This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nunes, P. A.
Right arrow Articles by Sá-Correia, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nunes, P. A.
Right arrow Articles by Sá-Correia, I.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, May 2001, p. 1528-1534, Vol. 45, No. 5
0066-4804/01/$04.00+0   DOI: 10.1128/AAC.45.5.1528-1534.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Resistance and Adaptation to Quinidine in Saccharomyces cerevisiae: Role of QDR1 (YIL120w), Encoding a Plasma Membrane Transporter of the Major Facilitator Superfamily Required for Multidrug Resistance

Patrícia A. Nunes, Sandra Tenreiro, and Isabel Sá-Correia*

Centro de Engenharia Biológia e Química, Instituto Superior Técnico, 1049-001 Lisbon, Portugal

Received 11 December 2000/Returned for modification 22 January 2001/Accepted 20 February 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

As predicted based on structural considerations, we show results indicating that the member of the major facilitator superfamily encoded by Saccharomyces cerevisiae open reading frame YIL120w is a multidrug resistance determinant. Yil120wp was implicated in yeast resistance to ketoconazole and quinidine, but not to the stereoisomer quinine; the gene was thus named QDR1. Qdr1p was proved to alleviate the deleterious effects of quinidine, revealed by the loss of cell viability following sudden exposure of the unadapted yeast population to the drug, and to allow the earlier eventual resumption of exponential growth under quinidine stress. However, QDR1 gene expression had no detectable effect on the susceptibility of yeast cells previously adapted to quinidine. Fluorescence microscopy observation of the distribution of the Qdr1-green fluorescent protein fusion protein in living yeast cells indicated that Qdr1p is a plasma membrane protein. We also show experimental evidence indicating that yeast adaptation to growth with quinidine involves the induction of active expulsion of the drug from preloaded cells, despite the fact that this antiarrhythmic and antimalarial quinoline ring-containing drug is not present in the yeast natural environment. However, we were not able to prove that Qdr1p is directly implicated in this export. Results clearly suggest that there are other unidentified quinidine resistance mechanisms that can be used in the absence of QDR1.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Several transport systems play an important role in conferring multiple drug resistance (MDR), presumably due to the catalysis of energy-dependent extrusion of a large number of structurally and functionally unrelated compounds out of the cells (3, 4, 25). In Saccharomyces cerevisiae, the proton motive force-dependent multidrug efflux systems belong to the major facilitator superfamily (MFS) (21, 22). Other known determinants associated with MDR are other membrane transporters belonging to the ATP binding cassette (ABC) superfamily, which utilize ATP hydrolysis to drive drug extrusion, and factors for transcriptional regulation of all these putative multidrug transporters (2). On the basis of the complete yeast genome sequence, the MFS-MDR homologues comprise a large number of proteins that have escaped identification by classical approaches (16, 19, 22). However, the involvement of the vast majority as MDR determinants remains unknown.

Within the context of the European Functional Analysis Network (EUROFAN), we have identified open reading frame (ORF) YIL120w, encoding an MFS-MDR homologue, as a determinant of resistance to quinidine. The gene, named QDR1, also confers resistance to (at least) ketoconazole. These conclusions were based on the higher susceptibility to these compounds of the deletion mutant Delta qdr1 compared with the wild-type strain and on the increased resistance of both strains upon increased expression of QDR1 from a centromeric plasmid clone. A distinct MFS-MDR homologue encoded by S. cerevisiae ORF YOR273c was previously demonstrated to confer resistance to quinidine in yeast cells by using a different approach (11). The strategy used was based on S. cerevisiae transformation with a yeast genomic library and selection for resistance to elevated levels of quinidine. The only ORF encoding a member of the MFS-MDR identified was YOR273c, therefore failing the identification of ORF YIL120w.

The emergence of drug-resistant strains of Plasmodium falciparum is an obstacle in malaria control (10, 23). The antimalarial effects of quinoline ring-containing drugs are exerted in Plasmodium cells via physiological mechanisms that do not exist in yeast cells (10, 15), and the mechanisms of resistance in S. cerevisiae may not apply to the malaria parasite. However, the mechanisms of drug resistance have been conserved among phylogenetically distant organisms (4, 6, 10, 22), and experimental evidence suggests that the mechanisms of action of quinoline ring-containing drugs in P. falciparum are independent of the mechanisms of resistance (10). During the present study, we tried to gain some understanding of how Yil120wp confers resistance to quinidine, used for the treatment of life-threatening infections with P. falciparum and as an antiarrhythmic agent (http://www.rxmed.com/monographs/quinidin2.html). The role of QDR1 in alleviating the deleterious effects of quinidine on unadapted yeast cells suddenly exposed to the drug was examined. Although the adaptation of yeast cells to growth in the presence of quinidine involves induction of active efflux of quinidine out of the cell, we were not able to prove that Qdr1p is directly implicated in this transport across the plasma membrane, where this protein was localized by fluorescence microscopy.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Strains, media, and general methods. Disruption of ORF YIL120w was carried out in two S. cerevisiae strains: FY73 (MATalpha ura3-52 his3Delta 200 GAL2+), closely related to the sequenced strain FY1679, and W303.1b (MATalpha ura3-1 leu2-3,112, his3-11,15,15 trp1-1 ade1-2 can1-100), another EUROFAN strain, used extensively in our laboratory to assess drug susceptibility phenotypes (7, 31). Escherichia coli strains and the routine growth media used were described before (7, 31). Cloning procedures were carried out by standard methods (29). Transformation of yeast cells was performed by the method of Gietz et al. (14), slightly modified.

