Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, August 2001, p. 2393-2396, Vol. 45, No. 8
Pneumococcal Diseases Research Unit, Department of Clinical
Microbiology and Infectious Diseases, South African Institute
for Medical Research, Johannesburg, South
Africa,1 and Departments of
International Health and Infectious Diseases, Emory University,
Atlanta, Georgia2
Received 1 December 2000/Returned for modification 23 March
2001/Accepted 5 May 2001
We report that alteration in MurM, an enzyme involved in the
biosynthesis of branched-stem cell wall muropeptides, is required for
maximal expression of penicillin and cefotaxime resistance in the
pneumococcus. Hungarian isolate 3191 (penicillin MIC, 16 µg/ml;
cefotaxime MIC, 4 µg/ml) was a source of donor DNA in transformation experiments. Penicillin-binding protein DNA was insufficient to transform recipient strain R6 to full resistance. Further
transformation with altered murM DNA was required for
full expression of donor penicillin and cefotaxime resistance.
Beta-lactam antibiotics inhibit the
growth of pneumococci by the inactivation of penicillin-binding
proteins (PBPs). PBPs are serine peptidases which catalyze
polymerization of peptidoglycan precursors during cell wall synthesis
(15). Pneumococcal resistance to In this paper we report a non-PBP resistance determinant that is
essential for the complete development of high-level penicillin and
cephalosporin resistance in pneumococcal isolates. This resistance mechanism involves alteration in MurM, an enzyme involved in the biosynthesis of branched-stem cell wall muropeptides. The major peptide
species in susceptible cell walls are of a linear-stem structure,
compared to an abnormal branched-stem structure found in resistant cell
walls (4). Branched-stem peptides presumably have superior
binding to structurally altered PBPs and therefore become the preferred
substrate for cell wall synthesis in resistant bacteria. Filipe and
Tomasz (3) recently described the murMN operon
in the pneumococcus that codes for the MurM and MurN proteins, which
control the biosynthesis of branched-stem-structured cell wall
muropeptides. They showed that a functional murMN operon is
critical for the expression of penicillin resistance. We extend their
findings by showing that alterations in MurM contribute to development
of high-level penicillin and cephalosporin resistance in the pneumococcus.
Properties of the pneumococcal strains studied are shown in Table
1. Chromosomal DNAs were extracted from
bacterial cells, and genes were amplified from the chromosomal DNAs by
PCR using methods that have been described previously
(13). For pbp gene PCR, primers have been
described previously (11, 12). For murMN gene
PCR, the following primer pairs were used: (i) murMN-up (TTCAAACGAAAGTAGTAGAATAG) and murMN-down3
(CCTATCAAACGAAAAAGCCAGCGCA) and (ii) murMN-up2
(TTTATAAATGAACCACTATTTATAG) and MurMN-down (GCATGTCTCTCCACCTTTCTAGC). PCR products were sequenced using
the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, Calif.) and an Applied Biosystems model 310 automated DNA sequencer. Pneumococcal strain R6 was used as the recipient in transformation studies.
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.8.2393-2396.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Alterations in MurM, a Cell Wall Muropeptide Branching
Enzyme, Increase High-Level Penicillin and Cephalosporin
Resistance in Streptococcus pneumoniae
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
-lactams is the result
of altered PBPs with decreased antibiotic affinities (8, 9,
16). Pneumococci contain a set of six PBPs (7).
High-level penicillin resistance can be established by alteration in
only three of these PBPs, that is, PBPs 2X, 2B, and 1A
(2), while only altered PBPs 2X and 1A are required for
high-level cefotaxime resistance (10). The role of PBPs in
mediating -lactam resistance in pneumococci was first described in
the early 1980s (8, 16). More recently, further mechanisms for -lactam resistance in pneumococci have been described, i.e., mutations in the histidine protein kinase CiaH (6) and
mutations in the glycosyltransferase CpoA (5). These
non-PBP mechanisms have been identified only in laboratory mutants and
account for very low-level resistance.
TABLE 1.
Properties of pneumococci
Chromosomal DNA and cloned genes were used as transforming DNA.
Pneumococcal strains were made competent as follows. Bacteria were
cultured in C medium (14) until the mid-exponential phase (optical density at 620 nm, 0.15) and, after the addition of glycerol to 10%, were frozen at 
70°C in 500-µl aliquots. For
transformation, 1 µg of DNA was added to 500 µl of competent cells,
which were then incubated at 30°C for 45 min and at 37°C for 90 min. Eighty-microliter amounts were then plated onto Mueller-Hinton
blood agar containing increasing concentrations of antibiotic, and the
plates were incubated at 37°C for 48 h. Transformants were
picked from the plates containing the highest antibiotic concentration.
