AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, P. A.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, P. A.
Right arrow Articles by Rawlinson, W. D.

Antimicrobial Agents and Chemotherapy, September 2001, p. 2658-2661, Vol. 45, No. 9
0066-4804/01/$04.00+0   DOI: 10.1128/AAC.45.9.2658-2661.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Integrons and Gene Cassettes in the Enterobacteriaceae

Peter A. White,* Christopher J. McIver, and William D. Rawlinson

Virology Division, Department of Microbiology, SEALS, Prince of Wales Hospital, Randwick, Sydney NSW 2031, and School of Pathology, Faculty of Medicine and School of Microbiology and Immunology, Faculty of Science, The University of New South Wales, Sydney 2052, Australia

Received 5 September 2000/Returned for modification 14 February 2001/Accepted 25 June 2001


    ABSTRACT
Top
Abstract
Text
References

Integrons were detected in 59 of 120 (49%) urinary isolates of Enterobacteriaceae by PCR using degenerate primers targeted to conserved regions of class 1, 2, and 3 integrase genes. PCR sequencing analysis of the cassette arrays revealed a predominance of cassettes that confer resistance to the aminoglycosides and trimethoprim.


    TEXT
Top
Abstract
Text
References

Dissemination of antibiotic resistance genes by horizontal transfer has led to the rapid emergence of antibiotic resistance among clinical isolates of bacteria (20). The spread of resistance genes is greatly enhanced when they form part of a mobile gene cassette, since this provides for horizontal transfer by several mechanisms. These mechanisms include (i) mobilization of individual cassettes by the integron-encoded integrase (9), (ii) movement when the integron containing the cassette relocates---probably by targeted transposition (6, 10, 19), (iii) dissemination of larger transposons such as Tn21 carrying integrons (16), and (iv) movement of conjugative plasmids containing integrons among different bacterial species. It is therefore not surprising that many of the antibiotic resistance genes found in clinical isolates of gram-negative microorganisms are part of a gene cassette inserted into an integron (21). The four classes of integron so far identified (classes 1, 2, 3, and 4) are distinguished by their respective integrase (int) genes (1, 18, 21). Class 4 is a distinctive class of integrons located in the Vibrio cholerae genome and is not known to be associated with antibiotic resistance (18).

Gene cassettes consist of a gene flanked by a recombination site, known as a 59-base element, which is recognized by the integron-encoded site-specific recombinase (IntI). Gene cassettes can exist as free circular molecules (9) and are transcribed only when captured and inserted into an integron, usually at the attI recombination site 104 bp upstream of the intI1 gene (13). New cassettes are continually being discovered, and now over 60 cassettes that confer resistance to a range of antimicrobial agents have been identified (14, 21, 23).

Despite the detailed understanding of the molecular relationship between gene cassettes and integrons (13, 21), there is a paucity of information on how widespread these elements are in a hospital setting. Only a few studies have suggested that integrons are widespread in both animal and human clinical bacterial isolates (3, 15, 17, 22). In this study we have determined the incidence of integrons and their class and characterized the cassette arrays in a collection of random isolates collected from nine clinical settings in Sydney, Australia.

Clinical isolates. One hundred and twenty urinary isolates identified as belonging to the Enterobacteriaceae were studied. The isolates were randomly selected during a six-month period (August 1998 to January 1999) from patients in 46 wards of seven hospitals and two community clinics. These organisms were identified as Escherichia coli (n = 90), Proteus sp. (n = 13), Klebsiella sp. (n = 15), and Enterobacter sp. (n = 2) using standard biochemical criteria (2). The diversity of the 120 isolates was assessed by calculating Simpson's index, using identification of bacterial genus (n = 4) and antibiotic profiles (n = 52). The probability of selecting two strains at random from different genera with different antibiotic profiles was calculated to be 94.2%.