Disruption and cloning of ORF YIL120w. Disruption of ORF YIL120w in S. cerevisiae FY73 was performed using a disruption cassette, consisting of the dominant resistance marker loxP-kanMX4-loxP flanked by short flanking homology regions to the target ORF. This was prepared by DNA amplification by PCR, using plasmid pUG6 (17, 33) as a template and the following primers: 5'-ATG ACCAAACAACAAACTTCTGTAATGCGTAACGCATCTATAGCCAAGG CGGCCGCTTCGTACGCTGCAGGTCGAC-3' and 5'-GTTATAAAATATA GATATCTGTTTCTGGAAAGTGGGGGCAGAGACGCGGCCGCGCATA GGCCACTAGTGGATCTG-3', where the sequence complementary to pUG6 is underlined. These primers included at the 5' end 48 and 45 nucleotides, respectively, homologous to the flanking region of the ORF followed by the NotI site and, at the 3' end, 20 and 22 nucleotides, respectively, homologous to pUG6. The PCR product of 1,690 bp, generated using the amplification conditions described before (7), was purified and used to transform strain FY73. Transformants were selected on YPD plates with geneticin (200 mg/liter), and the correct replacement of the gene was confirmed by two independent PCRs (7).

A replacement cassette was also prepared to be used for systematic inactivation of ORF YIL120w in any S. cerevisiae strain, in particular strain W303.1b, by creating longer homologous sequences on both sides of the loxP-kanMX4-loxP module. This YIL120w replacement cassette (long flanking homology) was obtained by PCR amplification with Pwo using genomic DNA isolated from the deletant strain and the following primers: 5'-GGCGCATGCGACATCTACGGCTACGGGAT-3' and 5'-GCGGCATGCTGGATACCAAAGGAGAACCA-3', designed to be located 765 and 872 bp upstream and downstream of the start and the stop codon, respectively. The PCR product was cloned in the SphI site of pFL38 (5), generating plasmid pYORC_YIL120w.

ORF YIL120w was cloned by the gap repair technique (27) into pFL38, using plasmid pYORC_YIL120w, as described before (7), giving rise to plasmid pFL38_YIL120w.

Growth media and drug susceptibility tests. The susceptibility tests for several metabolic inhibitors were carried out first by comparing the susceptibilities of the wild-type strain (W303.1b) and the mutant Delta yil120w strain (W303.1b Delta yil120w). Whenever a consistent phenotype was detected, these tests were followed by comparison of the susceptibility of the wild-type (W303.1b) and the mutant Delta yil120w strain transformed with pFL38_YIL120w or the cloning vector. Cells were grown on minimal medium (MM2 or MM2 lacking uracil [MM2-U] for plasmid maintenance) agar plates supplemented with suitable concentrations of the different compounds. MM2 medium contained (per liter): 1.7 g of yeast nitrogen base without amino acids or NH4+ (Difco), 20 g of glucose, 2.65 g of (NH4)2SO4, 80 mg of adenine, 10 mg of histidine, 10 mg of leucine, 20 mg of tryptophan, and 20 mg of uracil. The ranges of drug concentrations tested in agar plates were 0.11 to 0.18 µM for cycloheximide, 52 to 69 µM for benomyl, 22 to 35 µM for methotrexate, and 0.9 to 1.1 µM for 4-nitroquinoline-N-oxide (all from Sigma, stock dissolved in dimethyl sulfoxide [DMSO]); 3.7 to 6.1 µM for crystal violet and 3.2 to 5.4 µM for malachite green (obtained from Merck, dissolved in water); 2.3 to 3.0 µM for fluconazole (Diflucan, in saline solution); 1.4 to 2.8 µM for itraconazole and 1.9 to 2.9 µM for ketoconazole (kindly supplied by Janssen Research Foundation, dissolved in DMSO); 24 to 100 nM for miconazole (Sigma, stock in DMSO); 3.0 to 4.0 mM for quinine and 3.0 to 3.8 mM for quinidine (sulfate salt dehydrate) (both from Sigma, dissolved in 70% ethanol). DMSO and ethanol concentrations in the growth media (including the control medium lacking the growth inhibitors) were kept below 0.1% (wt/vol) and 1.4% (vol/vol), respectively; these concentrations had no detectable effect on yeast growth kinetics. Cells used to inoculate the agar plates were mid-exponential-phase cells grown without drugs until a culture optical density at 600 nm (OD600) of 0.2 ± 0.02 was reached and resuspended in sterile H2O to obtain cell suspensions with an OD600 of 0.05 ± 0.005. These and diluted (1:2 and 1:4) cell suspensions were applied as spots (4 µl) onto the surface of the agar media and incubated at 30°C for 3 to 5 days, depending on the severity of growth inhibition. Conclusions on drug susceptibility were based on consistent results from several independent spot assay experiments carried out with recently transformed yeast cells.