Transformation frequencies were on the order of
10
4 to 105.
Our study is based on isolate 3191, a representative of a Hungarian pneumococcal clone, isolated during the period 1997 to 1998, that was found to have notably high levels of penicillin (MIC, 16 µg/ml) and cefotaxime (MIC, 4 µg/ml) resistance (12). In that study, transformation of susceptible strain R6 with combinations of all six pbp genes from isolate 3191 resulted in transformants for which the maximum MICs were 4 µg of penicillin per ml and 2 µg of cefotaxime per ml. Resistance in these R63191/2X/2B/1A transformants was due to altered PBPs 2X, 2B, and 1A. The full MICs for the donor (penicillin MIC, 16 µg/ml; cefotaxime MIC, 4 µg/ml) could be reached only by further transformation of R63191/2X/2B/1A strains with chromosomal 3191 DNA, demonstrating the involvement of a non-PBP resistance determinant.
Our present study has now identified this resistance determinant. Experiments were initiated along the lines of the methods described by Adrian and coworkers (1). The following steps were taken. The chromosomal DNA was digested, and fragments of DNA with transforming ability were identified. In the process of identifying open reading frames with transforming ability, Filipe and Tomasz (3) described the murMN operon in the pneumococcus and proved that a functional murMN operon was critical for the expression of penicillin resistance. We therefore decided to investigate whether the product of this murMN operon was our non-PBP resistance determinant. PCR primers were designed, and the murMN operon was amplified from isolate 3191. The murMN DNA was shown to successfully transform R63191/2X/2B/1A to requiring the full MICs of the donor (penicillin MIC, 16 µg/ml; cefotaxime MIC, 4 µg/ml). R63191/2X/2B/1A/mur transformants could be selected with either penicillin or cefotaxime.
The murMN genes from isolate 3191 and from
R63191/2X/2B/1A/mur transformants were then
sequenced. The nucleotide sequence of the genes from susceptible strain
R6 was used as the basis for comparison with resistant strains. The
murMN genes from isolate 3191 displayed a mosaic pattern
with 9.5% nucleotide sequence divergence from the genes of strain R6.
The murMN operon is divided into the murM and
murN genes, with the major sequence divergence occurring in the murM gene. The murM gene revealed 16.2%
nucleotide sequence divergence, resulting in 74 amino acid mutations in
the 406-amino-acid MurM protein, while the murN gene
revealed a nucleotide sequence diversity of only 2.9%, which resulted
in only 6 mutations in the 410-amino-acid MurN protein. Sequence
analysis of the murMN genes from
R63191/2X/2B/1A/mur transformants showed that
altered MurM was the resistance determinant. Figure
1 schematically illustrates
murMN genes from six
R63191/2X/2B/1A/mur transformants, compared to
the genes from donor isolate 3191, and indicates the regions of the
genes where altered DNA from isolate 3191 has been introduced. A common
area of alteration (nucleotides 208 to 474) could be identified among
all transformants, which indicated that this area (located in the
murM gene) housed the alterations leading to the development
of resistance. This area corresponds to amino acid positions 42 to 131 of the MurM protein (Fig. 2), which
account for 20 of the 74 mutations in the altered protein.
|
|
We then investigated whether the role played by altered MurM in the
development of high-level penicillin and cefotaxime resistance was a
unique characteristic of MurM from the Hungarian clone or whether
murM genes from other resistant strains were also able to
increase -lactam MICs in pneumococci. For this analysis, we selected
two South African isolates (149193 and 50012) with high-level resistance to both penicillin and cefotaxime (MICs, 2 µg/ml). Transformation experiments with murMN DNAs from these South
African strains successfully transformed
R63191/2X/2B/1A to full levels of
resistance, in the same manner as did murMN DNA
from Hungarian isolate 3191. This indicated that these South African strains may also have the requirement of altered MurM for
high-level resistance development and that this resistance determinant
may be widespread among pneumococci. Comparison of MurM sequences from
isolates 3191, 149193, and 50012 revealed very similar patterns of
alteration, and many common amino acid mutations were identified (Fig.
2). murM genes from three other isolates (8303, 20475, and
806) with lower levels of penicillin and cefotaxime resistance were
then analyzed, all of which revealed MurM proteins with only a single
V101A substitution. The murM genes from these
isolates showed no resistance-transforming ability; therefore, in
effect these isolates had unaltered MurM proteins. This surprisingly
also included isolate 8303, for which the penicillin MIC was 4 µg/ml.