Antibiotic resistance profiles. Sensitivity profiles were established by agar diffusion using the calibrated dichotomous sensitivity test (4, 5). Isolates were tested for susceptibility to a panel of 18 antibiotics, representing 11 classes (Table 1). Integrons were strongly associated with multiple-antibiotic-resistant strains, with integron-positive strains demonstrating a greater predilection for antibiotic resistance than integron-negative strains (Table 1). Ninety-seven of 120 (81%) strains were resistant to one or more antibiotic. High levels of resistance were found to antibiotics which have been available therapeutically for a long time including ampicillin (64%), sulfafurazole (59%), streptomycin (48%), tetracycline (39%), and trimethoprim (36%) (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Association between antibiotic resistance and integrons in 120 isolates of Enterobacteriaceae

Incidence of integrons in 120 isolates of Enterobacteriaceae. DNA was extracted from bacteria using standard techniques for the isolation of plasmid DNA, and integrons were detected by PCR with the degenerate primers hep35 (5' TGCGGGTYAARGATBTKGATTT 3') and hep36 (5' CARCACATGCGTRTARAT 3'), which hybridize to conserved regions of integron-encoded integrase genes intI1, intI2, and intI3 (23). Fifty-nine of the 120 isolates (49%) were integron positive. The class of the integron was determined by analyzing integrase PCR products by restriction fragment length polymorphism (RFLP) following digestion using either RsaI or HinfI restriction enzyme (Table 2). Restriction analysis revealed that 36% contained a single class 1 integron, 3% contained two class 1 integrons (as determined by the presence of two class 1 cassette PCR products), 6% contained class 1 and 2 integrons, and 4% contained a class 2 integron (Table 3). In total, 58 class 1 integrons and 12 class 2 integrons were identified in 59 of the 120 isolates. No class 3 integrons were detected.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   RFLP classification of integrase PCR products


                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Characterization of integrons, cassette arrays, and integron-associated antibiotic resistance in 59 Enterobacteriaceae isolates

Characterization of cassette arrays. Class 1 integron cassette regions were amplified using hep58 and hep59 as described previously (23). Class 2 integron cassette regions were amplified using hep74 (5' CGGGATCCCGGACGGCATGCACGATTTGTA 3'), which binds to attI2, and hep51 (5' GATGCCATCGCAAGTACGAG 3'), which binds to orfX, which is situated downstream of the cassette region within Tn7 (GenBank accession number AJ002782). Cassette PCR products were restricted with RsaI and HinfI. Two representative products of each distinct RFLP were purified by polyethylene glycol precipitation (11) and sequenced. Analysis of 67 integron cassette regions identified a total of 104 cassettes (Table 3). The cassette regions of three class 1 integrons could not be amplified by PCR, possibly due to the lack of a 3'-conserved segment. Class 1 integrons harbored 11 different cassette arrays (Table 3). The most common types of cassette carried by class 1 integrons were those conferring resistance to streptomycin and spectinomycin. These cassettes represented 53% of all cassettes found and included aadA1 (39% of cassettes), aadA2 (9%), and aadA5 (5%). Streptomycin and spectinomycin are seldom used therapeutically, yet aadA gene cassettes remain prevalent within integrons despite the fact that the integron-encoded integrase is capable of excising them (9). Thus, even when antibiotics cease to be used therapeutically, genes encoding resistance to these antibiotics are not necessarily lost. Indeed, if reexposed to the antibiotic, the integron could demonstrate a form of genetic memory whereby cassettes that are found at the 3' end of the cassette region are repositioned by the integrase, nearer to the promoter, where they are expressed more efficiently (8).

A second aminoglycoside adenylyltransferase gene cassette (aadB), encoding resistance to gentamicin, kanamycin, and tobramycin, was detected exclusively in seven Klebsiella isolates. Interestingly, five of these seven isolates exhibited extended-spectrum beta -lactamase activity, indicating that aadB was also associated with this resistance.

dfr cassettes (dfrA1, -A5, -A12, -A17, and -B2) that confer resistance to trimethoprim represented 27% of cassettes detected (Table 3). It is likely that selection for cassettes carrying dfr genes has occurred in this population because trimethoprim is used to treat urinary tract infections, and this could therefore account for their high prevalence. Other individual cassettes identified in class 1 integrons were orfA and ereA2 (resistance to erythromycin).