The effect of quinidine on growth kinetics was additionally assessed using minimal liquid medium supplemented with quinidine. A volume of 500 ml of this medium in 1-liter Erlenmeyer flasks was inoculated with cells that were either unadapted or previously adapted to growth with quinidine (3 mM). Cells in the inocula were exponential-phase cells harvested from quinidine-supplemented or unsupplemented growth medium at the standardized culture OD600 of 0.2 ± 0.01. Cultures were grown at 30°C with orbital agitation (250 rpm), and growth was monitored by measuring culture OD600. The concentration of viable cells during yeast cultivation was assessed as the number of CFU on minimal medium agar plates (triplicate) incubated at 30°C for 3 days. Under the standardized conditions indicated above, the many independent growth experiments carried out gave rise to identical growth curves.

Subcellular localization of Yil120w-GFP fusion protein. The subcellular localization of Yil120wp was based on the observation, by fluorescence microscopy, of the distribution of Yil120w-green fluorescent protein (GFP) fusion protein in S. cerevisiae living cells. The YIL120w-GFP fusion plasmid was prepared by using the multicopy expression vector pMET25_GFP, kindly provided by E. Boles (University of Düsseldorf, Düsseldorf, Germany), and the protocol described before (31). The two primers used in the present work (5'-GATACATAGATACAATTCTATTACCCCCATCCATACTCTAGAAAATGACCAAACAACAAACTTC-3' and 5'-GTGAAAAGTTCTTCTCCTTTACTCATACCAGCACCAGCGGCCGCCGTCGAAACTTTTTCTGAATTTT-3') were designed to have the first 44 bp complementary to the end of the MET25 promoter (sequence underlined) followed by the first 20 bp of ORF YIL120w, starting at the ATG. The 3' primer was designed to have the first 44 bp complementary to the beginning of the GFP gene (sequence underlined) followed by the last 23 bp of ORF YIL120w before the stop codon, which was not included.

Accumulation assays and energy-dependent efflux of [9-3H]quinidine. To estimate quinidine accumulation and its eventual active export from yeast cells, cells of the wild type or the Delta yil120w mutant were grown in minimal medium to an OD600 of 0.7 ± 0.05 and then introduced into the same medium supplemented with 3 mM quinidine or unsupplemented (initial pH of the growth medium was adjusted to pH 5.5 with NaOH to consider the alkalinizing effect of quinidine supplementation) and harvested, during cultivation with orbital agitation at 30°C, at time zero (immediately before inoculation), after 2 h of incubation or during exponential growth, at the standardized culture OD600 of 0.2 ± 0.01. These cells were washed twice with ice-cold water and resuspended in TM buffer (0.1 M MES [morpholineethanesulfonic acid; Sigma], 41 mM Tris [Sigma] adjusted to pH 5.5 with HCl) to obtain dense cell suspensions (OD600, 5.0 ± 0.1, equivalent to approximately 2.2 mg [dry weight] ml-1). After 5 min of incubation in buffer at 30°C with agitation (150 rpm), 0.2 µM [9-3H]quinidine (ICN; 37 MBq/ml) was added to the cell suspensions, and incubation proceeded for an additional 15 min, found to be enough for reaching equilibrium. To follow intracellular accumulation of labeled quinidine in the absence of glucose, 200 µl of that cell suspension was taken at adequate time intervals, filtered through prewetted glass microfiber filters (Whatman GF/C), and washed with ice-cold TM buffer, and the radioactivity was measured in a Beckman LS 5000TD scintillation counter. The eventual active efflux of the labeled quinidine, accumulated beforehand, was followed, after the addition of a pulse of glucose (1%, wt/vol), by measuring cell radioactivity for an additional period of 45 min. The effect on quinidine-induced active efflux of the addition of 0.35 mM cycloheximide to the quinidine-supplemented growth medium was also examined. Nonspecific [9-3H] quinidine adsorption to the filters and to the cells (less than 5% of the total radioactivity) was assessed and taken into consideration. The extracellular concentration of labeled quinidine was estimated by the radioactivity of 100 µl of the supernatant. To calculate the intracellular concentration of labeled quinidine, the internal cell volume (Vi) was considered constant and equal to 2.5 µl (mg [dry weight])-1 (26). Transport assays were repeated at least twice using cells from at least two independent growth experiments. Results are means (± standard deviation) of these repeats or are values from selected representative and complete experiments.

Intracellular pH. The comparison of the average intracellular pH (pHi) of wild-type and Delta yil120w exponential-phase cell populations grown in the absence or presence of 3 mM quinidine and used to calculate intracellular/extracellular quinidine concentrations was based on the relative distribution of [2-14C]propionic acid between the cytoplasm and the extracellular medium (26, 31) using the same Vi used to estimate quinidine intracellular concentration.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

ORF YIL120w is an MDR determinant. S. cerevisiae W303.1b deleted for ORF YIL120w did not display any evident growth phenotype on minimal medium. Also, we could not find any evidence for the involvement of Yil120wp in yeast resistance to benomyl, methotrexate, 4-nitroquinoline-N-oxide, crystal violet, malachite green, cycloheximide, miconazole, or itraconazole, based on the supplementation of minimal medium with inhibitory concentrations of these compounds within the ranges of interest, as determined before (7, 31). Susceptibility assays revealed, however, the involvement of ORF YIL120w in yeast resistance to quinidine (Fig. 1) but not to quinine, and to ketoconazole and fluconazole, although the phenotypic differences with fluconazole were more subtle (Fig. 1 and results not shown). These conclusions were based on the increased resistance to the referred compounds upon increased expression of this ORF in plasmid pFL38, either in the deletion mutant or in the wild-type strain (Fig. 1). Based on the resistance phenotype observed with quinidine, ORF YIL120w was named QDR1.


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1.   ORF YIL120w is required for resistance to quinidine and ketoconazole. Comparison of susceptibility to the drugs, at the indicated concentrations, of S. cerevisiae W303.lb (wild type, WT) and the deletion mutant Delta yil120w harboring either recombinant plasmid pFL38_YIL120w (ORF YIL120w inserted into pFL38) or the cloning vector. The cell suspensions used to prepare the spots in lanes b and c were 1:2 and 1:4 dilutions of the cell suspension used in lanes a, respectively.

Effects of QDR1 expression level on quinidine-stressed cultivation. The role of QDR1 as a determinant of resistance to quinidine in yeast cells was confirmed in minimal liquid medium. The comparison of cell viability during cultivation of unadapted wild-type and Delta qdr1 cells under mild stress imposed by 3 mM quinidine indicated that QDR1 expression reduced the period of adaptation to exponential growth with quinidine by decreasing quinidine-induced death following sudden exposure of these unadapted cells to the drug (Fig. 2). However, after this initial period of adaptation, the exponential growth of both strains in the presence of 3 mM quinidine resumed, exhibiting indistinguishable kinetics independent of QDR1 expression (Fig. 2). The increased expression of QDR1 in a plasmid in the wild-type strain exerted additional protection for growth under high quinidine stress (Fig. 3). At 3.8 mM quinidine supplementation and after 30 h of cultivation, the strain expressing wild-type levels of QDR1 did not recover from the initial period of viability loss to resume exponential growth in the presence of the drug (Fig. 3). This contrasted with the behavior of the recombinant strain, expressing increased levels of QDR1, which resumed growth after approximately 12 h of adaptation (Fig. 3).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2.   Effect of QDR1 gene expression on yeast viability and growth under quinidine stress. Growth curves were followed by (A) culture OD600 and (B) concentration of viable cells. The growth curves of the wild-type (, ) and the deletion mutant Delta qdr1 (open circle , ) in the absence (open circle , ) or presence of 3 mM quinidine (, ) are compared. Cells used as inoculum were exponential-phase cells cultivated in the absence of quinidine. Viable cell values are the means of at least two independent growth experiments done in triplicate.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.   Effect of increased expression of QDR1 on quinidine-stressed yeast growth. Comparison of the growth curves in MM2-U medium supplemented with 3.5 mM (A) or 3.8 mM (B) quinidine of the wild-type strain W303.lb transformed with the cloning vector pFL38 () or the recombinant plasmid pFL38_QDR1, with the QDR1 gene inserted (). Cells used as inoculum were exponential-phase cells grown in the absence of quinidine supplementation.

The role of QDR1 expression in alleviating the deleterious effects of quinidine in unadapted yeast cells was not detectable in cells previously adapted to the drug (Fig. 4). Indeed, when cells used as the inoculum were previously adapted to growth with 3 mM quinidine by their cultivation in the presence of the drug to the standardized culture OD600 of 0.2, the growth curves of the wild-type and the mutant strain devoid of the QDR1 gene in the presence of either 3 or 3.2 mM quinidine were absolutely coincident (Fig. 4).


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4.   Quinidine effect on the growth curve of yeast cells previously adapted to the drug is independent of QDR1 gene expression. Comparison of the growth curves in minimal medium supplemented with 3 mM (A and B) or 3.2 mM (C and D) quinidine of S. cerevisiae W303.lb (wild type) () and Delta qdr1 mutant (). Cells used as inoculum were exponential-phase cells (at culture OD600 of 0.2 ± 0.01) cultivated in the absence of quinidine (A and C) or in the presence of 3 mM quinidine (B and D).

Localization of Qdr1p-GFP fusion protein in plasma membrane. The fluorescence of exponential-phase cells of S. cerevisiae W303.1b expressing Qdr1-GFP fusion protein from plasmid pMET25_YIL120w_GFP was predominantly localized to the cell periphery, while control cells, expressing GFP alone from plasmid pMET25_GFP, exhibited a slight and uniform distribution of green fluorescence throughout the cell (Fig. 5), similar to the autofluorescence of the host cells. The strong ring-like fluorescence staining around the cell was observed for the majority of the cells from an exponential-phase culture of transformants expressing Qdr1p-GFP protein (Fig. 5B and C) but was absent from the control cells (Fig. 5A). As observed before (31), some heterogeneity in the signal intensity in the periphery of cells expressing Qdr1-GFP protein was detected, possibly due to plasmid copy number differences. Since ORF YIL120w was predicted to code for an integral membrane protein (1, 19, 20, 22), these results strongly suggest that Qdr1p is a plasma membrane protein.


View larger version (52K):
[in this window]
[in a new window]
 
FIG. 5.   Fluorescence of exponential-phase cells of S. cerevisiae W303.lb (A) harboring the expression vector pMET25_GFP (control cells) or (B and C) transformed with the multicopy plasmid pMET25_YIL120w_GFP, indicating that Qdr1-GFP fusion protein is found in the plasma membrane.

Quinidine-induced active efflux of drug: role of QDR1 gene expression. Since Qdr1p was localized in the plasma membrane, we examined its possible involvement in the reduction of quinidine accumulation in the cell by active transport of the drug out of the cell. After a pulse of glucose, both the Delta qdr1 mutant and wild-type cells grown in the absence of quinidine supplementation were unable to export the labeled quinidine that rapidly entered the cell beforehand and reached an intracellular concentration ranging from 1- to 1.6-fold the concentration in the surrounding medium (Fig. 6A, E, and F). However, after 2 h of cultivation in medium supplemented with 3 mM quinidine, wild-type cells became capable of actively reducing the concentration of quinidine accumulated in the cell before a glucose pulse (Fig. 6B). This rapid induction of quinidine active export detected in wild-type cells was impaired by the addition of cycloheximide to the growth medium with the drug (Fig. 6D), indicating that the observed phenomenon depends on de novo protein synthesis induced by the drug. Evidence for the induction of a putative quinidine transporter(s) were, however, not obtained using cells devoid of QDR1 gene after the same 2 h of incubation with the drug, being the values of quinidine accumulation, in the absence or presence of glucose, above the corresponding values in the wild-type cells (Fig. 6B and C). These results were consistent with our first expectations that QDR1 might encode an H+-dependent exporter for quinidine, thus modulating the concentration of the drug accumulated in the cell. However, after a more extended period of adaptation to quinidine, the more susceptible Delta qdr1 culture also resumed exponential growth (Fig. 2), and the quinidine-adapted exponential-phase cells devoid of QDR1, harvested at the standardized culture OD600 of 0.2, were also capable of active expulsion of the quinidine accumulated beforehand (Fig. 6H). Nevertheless, the amount of quinidine accumulated in Delta qdr1 cells in the absence of glucose was significatively above that accumulated in wild-type cells (threefold compared with twofold), although, at the equilibrium following the glucose pulse, the concentration of labeled quinidine accumulated in the deletion mutant reached a value closer to the corresponding wild-type value (Fig. 6F and H).


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6.   Time course of [9-3H]quinidine accumulation in the absence of glucose (open circle , , triangle ) and its eventual subsequent expulsion after a glucose (Glc) pulse (, , black-triangle). Quinidine accumulation values are means or representative values of at least two independent experiments using cells of wild-type (wt) (, triangle , black-triangle, ) or Delta qdr1 (open circle , ) strains that had been grown in the absence of quinidine (QD), used to inoculate quinidine-supplemented or unsupplemented media, and harvested during the growth curves documented in Fig. 2 at time zero (A), after 2 h of cultivation in quinidine-supplemented medium (B and C), and at the exponential phase (exp) (culture OD600 of 0.2) of cultivation in unsupplemented medium (E and G) or quinidine-supplemented medium (F and H). In panel D we show the results obtained using wild-type cells incubated for 2 h in the absence (, ) (as in B) or presence (triangle , black-triangle) of 0.35 mM cycloheximide (CYH).

The cells used in the accumulation-active efflux assays were harvested at the same standardized culture OD600 of 0.2. In spite of the attempt to standardize the cell populations examined, it is clear from the viability curves in Fig. 2 that these populations exhibit a slightly different number of viable cells. This value was minimal for the quinidine-susceptible Delta qdr1 population grown with quinidine and maximal for both the wild-type and the Delta qdr1 populations grown in the absence of stress and shows an intermediate value for the quinidine-stressed wild-type population. Moreover, the average pHi values for quinidine-stressed exponential-phase populations (6.4 ± 0.02 and 6.2 ± 0.02 for the wild type and mutant, respectively) were below the value in unstressed cell populations (6.6 ± 0.02 for both the wild type and mutant), reaching the lowest value in the stressed Delta qdr1 mutant. We conclude that the stress imposed by quinidine on yeast cells led to a slight global acidification of the cell interior, even though the accumulation of this weak base is more compatible with alkalization of the cell interior. Since yeast growth medium is acidic (pH 5.5), these results strongly suggest that quinidine led to plasma membrane permeabilization with a consequent increase in the H+ influx rate. The relative average pHi estimates are consistent with lower susceptibility to the deleterious effects of quinidine of the unadapted wild-type population compared with the deletion mutant Delta qdr1 population. They are also consistent with the passive accumulation of labeled quinidine being minimal for both the wild-type and Delta qdr1 cell populations grown in the absence of quinidine and maximal for the Delta qdr1 mutant cell population grown with the drug, as it would be expected from the higher protonation of this weak base in the more acidic cell interior.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

As predicted from structural considerations (1, 16, 19, 20, 22), we show results indicating that the MFS-MDR homologue encoded by ORF YIL120w, here named QDR1, is an MDR determinant. Indeed, the expression of QDR1 was implicated in yeast resistance to ketoconazole, fluconazole, and quinidine, but not its stereoisomer quinine. Like Yil120wp, the first MFS-MDR homologue implicated in quinidine resistance, Yor273cp, belongs to the 12-spanner family 1, although to a different cluster of proteins (16, 19, 22). ORF YOR273c was identified based on functional overexpression in a hypersensitive S. cerevisiae strain of genes from a yeast genomic library and selection of transformants that grew in the presence of elevated levels of quinidine (11). However, the authors failed to isolate ORF YIL120w in this screening; among other reasons, it is possible that the conditions used for their screen might have been too stringent. Interestingly, Yor273cp is also very specific for quinidine, displaying no cross-resistance to any of the other quinoline-containing antimalarial drugs tested, including quinine and chloroquine (11), which could not be tested in the present work due to very high concentrations of chloroquine necessary for growth inhibition of the yeast strains examined. On the basis of high sequence homology of Yil120wp with other putative drug transporters of the MFS and of its subcellular localization, QDR1 was expected to encode an H+-dependent exporter for quinidine through the plasma membrane. However, we show results that do not confirm this mode of action. Indeed, the differences registered in the active efflux of quinidine from cells of the wild type and the mutant devoid of the QDR1 gene were essentially detected during the initial period of adaptation to the drug, while exponential-phase cells of both strains adapted to the drug were able to actively pulse quinidine out of the cell. The detection of an active quinidine efflux in the wild-type population but not in the population devoid of QDR1 after the same 2 h of incubation following the sudden exposure of cells to quinidine may be the result of the higher susceptibility of the unadapted Delta qdr1 population, revealed by the higher quinidine-induced viability loss during this adaptation period. In fact, after surpassing a shorter or longer initial period of adaptation, exponential growth with quinidine was resumed in both populations, and these adapted cells became capable of active expulsion of the drug independent of QDR1 expression. It is intriguing why quinidine, which is not present in the yeast natural environment, may induce its active expulsion from cells which are actively dividing in its presence. QDR1 gene transcription levels do not increase in cells cultivated with quinidine (P. Nunes, M. Teixeira, and I. Sá-Correia, unpublished results), consistent with other indications suggesting that this gene is not involved in the induction of quinidine export by the drug. Nevertheless, the level of expression of QDR1 is critical to surpass the viability loss during the initial period of adaptation to quinidine and to eventually resume exponential growth, which depends on the remaining viable population. Results also suggest that there are other resistance mechanisms that can be used when QDR1 is absent, possibly involving other MFS-MDR and/or ABC transporters.

Quinidine accumulation assays were carried out at an external pH of 5.5, and the uptake of labeled quinidine into the yeast cell was extremely rapid. However, at this pH quinidine, which is a weak base with two protonation sites with pKas of 5.4 and 10.0 (8), is basically in the singly protonated form and not in the highly lipophilic unprotonated form which would pass freely through biological membranes by passive diffusion. A very rapid uptake rate of chloroquine into Plasmodium cells was also observed phase and a similar question was raised (10, 13, 15). The internal pH (pHi) of exponential-phase yeast cells was estimated to be within the range from 6.2 to 6.6, depending on the presence or absence of the drug or of a functional QDR1 gene; cells grown under quinidine stress exhibited an average pHi slightly below the pHi of cells grown in the absence of drug. This observation is consistent with the disturbing effect of quinidine on plasma membrane spatial organization and the consequent increase in H+ passive influx, with the acidification of the interior of cells incubated at pH 5.5, even though quinidine accumulation, presumably into the slightly acidic yeast vacuole (9, 10, 15, 18), is expected to lead to alkalinization. At high concentrations, chloroquine also has a demonstrable negative effect on Plasmodium membrane stability, and the protonated form may interact with various phospholipids by both hydrophobic and electrostatic forces (15). Therefore, the slightly lower pHi exhibited by the exponential-phase Delta qdr1 population compared with the wild-type population, both grown under identical quinidine stress, is consistent with the higher susceptibility of unadapted cells devoid of QDR1 to the deleterious effects of quinidine during the initial period of adaptation to the drug. Since the average pHi of the Delta qdr1 population used in the accumulation-active efflux assays was slightly below the average pHi of the wild-type population harvested at the same culture OD (pHi 6.2 compared with 6.4), the higher accumulation of quinidine in the absence of glucose into the more acidic interior of Delta qdr1 cells may merely be a consequence of the weak base properties of this drug. This hypothesis is also consistent with the apparently unexpected lower intracellular accumulation of quinidine (around onefold) in exponential-phase cells of both strains grown in the absence of quinidine compared with the values calculated for quinidine-adapted cells with a more acidic interior (two- or threefold).

Studies carried out before to gain some understanding of how another plasma membrane MFS-MDR homologue, encoded by ORF YGR224w (AZR1 gene), facilitates yeast adaptation to inhibitory concentrations of acetic acid also failed to directly implicate this protein in the active export of acetate (31). It is possible that a number of the MFS-MDR homologues may play other roles in yeast cells than detoxification, such as the transport of a specific molecule unrelated to the drugs to which they confer resistance. This is apparently the case for polyamine transport by YlI028cp (32) or the transport of dityrosine precursors by Ybr180wp Dtr1p (12). It is possible that Qdr1p could alter ion fluxes that indirectly control drug accumulation in yeast cells by affecting pH and/or membrane potential (25). Further studies are required to find out the natural physiological role of Qdr1p as a plasma membrane transporter of the MFS and to establish the precise biochemical mechanisms whereby this putative transporter functions in alleviating the toxic effects of, at least, quinidine, ketoconazole, and fluconazole in S. cerevisiae. The elucidation of these mechanisms may provide useful information for the understanding of the physiological functions of the poorly characterized family of MFS-MDR transporters that have largely escaped identification by classical approaches. The quinidine concentrations used in the present work to inhibit yeast growth were much higher than the one required for killing Plasmodium cells, consistent with the idea that the antimalarial effects of quinoline ring-containing drugs are exerted via physiological processes that do not exist in S. cerevisiae (10, 15). However, the expression in yeast cells of the P. faciparum pfmdr1 gene, a member of the ABC superfamily of transporters that confers resistance to multiple antimalarials in the malaria parasite (24), was associated with decreased cellular accumulation and a concomitant increase in resistance to quinoline-containing drugs in yeast transformants (28). Nevertheless, it is clear that this gene cannot also be the sole cause of chloroquine resistance in P. falciparum (30). Since the mechanisms of multidrug resistance are apparently conserved among phylogenetically distant organisms (4, 6, 10, 22), the characterization of drug resistance determinants and of the mechanisms of multidrug resistance in yeast cells may contribute to the understanding of these mechanisms in more complex and less easily accessible eukaryotes, such as those underlying the resistance to quinoline-containing drugs in the malaria parasite.


    ACKNOWLEDGMENTS

We thank R. Nelhas and R. Vargas for their contribution to ORF YIL120w disruption and QDR1 gene cloning.

This research was supported by the European Union BIOTECH EUROFAN I and II projects (contracts BIO4-CT95-0080 and BIO4-CT97-2294) and by Fundação para a Ciência e Tecnologia, FEDER, and PRAXIS XXI Programme (projects PRAXIS/PCN/C/BIO/79/96 and Ph.D. [BD/9633/96] and M.Sc. [BM/19146/99] scholarships to S. Tenreiro and P. Nunes, respectively).


    FOOTNOTES

* Corresponding author. Mailing address: Centro de Engenharia Biológia e Química, Instituto Superior Técnico, Av. Rovisco Pais, 1049-001 Lisbon, Portugal. Phone: 351-218417682. Fax: 351-218480072. E-mail: pcisc{at}popsrv.ist.utl.pt.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. André, B. 1995. An overview of membrane transport proteins in Saccharomyces cerevisiae. Yeast 11:1575-1611[CrossRef][Medline].
2. Balzi, E., and A. Goffeau. 1994. Genetics and biochemistry of yeast multidrug resistance. Biochim. Biophys. Acta 1187:152-162[Medline].
3. Balzi, E., and A. Goffeau. 1995. Yeast multidrug resistance: the PDR network. J. Bioenerg. Biomembr. 27:71-76[CrossRef][Medline].
4. Bolhuis, H., H. W. van Veen, B. Poolman, A. J. Driessen, and W. N. Konings. 1997. Mechanisms of multidrug transporters. FEMS Microbiol. Rev. 21:55-84[CrossRef][Medline].
5. Bonneaud, N., O. Ozier-Kalogeropoulos, G. Y. Li, M. Labouesse, L. Minvielle-Sebastia, and F. Lacroute. 1991. A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast 7:609-615[CrossRef][Medline].
6. Borst, P., and M. Ouellete. 1995. New mechanisms of drug resistance in parasitic protozoa. Annu. Rev. Microbiol. 49:427-460[CrossRef][Medline].
7. Brôco, N., S. Tenreiro, C. A. Viegas, and I. Sá- Correia. 1999. FLR1 gene (ORF YBR008c) is required for benomyl and methotrexate resistance in Saccharomyces cerevisiae and its benomyl-induced expression is dependent on Pdr3 transcriptional regulator. Yeast 15:1595-1608[CrossRef][Medline].
8. Budavari, S. 1996. The Merck Index, 12th ed. Merck & Co., Inc., Whitehouse Station, N.J.
9. Carmelo, V., H. Santos, and I. Sá- Correia. 1997. Effect of extracellular acidification on the activity of plasma membrane ATPase and on the cytosolic and vacuolar pH of Saccharomyces cerevisiae. Biochim. Biophys. Acta 1325:63-70[Medline].
10. Cowman, A. F. 1997. The mechanisms of drug action and resistance in malaria, p. 221-246. In J. D. Hayes, and C. R. Wolf (ed.), Molecular genetics of drug resistance. Harwood Academic Publishers, Amsterdam, The Netherlands.
11. Delling, U., M. Raymond, and E. Schurr. 1998. Identification of Saccharomyces cerevisiae genes conferring resistance to quinoline ring-containing antimalarial drugs. Antimicrob. Agents Chemother. 42:1034-1041[Abstract/Free Full Text].
12. Felder, T., S. Tenreiro, I. Sá- Correia, M. Breitenbach, and P. Briza. 1999. Biosynthesis of the yeast ascopore wall: identification of a membrane transporter of dityrosine-containing spore wall precursors. Curr. Genet. 35:272.
13. Ferrari, V., and D. J. Cuther. 1991. Simulation of kinetic data on the influx and efflux of chloroquine by erythrocytes infected with Plasmodium falciparum: evidence for a drug-importer in chloroquine-sensitive strains. Biochem. Pharmacol. 42:5167-5179.
14. Gietz, D., A. St. Jean, R. A. Woods, and R. H. Schiestl. 1992. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425[Free Full Text].
15. Ginsburg, H., and T. G. Geary. 1987. Current concepts and new ideas on the mechanism of action of quinoline-containing antimalarials. Biochem. Pharmacol. 36:1567-1576[CrossRef][Medline].
16. Goffeau, A., J. Park, I. T. Paulsen, J. L. Jonniaux, T. Dinh, P. Mordant, and M. H. Saier, Jr. 1997. Multidrug-resistant transport proteins in yeast: complete inventory and phylogenetic characterization of yeast open reading frames within the major facilitator superfamily. Yeast 13:43-54[CrossRef][Medline].
17. Güldener, U., S. Heccks, T. Fiedler, J. Beinhauer, and J. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519-2524[Abstract/Free Full Text].
18. Klionsky, D. J., P. K. Herman, and S. D. Emr. 1990. A fungal vacuole: composition, function, and biogenesis. Microbiol. Rev. 54:266-292[Abstract/Free Full Text].
19. Nelissen, B., R. De Wachter, and A. Goffeau. 1997. Classification of all putative permeases and other membrane plurispanners of the major facilitator superfamily encoded by the complete genome of Saccharomyces cerevisiae. FEMS Microbiol. Rev. 21:113-134[CrossRef][Medline].
20. Nelissen, B., P. Mordant, J. L. Jonniaux, R. De Wachter, and A. Goffeau. 1995. Phylogenetic classification of the major superfamily of membrane transport facilitators, as deduced from yeast genome sequencing. FEBS Lett. 377:232-236[CrossRef][Medline].
21. Paulsen, I. T., M. H. Brown, and R. A. Skurray. 1996. Proton-dependent multidrug efflux systems. Microbiol. Rev. 60:75-608.
22. Paulsen, I. T., M. K. Slinwinski, B. Nelissen, A. Goffeau, and M. H. Saier, Jr. 1998. Unified inventory of established and putative transporters encoded within the complete genome of Saccharomyces cerevisiae. FEBS Lett. 430:116-125[CrossRef][Medline].
23. Peters, W. 1987. Chemotherapy and drug resistance in malaria, 2nd ed. Academic Press, London, U.K.
24. Reed, M. B., K. J. Saliba, S. R. Caruana, K. Kirk, and A. F. Cowman. 2000. Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature 403:906-909[CrossRef][Medline].
25. Roepe, P. D., L. Wei, M. M. Hoffman, and F. Fritz. 1996. Altered drug translocation mediated by the MDR protein: direct, indirect or both? J. Bioenerg. Biomembr. 28:541-554[CrossRef][Medline].
26. Rosa, M. F., and I. Sá- Correia. 1996. Intracellular acidification does not account for inhibition of Saccharomyces cerevisiae growth in the presence of ethanol. FEMS Microbiol. Lett. 135:271-274[CrossRef][Medline].
27. Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-301[CrossRef][Medline].
28. Ruetz, S., U. Delling, M. Brault, E. Schurr, and P. Gros. 1996. The pfmdr1 gene of Plasmodium falciparum confers cellular resistance to antimalarial drugs in yeast cells. Proc. Natl. Acad. Sci. USA 93:9942-9947[Abstract/Free Full Text].
29. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
30. Su, X.-Z., L. A. Kirkman, H. Fujioka, and T. E. Wellems. 1997. Complex polymorphisms in an ~330 kDa protein are linked to chloroquine-resistance P. falciparium in Southeast Asia and Africa. Cell 91:593-603[CrossRef][Medline].
31. Tenreiro, S., P. C. Rosa, C. A. Viegas, and I. Sá- Correia. 2000. Expression of the AZR1 gene (ORF YGR224w), encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and resistance to azoles in Saccharomyces cerevisiae. Yeast 16:1469-1481[CrossRef][Medline].
32. Tomitori, H., K. Kashiwagi, K. Sakata, Y. Kakinuma, and K. Igarashi. 1999. Identification of a gene for a polyamine transport protein in yeast. J. Biol. Chem. 274:3265-3267[Abstract/Free Full Text].
33. Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[CrossRef][Medline].


Antimicrobial Agents and Chemotherapy, May 2001, p. 1528-1534, Vol. 45, No. 5
0066-4804/01/$04.00+0   DOI: 10.1128/AAC.45.5.1528-1534.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Vargas, R. C., Garcia-Salcedo, R., Tenreiro, S., Teixeira, M. C., Fernandes, A. R., Ramos, J., Sa-Correia, I. (2007). Saccharomyces cerevisiae Multidrug Resistance Transporter Qdr2 Is Implicated in Potassium Uptake, Providing a Physiological Advantage to Quinidine-Stressed Cells. Eukaryot Cell 6: 134-142 [Abstract] [Full Text]  
  • Velasco, I., Tenreiro, S., Calderon, I. L., Andre, B. (2004). Saccharomyces cerevisiae Aqr1 Is an Internal-Membrane Transporter Involved in Excretion of Amino Acids. Eukaryot Cell 3: 1492-1503 [Abstract] [Full Text]  
  • Vargas, R. C., Tenreiro, S., Teixeira, M. C., Fernandes, A. R., Sa-Correia, I. (2004). Saccharomyces cerevisiae Multidrug Transporter Qdr2p (Yil121wp): Localization and Function as a Quinidine Resistance Determinant. Antimicrob. Agents Chemother. 48: 2531-2537 [Abstract] [Full Text]  
  • Felder, T., Bogengruber, E., Tenreiro, S., Ellinger, A., Sa-Correia, I., Briza, P. (2002). Dtr1p, a Multidrug Resistance Transporter of the Major Facilitator Superfamily, Plays an Essential Role in Spore Wall Maturation in Saccharomyces cerevisiae. Eukaryot Cell 1: 799-810 [Abstract] [Full Text]  
  • Keller, G., Ray, E., Brown, P. O., Winge, D. R. (2001). Haa1, a Protein Homologous to the Copper-regulated Transcription Factor Ace1, Is a Novel Transcriptional Activator. J. Biol. Chem. 276: 38697-38702 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nunes, P. A.
Right arrow Articles by Sá-Correia, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nunes, P. A.
Right arrow Articles by Sá-Correia, I.