Our data show that for the pneumococcus to resist -lactam
antibiotics at extreme concentrations, a functional but altered MurM is
required. The branched-stem peptide precursors produced by an unaltered
MurM may be adequate for cells with the capacity to resist penicillin
at concentrations of up to 4 µg/ml and cefotaxime at concentrations
of up to 1 µg/ml, but at higher levels of resistance, an
alteration in MurM is required. Altered MurM presumably results in a
new species of branched-stem peptides, with superior binding to
restructured PBPs in resistant bacteria, compared to the binding of the
normal branched-stem peptides. Previous studies (2, 10)
have shown that high-level penicillin and cefotaxime resistance can be
transferred to susceptible strains using only altered pbp DNA; therefore, it is clear that high-level resistance is obtainable in
the absence of altered MurM. Because our data have shown a requirement
for altered MurM in the development of resistance, we have revealed an
alternative pathway in the development of high-level penicillin and
cefotaxime resistance.
In conclusion, we have shown that in conjunction with altered PBPs, a non-PBP resistance determinant (altered MurM) can be used as an alternative pathway in the development of high-level penicillin and cephalosporin resistance in the pneumococcus. Alteration of MurM is a mechanism particularly essential for full resistance development in a Hungarian clone.
Nucleotide sequence accession numbers. murMN sequence data appear in the EMBL, GenBank, and DDBJ nucleotide sequence data libraries under the following accession numbers: AJ250764 (strain R6), AF319941 (strain 3191), and AF319942 (strains 149193 and 50012).
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Medical Research Council, the South African Institute for Medical Research, and the University of the Witwatersrand.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: MRC/SAIMR/WITS Pneumococcal Diseases Research Unit, Department of Clinical Microbiology and Infectious Diseases, South African Institute for Medical Research, P.O. Box 1038, Johannesburg, 2000, South Africa. Phone: 27-011-4899335. Fax: 27-011-4899332. E-mail: anthonys{at}mail.saimr.wits.ac.za.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Adrian, P. V.,
W. Zhao,
T. O. Black,
K. J. Shaw,
R. S. Hare, and K. P. Klugman.
2000.
Mutations in ribosomal protein L16 conferring reduced susceptibility to evernimicin (SCH27899): implications for mechanism of action.
Antimicrob. Agents Chemother.
44:732-738 |
| 2. | Barcus, V. A., K. Ghanckar, M. Yeo, T. J. Coffey, and C. G. Dowson. 1995. Genetics of high level penicillin resistance in clinical isolates of Streptococcus pneumoniae. FEMS Microbiol. Lett. 126:299-303[CrossRef][Medline]. |
| 3. |
Filipe, S. R., and A. Tomasz.
2000.
Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
Proc. Natl. Acad. Sci. USA
97:4891-4896 |
| 4. |
Garcia-Bustos, J., and A. Tomasz.
1990.
A biological price of antibiotic resistance: major changes in the peptidoglycan structure of penicillin-resistant pneumococci.
Proc. Natl. Acad. Sci. USA
87:5415-5419 |
| 5. |
Grebe, T.,
J. Paik, and R. Hakenbeck.
1997.
A novel resistance mechanism against -lactams in Streptococcus pneumoniae involves CpoA, a putative glycosyltransferase.
J. Bacteriol.
179:3342-3349 |
| 6. | Guenzi, E., A.-M. Gasc, M. A. Sicard, and R. Hakenbeck. 1994. A two-component signal-transducing system is involved in competence and penicillin susceptibility in laboratory mutants of Streptococcus pneumoniae. Mol. Microbiol. 12:505-515[Medline]. |
| 7. |
Hakenbeck, R.,
K. Kaminski,
A. König,
M. van der Linden,
J. Paik,
P. Reichmann, and D. Zähner.
1999.
Penicillin-binding proteins in -lactam resistant Streptococcus pneumoniae.
Microb. Drug Resist.
5:91-99[Medline].
|
| 8. |
Hakenbeck, R.,
M. Tarpay, and A. Tomasz.
1980.
Multiple changes of penicillin-binding proteins in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
17:364-371 |
| 9. | Laible, G., B. G. Spratt, and R. Hakenbeck. 1991. Interspecies recombinational events during the evolution of altered PBP 2X genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5:1993-2002[Medline]. |
| 10. | Muñoz, R., C. G. Dowson, M. Daniels, T. J. Coffey, C. Martin, R. Hakenbeck, and B. G. Spratt. 1992. Genetics of resistance to third-generation cephalosporins in clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 6:2461-2465[Medline]. |
| 11. |
Smith, A. M., and K. P. Klugman.
1998.
Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
42:1329-1333 |
| 12. | Smith, A. M., and K. P. Klugman. 2000. Non-penicillin-binding protein mediated high-level penicillin and cephalosporin resistance in a Hungarian clone of Streptococcus pneumoniae. Microb. Drug Resist. 6:105-110[CrossRef][Medline]. |
| 13. |
Smith, A. M.,
K. P. Klugman,
T. J. Coffey, and B. G. Spratt.
1993.
Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.
Antimicrob. Agents Chemother.
37:1938-1944 |
| 14. |
Tomasz, A., and R. D. Hotchkiss.
1964.
Regulation of the transformability of pneumococcal cultures by macromolecular cell products.
Proc. Natl. Acad. Sci. USA
51:480-487 |
| 15. |
Waxman, D. J., and J. L. Strominger.
1983.
Penicillin-binding proteins and mechanism of action of -lactam antibiotics.
Annu. Rev. Biochem.
52:825-869[CrossRef][Medline].
|
| 16. |
Zighelboim, S., and A. Tomasz.
1980.
Penicillin-binding proteins of multiply antibiotic-resistant South African strains of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
17:434-442 |
Antimicrobial Agents and Chemotherapy, August 2001, p. 2393-2396, Vol. 45, No. 8
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.8.2393-2396.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kosowska-Shick, K., Ednie, L. M., McGhee, P., Appelbaum, P. C.
(2009). Comparative Antipneumococcal Activities of Sulopenem and Other Drugs. Antimicrob. Agents Chemother.
53: 2239-2247
[Abstract] [Full Text] -
McGee, L., Biek, D., Ge, Y., Klugman, M., du Plessis, M., Smith, A. M., Beall, B., Whitney, C. G., Klugman, K. P.
(2009). In Vitro Evaluation of the Antimicrobial Activity of Ceftaroline against Cephalosporin-Resistant Isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
53: 552-556
[Abstract] [Full Text] -
De Pascale, G., Lloyd, A. J., Schouten, J. A., Gilbey, A. M., Roper, D. I., Dowson, C. G., Bugg, T. D. H.
(2008). Kinetic Characterization of Lipid II-Ala:Alanyl-tRNA Ligase (MurN) from Streptococcus pneumoniae using Semisynthetic Aminoacyl-lipid II Substrates. J. Biol. Chem.
283: 34571-34579
[Abstract] [Full Text] -
Lloyd, A. J., Gilbey, A. M., Blewett, A. M., De Pascale, G., El Zoeiby, A., Levesque, R. C., Catherwood, A. C., Tomasz, A., Bugg, T. D. H., Roper, D. I., Dowson, C. G.
(2008). Characterization of tRNA-dependent Peptide Bond Formation by MurM in the Synthesis of Streptococcus pneumoniae Peptidoglycan. J. Biol. Chem.
283: 6402-6417
[Abstract] [Full Text] -
Gums, J. G, Boatwright, D W., Camblin, M., Halstead, D. C, Jones, M. E, Sanderson, R.
(2008). Differences Between Ceftriaxone and Cefotaxime: Microbiological Inconsistencies. The Annals of Pharmacotherapy
42: 71-79
[Abstract] [Full Text] -
Haenni, M., Moreillon, P.
(2006). Mutations in Penicillin-Binding Protein (PBP) Genes and in Non-PBP Genes during Selection of Penicillin-Resistant Streptococcus gordonii. Antimicrob. Agents Chemother.
50: 4053-4061
[Abstract] [Full Text] -
del Campo, R., Cafini, F., Morosini, M. I., Fenoll, A., Linares, J., Alou, L., Sevillano, D., Canton, R., Prieto, J., Baquero, F., on behalf of the Spanish Pneumococcal Network (G3/,
(2006). Combinations of PBPs and MurM protein variants in early and contemporary high-level penicillin-resistant Streptococcus pneumoniae isolates in Spain. J Antimicrob Chemother
57: 983-986
[Abstract] [Full Text] -
Cafini, F., del Campo, R., Alou, L., Sevillano, D., Morosini, M. I., Baquero, F., Prieto, J., on behalf of the Spanish Pneumococcal Network (G03,
(2006). Alterations of the penicillin-binding proteins and murM alleles of clinical Streptococcus pneumoniae isolates with high-level resistance to amoxicillin in Spain. J Antimicrob Chemother
57: 224-229
[Abstract] [Full Text] -
Granger, D., Boily-Larouche, G., Turgeon, P., Weiss, K., Roger, M.
(2006). Molecular characteristics of pbp1a and pbp2b in clinical Streptococcus pneumoniae isolates in Quebec, Canada. J Antimicrob Chemother
57: 61-70
[Abstract] [Full Text] -
Smith, A. M., Klugman, K. P.
(2005). Amino Acid Mutations Essential to Production of an Altered PBP 2X Conferring High-Level {beta}-Lactam Resistance in a Clinical Isolate of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
49: 4622-4627
[Abstract] [Full Text] -
Chesnel, L., Carapito, R., Croize, J., Dideberg, O., Vernet, T., Zapun, A.
(2005). Identical Penicillin-Binding Domains in Penicillin-Binding Proteins of Streptococcus pneumoniae Clinical Isolates with Different Levels of {beta}-Lactam Resistance. Antimicrob. Agents Chemother.
49: 2895-2902
[Abstract] [Full Text] -
Smith, A. M., Feldman, C., Massidda, O., McCarthy, K., Ndiweni, D., Klugman, K. P.
(2005). Altered PBP 2A and Its Role in the Development of Penicillin, Cefotaxime, and Ceftriaxone Resistance in a Clinical Isolate of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
49: 2002-2007
[Abstract] [Full Text] -
Trzcinski, K., Thompson, C. M., Lipsitch, M.
(2004). Single-Step Capsular Transformation and Acquisition of Penicillin Resistance in Streptococcus pneumoniae. J. Bacteriol.
186: 3447-3452
[Abstract] [Full Text] -
Karlowsky, J. A., Jones, M. E., Draghi, D. C., Sahm, D. F.
(2003). Clinical Isolates of Streptococcus pneumoniae with Different Susceptibilities to Ceftriaxone and Cefotaxime. Antimicrob. Agents Chemother.
47: 3155-3160
[Abstract] [Full Text] -
Rohrer, S., Berger-Bachi, B.
(2003). FemABX Peptidyl Transferases: a Link between Branched-Chain Cell Wall Peptide Formation and {beta}-Lactam Resistance in Gram-Positive Cocci. Antimicrob. Agents Chemother.
47: 837-846
[Full Text] -
Smith, A. M., Klugman, K. P.
(2003). Site-Specific Mutagenesis Analysis of PBP 1A from a Penicillin-Cephalosporin-Resistant Pneumococcal Isolate. Antimicrob. Agents Chemother.
47: 387-389
[Abstract] [Full Text] -
Leach, A. J., Morris, P. S., Smith-Vaughan, H., Mathews, J. D.
(2002). In Vivo Penicillin MIC Drift to Extremely High Resistance in Serotype 14 Streptococcus pneumoniae Persistently Colonizing the Nasopharynx of an Infant with Chronic Suppurative Lung Disease: a Case Study. Antimicrob. Agents Chemother.
46: 3648-3649
[Abstract] [Full Text] -
du Plessis, M., Bingen, E., Klugman, K. P.
(2002). Analysis of Penicillin-Binding Protein Genes of Clinical Isolates of Streptococcus pneumoniae with Reduced Susceptibility to Amoxicillin. Antimicrob. Agents Chemother.
46: 2349-2357
[Abstract] [Full Text] -
Nagai, K., Davies, T. A., Jacobs, M. R., Appelbaum, P. C.
(2002). Effects of Amino Acid Alterations in Penicillin-Binding Proteins (PBPs) 1a, 2b, and 2x on PBP Affinities of Penicillin, Ampicillin, Amoxicillin, Cefditoren, Cefuroxime, Cefprozil, and Cefaclor in 18 Clinical Isolates of Penicillin-Susceptible, -Intermediate, and -Resistant Pneumococci. Antimicrob. Agents Chemother.
46: 1273-1280
[Abstract] [Full Text] -
Filipe, S. R., Severina, E., Tomasz, A.
(2002). The murMN operon: A functional link between antibiotic resistance and antibiotic tolerance in Streptococcuspneumoniae. Proc. Natl. Acad. Sci. USA
99: 1550-1555
[Abstract] [Full Text] -
Smith, A. M., Botha, R. F., Koornhof, H. J., Klugman, K. P.
(2001). Emergence of a Pneumococcal Clone with Cephalosporin Resistance and Penicillin Susceptibility. Antimicrob. Agents Chemother.
45: 2648-2650
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»