All 12 class 2 integrons carried the same three cassettes as those found in Tn7, namely, dfrA1, sat1, and aadA1 (Table 3). This could be explained by the fact that the class 2 integrase gene (intI2) contains an early stop codon resulting in a truncated form of the enzyme. The resultant integrase is therefore unable to excise existing cassettes or insert new ones.

Associations between integrons and antibiotic resistance. Integrons were significantly associated with resistance to certain antibiotics including gentamicin, kanamycin, streptomycin, tobramycin, sulfafurazole, trimethoprim, ampicillin, chloramphenicol, and tetracycline (Table 1). However, resistance to only streptomycin, sulfafurazole, and trimethoprim, and to some extent gentamicin, kanamycin, and tobramycin, could be directly related to the presence of resistance genes within the integron (Table 3). The association of the other older antibiotics ampicillin, chloramphenicol, and tetracycline with the presence of an integron is likely to be due to genetic linkage between integrons and conjugative plasmids and transposons.

Conclusion. Gene cassettes conferring resistance to nearly every major class of antibiotics have been identified, with the notable exception of the quinolones. Despite this, the current impact of integrons on resistance in Sydney, Australia, and indeed in other countries (17), appears to be focused towards older antibiotics such as streptomycin, trimethoprim, sulfafurazole, and the early aminoglycosides. However, genes conferring resistance to recently introduced antibiotics are already part of gene cassettes. Examples include blaIMP, which confers resistance to imipenem and broad-spectrum beta -lactams (22), and aacA7, which confers resistance to modern aminoglycosides such as amikacin and netilmicin (7). These cassettes presumably have not yet received enough selective pressure or had sufficient evolutionary time to encourage their widespread dissemination. However, with the potential of integrons to capture and collect gene cassettes it is likely that they will become more prevalent. Consequently, integrons will continue to threaten the usefulness of antibiotics as therapeutic agents.


    ACKNOWLEDGMENTS

We thank Jeanette Pham, Tiffany Shultz, and John Tapsall for helpful discussions.


    FOOTNOTES

* Corresponding author. Mailing address: Virology Division, Department of Microbiology, SEALS, Prince of Wales Hospital, Randwick, NSW 2031, Australia. Phone: 61 2 9382 9096. Fax: 61 2 9398 4275. E-mail: whitepa{at}sesahs.nsw.gov.au.


