,
B. Poolman,
A. J. Driessen, and W. N. Konings.
1997.
Mechanisms of multidrug transporters.
FEMS Microbiol. Rev.
21:55-84[CrossRef][Medline].
|
| 5.
|
Bonneaud, N.,
O. Ozier-Kalogeropoulos,
G. Y. Li,
M. Labouesse,
L. Minvielle-Sebastia, and F. Lacroute.
1991.
A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors.
Yeast
7:609-615[CrossRef][Medline].
|
| 6.
|
Borst, P., and M. Ouellete.
1995.
New mechanisms of drug resistance in parasitic protozoa.
Annu. Rev. Microbiol.
49:427-460[CrossRef][Medline].
|
| 7.
|
Brôco, N.,
S. Tenreiro,
C. A. Viegas, and I. Sá- Correia.
1999.
FLR1 gene (ORF YBR008c) is required for benomyl and methotrexate resistance in Saccharomyces cerevisiae and its benomyl-induced expression is dependent on Pdr3 transcriptional regulator.
Yeast
15:1595-1608[CrossRef][Medline].
|
| 8.
|
Budavari, S.
1996.
The Merck Index, 12th ed.
Merck & Co., Inc., Whitehouse Station, N.J.
|
| 9.
|
Carmelo, V.,
H. Santos, and I. Sá- Correia.
1997.
Effect of extracellular acidification on the activity of plasma membrane ATPase and on the cytosolic and vacuolar pH of Saccharomyces cerevisiae.
Biochim. Biophys. Acta
1325:63-70[Medline].
|
| 10.
|
Cowman, A. F.
1997.
The mechanisms of drug action and resistance in malaria, p. 221-246.
In
J. D. Hayes, and C. R. Wolf (ed.), Molecular genetics of drug resistance. Harwood Academic Publishers, Amsterdam, The Netherlands.
|
| 11.
|
Delling, U.,
M. Raymond, and E. Schurr.
1998.
Identification of Saccharomyces cerevisiae genes conferring resistance to quinoline ring-containing antimalarial drugs.
Antimicrob. Agents Chemother.
42:1034-1041[Abstract/Free Full Text].
|
| 12.
|
Felder, T.,
S. Tenreiro,
I. Sá- Correia,
M. Breitenbach, and P. Briza.
1999.
Biosynthesis of the yeast ascopore wall: identification of a membrane transporter of dityrosine-containing spore wall precursors.
Curr. Genet.
35:272.
|
| 13.
|
Ferrari, V., and D. J. Cuther.
1991.
Simulation of kinetic data on the influx and efflux of chloroquine by erythrocytes infected with Plasmodium falciparum: evidence for a drug-importer in chloroquine-sensitive strains.
Biochem. Pharmacol.
42:5167-5179.
|
| 14.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 15.
|
Ginsburg, H., and T. G. Geary.
1987.
Current concepts and new ideas on the mechanism of action of quinoline-containing antimalarials.
Biochem. Pharmacol.
36:1567-1576[CrossRef][Medline].
|
| 16.
|
Goffeau, A.,
J. Park,
I. T. Paulsen,
J. L. Jonniaux,
T. Dinh,
P. Mordant, and M. H. Saier, Jr.
1997.
Multidrug-resistant transport proteins in yeast: complete inventory and phylogenetic characterization of yeast open reading frames within the major facilitator superfamily.
Yeast
13:43-54[CrossRef][Medline].
|
| 17.
|
Güldener, U.,
S. Heccks,
T. Fiedler,
J. Beinhauer, and J. Hegemann.
1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
24:2519-2524[Abstract/Free Full Text].
|
| 18.
|
Klionsky, D. J.,
P. K. Herman, and S. D. Emr.
1990.
A fungal vacuole: composition, function, and biogenesis.
Microbiol. Rev.
54:266-292[Abstract/Free Full Text].
|
| 19.
|
Nelissen, B.,
R. De Wachter, and A. Goffeau.
1997.
Classification of all putative permeases and other membrane plurispanners of the major facilitator superfamily encoded by the complete genome of Saccharomyces cerevisiae.
FEMS Microbiol. Rev.
21:113-134[CrossRef][Medline].
|
| 20.
|
Nelissen, B.,
P. Mordant,
J. L. Jonniaux,
R. De Wachter, and A. Goffeau.
1995.
Phylogenetic classification of the major superfamily of membrane transport facilitators, as deduced from yeast genome sequencing.
FEBS Lett.
377:232-236[CrossRef][Medline].
|
| 21.
|
Paulsen, I. T.,
M. H. Brown, and R. A. Skurray.
1996.
Proton-dependent multidrug efflux systems.
Microbiol. Rev.
60:75-608.
|
| 22.
|
Paulsen, I. T.,
M. K. Slinwinski,
B. Nelissen,
A. Goffeau, and M. H. Saier, Jr.
1998.
Unified inventory of established and putative transporters encoded within the complete genome of Saccharomyces cerevisiae.
FEBS Lett.
430:116-125[CrossRef][Medline].
|
| 23.
|
Peters, W.
1987.
Chemotherapy and drug resistance in malaria, 2nd ed.
Academic Press, London, U.K.
|
| 24.
|
Reed, M. B.,
K. J. Saliba,
S. R. Caruana,
K. Kirk, and A. F. Cowman.
2000.
Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum.
Nature
403:906-909[CrossRef][Medline].
|
| 25.
|
Roepe, P. D.,
L. Wei,
M. M. Hoffman, and F. Fritz.
1996.
Altered drug translocation mediated by the MDR protein: direct, indirect or both?
J. Bioenerg. Biomembr.
28:541-554[CrossRef][Medline].
|
| 26.
|
Rosa, M. F., and I. Sá- Correia.
1996.
Intracellular acidification does not account for inhibition of Saccharomyces cerevisiae growth in the presence of ethanol.
FEMS Microbiol. Lett.
135:271-274[CrossRef][Medline].
|
| 27.
|
Rothstein, R.
1991.
Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast.
Methods Enzymol.
194:281-301[CrossRef][Medline].
|
| 28.
|
Ruetz, S.,
U. Delling,
M. Brault,
E. Schurr, and P. Gros.
1996.
The pfmdr1 gene of Plasmodium falciparum confers cellular resistance to antimalarial drugs in yeast cells.
Proc. Natl. Acad. Sci. USA
93:9942-9947[Abstract/Free Full Text].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 30.
|
Su, X.-Z.,
L. A. Kirkman,
H. Fujioka, and T. E. Wellems.
1997.
Complex polymorphisms in an ~330 kDa protein are linked to chloroquine-resistance P. falciparium in Southeast Asia and Africa.
Cell
91:593-603[CrossRef][Medline].
|
| 31.
|
Tenreiro, S.,
P. C. Rosa,
C. A. Viegas, and I. Sá- Correia.
2000.
Expression of the AZR1 gene (ORF YGR224w), encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and resistance to azoles in Saccharomyces cerevisiae.
Yeast
16:1469-1481[CrossRef][Medline].
|
| 32.
|
Tomitori, H.,
K. Kashiwagi,
K. Sakata,
Y. Kakinuma, and K. Igarashi.
1999.
Identification of a gene for a polyamine transport protein in yeast.
J. Biol. Chem.
274:3265-3267[Abstract/Free Full Text].
|
| 33.
|
Wach, A.,
A. Brachat,
R. Pohlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[CrossRef][Medline].
|
Antimicrobial Agents and Chemotherapy, May 2001, p. 1528-1534, Vol. 45, No. 5
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.5.1528-1534.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
dos Santos, S. C., Tenreiro, S., Palma, M., Becker, J., Sa-Correia, I.
(2009). Transcriptomic Profiling of the Saccharomyces cerevisiae Response to Quinine Reveals a Glucose Limitation Response Attributable to Drug-Induced Inhibition of Glucose Uptake. Antimicrob. Agents Chemother.
53: 5213-5223
[Abstract]
[Full Text]
-
Rodaki, A., Bohovych, I. M., Enjalbert, B., Young, T., Odds, F. C., Gow, N. A.R., Brown, A. J.P.
(2009). Glucose Promotes Stress Resistance in the Fungal Pathogen Candida albicans. Mol. Biol. Cell
20: 4845-4855
[Abstract]
[Full Text]
-
Vargas, R. C., Garcia-Salcedo, R., Tenreiro, S., Teixeira, M. C., Fernandes, A. R., Ramos, J., Sa-Correia, I.
(2007). Saccharomyces cerevisiae Multidrug Resistance Transporter Qdr2 Is Implicated in Potassium Uptake, Providing a Physiological Advantage to Quinidine-Stressed Cells. Eukaryot Cell
6: 134-142
[Abstract]
[Full Text]
-
Velasco, I., Tenreiro, S., Calderon, I. L., Andre, B.
(2004). Saccharomyces cerevisiae Aqr1 Is an Internal-Membrane Transporter Involved in Excretion of Amino Acids. Eukaryot Cell
3: 1492-1503
[Abstract]
[Full Text]
-
Vargas, R. C., Tenreiro, S., Teixeira, M. C., Fernandes, A. R., Sa-Correia, I.
(2004). Saccharomyces cerevisiae Multidrug Transporter Qdr2p (Yil121wp): Localization and Function as a Quinidine Resistance Determinant. Antimicrob. Agents Chemother.
48: 2531-2537
[Abstract]
[Full Text]
-
Felder, T., Bogengruber, E., Tenreiro, S., Ellinger, A., Sa-Correia, I., Briza, P.
(2002). Dtr1p, a Multidrug Resistance Transporter of the Major Facilitator Superfamily, Plays an Essential Role in Spore Wall Maturation in Saccharomyces cerevisiae. Eukaryot Cell
1: 799-810
[Abstract]
[Full Text]
-
Keller, G., Ray, E., Brown, P. O., Winge, D. R.
(2001). Haa1, a Protein Homologous to the Copper-regulated Transcription Factor Ace1, Is a Novel Transcriptional Activator. J. Biol. Chem.
276: 38697-38702
[Abstract]
[Full Text]