    REFERENCES
Top
Abstract
Text
References

1. Arakawa, Y., M. Murakami, K. Suzuki, H. Ito, R. Wacharotayankun, S. Ohsuka, N. Kato, and M. Ohta. 1995. A novel integron-like element carrying the metallo-beta-lactamase gene blaIMP. Antimicrob. Agents Chemother. 39:1612-1615[Abstract].
2. Barrow, G. I., and R. K. A. Feltham. 1993. Cowan and Steel's manual for the identification of medical bacteria, 3rd ed. Cambridge University Press, Melbourne, Australia.
3. Bass, L., C. A. Liebert, M. D. Lee, A. O. Summers, D. G. White, S. G. Thayer, and J. J. Maurer. 1999. Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli. Antimicrob. Agents Chemother. 43:2925-2929[Abstract/Free Full Text].
4. Bell, S. M. 1988. Additions and modifications to the range of antibiotics tested by the CDS method of antibiotic testing. Pathology 20:303-304[Medline].
5. Bell, S. M. 1975. The CDS disc method of antibiotic sensitivity testing (calibrated dichotomous sensitivity test). Pathology 7:1-48.
6. Brown, H. J., H. W. Stokes, and R. M. Hall. 1996. The integrons In0, In2, and In5 are defective transposon derivatives. J. Bacteriol. 178:4429-4437[Abstract/Free Full Text].
7. Bunny, K. L., R. M. Hall, and H. W. Stokes. 1995. New mobile gene cassettes containing an aminoglycoside resistance gene, aacA7, and a chloramphenicol resistance gene, catB3, in an integron in pBWH301. Antimicrob. Agents Chemother. 39:686-693[Abstract].
8. Collis, C. M., and R. M. Hall. 1995. Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob. Agents Chemother. 39:155-162[Abstract].
9. Collis, C. M., and R. M. Hall. 1992. Gene cassettes from the insert region of integrons are excised as covalently closed circles. Mol. Microbiol. 6:2875-2885[CrossRef][Medline].
10. Craig, N. L. 1996. Transposon Tn7. Curr. Top. Microbiol. Immunol. 204:27-48[Medline].
11. Craxton, M. 1991. Linear amplification sequencing, a powerful method for sequencing DNA. Methods Companion Methods Enzymol. 3:20-26.
12. Garrod, L. P., H. P. Lambert, and F. O'Grady. 1981. Antibiotic and chemotherapy, 5th ed. Churchill Livingstone, Edinburgh, United Kingdom.
13. Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15:593-600[CrossRef][Medline].
14. Laraki, N., M. Galleni, I. Thamm, M. L. Riccio, G. Amicosante, J. M. Frere, and G. M. Rossolini. 1999. Structure of In31, a blaIMP-containing Pseudomonas aeruginosa integron phyletically related to In5, which carries an unusual array of gene cassettes. Antimicrob. Agents Chemother. 43:890-901[Abstract/Free Full Text].
15. Levesque, C., L. Piche, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185-191[Abstract].
16. Liebert, C. A., R. M. Hall, and A. O. Summers. 1999. Transposon Tn21, flagship of the floating genome. Microbiol. Mol. Biol. Rev. 63:507-522[Abstract/Free Full Text].
17. Martinez-Freijo, P., A. C. Fluit, F. J. Schmitz, V. S. C. Grek, J. Verhoef, and M. E. Jones. 1998. Class 1 integrons in Gram-negative isolates from different European hospitals and association with decreased susceptibility to multiple antibiotic compounds. J. Antimicrob. Chemother. 42:689-696[Abstract/Free Full Text].
18. Mazel, D., B. Dychinco, V. A. Webb, and J. Davies. 1998. A distinctive class of integron in the Vibrio cholerae genome. Science 280:605-608[Abstract/Free Full Text].
19. Minakhina, S., G. Kholodii, S. Mindlin, O. Yurieva, and V. Nikiforov. 1999. Tn5053 family transposons are res site hunters sensing plasmidal res sites occupied by cognate resolvases. Mol. Microbiol. 33:1059-1068[CrossRef][Medline].
20. Ploy, M. C., T. Lambert, J. P. Couty, and F. Denis. 2000. Integrons: an antibiotic resistance gene capture and expression system. Clin. Chem. Lab. Med. 38:483-487[CrossRef][Medline].
21. Recchia, G. D., and R. M. Hall. 1995. Gene cassettes---a new class of mobile element. Microbiology 141:3015-3027[Medline].
22. Senda, K., Y. Arakawa, S. Ichiyama, K. Nakashima, H. Ito, S. Ohsuka, K. Shimokata, N. Kato, and M. Ohta. 1996. PCR detection of metallo-beta-lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum beta-lactams. J. Clin. Microbiol. 34:2909-2913[Abstract].
23. White, P. A., C. J. McIver, Y. M. Deng, and W. D. Rawlinson. 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182:265-269[CrossRef][Medline].
24. White, P. A., and W. D. Rawlinson. 2001. Current status of the aadA and dfr gene cassette families. J. Antimicrob. Chemother. 47:495-496[Free Full Text].


Antimicrobial Agents and Chemotherapy, September 2001, p. 2658-2661, Vol. 45, No. 9
0066-4804/01/$04.00+0   DOI: 10.1128/AAC.45.9.2658-2661.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, P. A.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, P. A.
Right arrow Articles by Rawlinson, W. D.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS