![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Antimicrobial Agents and Chemotherapy, September 2001, p. 2658-2661, Vol. 45, No. 9
0066-4804/01/$04.00+0 DOI: 10.1128/AAC.45.9.2658-2661.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Virology Division, Department of Microbiology, SEALS, Prince of Wales Hospital, Randwick, Sydney NSW 2031, and School of Pathology, Faculty of Medicine and School of Microbiology and Immunology, Faculty of Science, The University of New South Wales, Sydney 2052, Australia
Received 5 September 2000/Returned for modification 14 February 2001/Accepted 25 June 2001
 |
ABSTRACT |
|---|
Top
Abstract
Text
References
|
|---|
Integrons were detected in 59 of 120 (49%) urinary isolates of Enterobacteriaceae by PCR using degenerate primers targeted to conserved regions of class 1, 2, and 3 integrase genes. PCR sequencing analysis of the cassette arrays revealed a predominance of cassettes that confer resistance to the aminoglycosides and trimethoprim.
| |
TEXT |
|---|
|
Top
Abstract
Text
References
|
|---|
Dissemination of antibiotic
resistance genes by horizontal transfer has led to the rapid emergence
of antibiotic resistance among clinical isolates of bacteria
(20). The spread of resistance genes is greatly enhanced
when they form part of a mobile gene cassette, since this provides for
horizontal transfer by several mechanisms. These mechanisms include (i)
mobilization of individual cassettes by the integron-encoded integrase
(9), (ii) movement when the integron containing the
cassette relocates
probably by targeted transposition (6, 10,
19), (iii) dissemination of larger transposons such as
Tn21 carrying integrons (16), and (iv) movement
of conjugative plasmids containing integrons among different bacterial
species. It is therefore not surprising that many of the antibiotic
resistance genes found in clinical isolates of gram-negative
microorganisms are part of a gene cassette inserted into an integron
(21). The four classes of integron so far identified
(classes 1, 2, 3, and 4) are distinguished by their
respective integrase (int) genes (1, 18,
21). Class 4 is a distinctive class of integrons located in the
Vibrio cholerae genome and is not known to be associated
with antibiotic resistance (18).
Gene cassettes consist of a gene flanked by a recombination site, known as a 59-base element, which is recognized by the integron-encoded site-specific recombinase (IntI). Gene cassettes can exist as free circular molecules (9) and are transcribed only when captured and inserted into an integron, usually at the attI recombination site 104 bp upstream of the intI1 gene (13). New cassettes are continually being discovered, and now over 60 cassettes that confer resistance to a range of antimicrobial agents have been identified (14, 21, 23).
Despite the detailed understanding of the molecular relationship between gene cassettes and integrons (13, 21), there is a paucity of information on how widespread these elements are in a hospital setting. Only a few studies have suggested that integrons are widespread in both animal and human clinical bacterial isolates (3, 15, 17, 22). In this study we have determined the incidence of integrons and their class and characterized the cassette arrays in a collection of random isolates collected from nine clinical settings in Sydney, Australia.
Clinical isolates. One hundred and twenty urinary isolates identified as belonging to the Enterobacteriaceae were studied. The isolates were randomly selected during a six-month period (August 1998 to January 1999) from patients in 46 wards of seven hospitals and two community clinics. These organisms were identified as Escherichia coli (n = 90), Proteus sp. (n = 13), Klebsiella sp. (n = 15), and Enterobacter sp. (n = 2) using standard biochemical criteria (2). The diversity of the 120 isolates was assessed by calculating Simpson's index, using identification of bacterial genus (n = 4) and antibiotic profiles (n = 52). The probability of selecting two strains at random from different genera with different antibiotic profiles was calculated to be 94.2%.
Antibiotic resistance profiles.
Sensitivity profiles were
established by agar diffusion using the calibrated dichotomous
sensitivity test (4, 5). Isolates were tested for
susceptibility to a panel of 18 antibiotics, representing 11 classes
(Table 1). Integrons were strongly
associated with multiple-antibiotic-resistant strains, with
integron-positive strains demonstrating a greater predilection for
antibiotic resistance than integron-negative strains (Table 1).
Ninety-seven of 120 (81%) strains were resistant to one or more
antibiotic. High levels of resistance were found to antibiotics which
have been available therapeutically for a long time including
ampicillin (64%), sulfafurazole (59%), streptomycin (48%),
tetracycline (39%), and trimethoprim (36%) (Table 1).
|
Incidence of integrons in 120 isolates of
Enterobacteriaceae.
DNA was extracted from bacteria
using standard techniques for the isolation of plasmid DNA, and
integrons were detected by PCR with the degenerate primers hep35
(5' TGCGGGTYAARGATBTKGATTT 3') and hep36 (5'
CARCACATGCGTRTARAT 3'), which hybridize to conserved regions of
integron-encoded integrase genes intI1, intI2,
and intI3 (23). Fifty-nine of the 120 isolates
(49%) were integron positive. The class of the integron was determined
by analyzing integrase PCR products by restriction fragment length
polymorphism (RFLP) following digestion using either RsaI or
HinfI restriction enzyme (Table
2). Restriction analysis revealed that
36% contained a single class 1 integron, 3% contained two class 1 integrons (as determined by the presence of two class 1 cassette PCR
products), 6% contained class 1 and 2 integrons, and 4% contained a
class 2 integron (Table 3). In total, 58 class 1 integrons and 12 class 2 integrons were identified in 59 of the
120 isolates. No class 3 integrons were detected.
|
|
Characterization of cassette arrays. Class 1 integron cassette regions were amplified using hep58 and hep59 as described previously (23). Class 2 integron cassette regions were amplified using hep74 (5' CGGGATCCCGGACGGCATGCACGATTTGTA 3'), which binds to attI2, and hep51 (5' GATGCCATCGCAAGTACGAG 3'), which binds to orfX, which is situated downstream of the cassette region within Tn7 (GenBank accession number AJ002782). Cassette PCR products were restricted with RsaI and HinfI. Two representative products of each distinct RFLP were purified by polyethylene glycol precipitation (11) and sequenced. Analysis of 67 integron cassette regions identified a total of 104 cassettes (Table 3). The cassette regions of three class 1 integrons could not be amplified by PCR, possibly due to the lack of a 3'-conserved segment. Class 1 integrons harbored 11 different cassette arrays (Table 3). The most common types of cassette carried by class 1 integrons were those conferring resistance to streptomycin and spectinomycin. These cassettes represented 53% of all cassettes found and included aadA1 (39% of cassettes), aadA2 (9%), and aadA5 (5%). Streptomycin and spectinomycin are seldom used therapeutically, yet aadA gene cassettes remain prevalent within integrons despite the fact that the integron-encoded integrase is capable of excising them (9). Thus, even when antibiotics cease to be used therapeutically, genes encoding resistance to these antibiotics are not necessarily lost. Indeed, if reexposed to the antibiotic, the integron could demonstrate a form of genetic memory whereby cassettes that are found at the 3' end of the cassette region are repositioned by the integrase, nearer to the promoter, where they are expressed more efficiently (8).
A second aminoglycoside adenylyltransferase gene cassette (aadB), encoding resistance to gentamicin, kanamycin, and tobramycin, was detected exclusively in seven Klebsiella isolates. Interestingly, five of these seven isolates exhibited extended-spectrum
-lactamase activity,
indicating that aadB was also associated with this resistance.
dfr cassettes (dfrA1, -A5,
-A12, -A17, and -B2) that confer resistance
to trimethoprim represented 27% of cassettes detected (Table 3).
It is likely that selection for cassettes carrying dfr genes
has occurred in this population because trimethoprim is used to treat
urinary tract infections, and this could therefore account for their
high prevalence. Other individual cassettes identified in class 1 integrons were orfA and ereA2 (resistance to erythromycin).
All 12 class 2 integrons carried the same three cassettes as those
found in Tn7, namely, dfrA1, sat1, and
aadA1 (Table 3). This could be explained by the fact that
the class 2 integrase gene (intI2) contains an early stop
codon resulting in a truncated form of the enzyme. The resultant
integrase is therefore unable to excise existing cassettes or insert
new ones.
Associations between integrons and antibiotic resistance. Integrons were significantly associated with resistance to certain antibiotics including gentamicin, kanamycin, streptomycin, tobramycin, sulfafurazole, trimethoprim, ampicillin, chloramphenicol, and tetracycline (Table 1). However, resistance to only streptomycin, sulfafurazole, and trimethoprim, and to some extent gentamicin, kanamycin, and tobramycin, could be directly related to the presence of resistance genes within the integron (Table 3). The association of the other older antibiotics ampicillin, chloramphenicol, and tetracycline with the presence of an integron is likely to be due to genetic linkage between integrons and conjugative plasmids and transposons.
Conclusion.
Gene cassettes conferring resistance to nearly
every major class of antibiotics have been identified, with the notable
exception of the quinolones. Despite this, the current impact of
integrons on resistance in Sydney, Australia, and indeed in other
countries (17), appears to be focused towards older
antibiotics such as streptomycin, trimethoprim, sulfafurazole, and the
early aminoglycosides. However, genes conferring resistance to recently
introduced antibiotics are already part of gene cassettes. Examples
include blaIMP, which confers resistance to
imipenem and broad-spectrum -lactams (22), and
aacA7, which confers resistance to modern aminoglycosides such as amikacin and netilmicin (7). These cassettes
presumably have not yet received enough selective pressure
or had sufficient evolutionary time to encourage their
widespread dissemination. However, with the potential of integrons
to capture and collect gene cassettes it is likely that they will
become more prevalent. Consequently, integrons will continue
to threaten the usefulness of antibiotics as
therapeutic agents.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jeanette Pham, Tiffany Shultz, and John Tapsall for helpful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Virology Division, Department of Microbiology, SEALS, Prince of Wales Hospital, Randwick, NSW 2031, Australia. Phone: 61 2 9382 9096. Fax: 61 2 9398 4275. E-mail: whitepa{at}sesahs.nsw.gov.au.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Arakawa, Y., M. Murakami, K. Suzuki, H. Ito, R. Wacharotayankun, S. Ohsuka, N. Kato, and M. Ohta. 1995. A novel integron-like element carrying the metallo-beta-lactamase gene blaIMP. Antimicrob. Agents Chemother. 39:1612-1615[Abstract]. |
| 2. | Barrow, G. I., and R. K. A. Feltham. 1993. Cowan and Steel's manual for the identification of medical bacteria, 3rd ed. Cambridge University Press, Melbourne, Australia. |
| 3. |
Bass, L.,
C. A. Liebert,
M. D. Lee,
A. O. Summers,
D. G. White,
S. G. Thayer, and J. J. Maurer.
1999.
Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli.
Antimicrob. Agents Chemother.
43:2925-2929 |
| 4. | Bell, S. M. 1988. Additions and modifications to the range of antibiotics tested by the CDS method of antibiotic testing. Pathology 20:303-304[Medline]. |
| 5. | Bell, S. M. 1975. The CDS disc method of antibiotic sensitivity testing (calibrated dichotomous sensitivity test). Pathology 7:1-48. |
| 6. |
Brown, H. J.,
H. W. Stokes, and R. M. Hall.
1996.
The integrons In0, In2, and In5 are defective transposon derivatives.
J. Bacteriol.
178:4429-4437 |
| 7. | Bunny, K. L., R. M. Hall, and H. W. Stokes. 1995. New mobile gene cassettes containing an aminoglycoside resistance gene, aacA7, and a chloramphenicol resistance gene, catB3, in an integron in pBWH301. Antimicrob. Agents Chemother. 39:686-693[Abstract]. |
| 8. | Collis, C. M., and R. M. Hall. 1995. Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob. Agents Chemother. 39:155-162[Abstract]. |
| 9. | Collis, C. M., and R. M. Hall. 1992. Gene cassettes from the insert region of integrons are excised as covalently closed circles. Mol. Microbiol. 6:2875-2885[CrossRef][Medline]. |
| 10. | Craig, N. L. 1996. Transposon Tn7. Curr. Top. Microbiol. Immunol. 204:27-48[Medline]. |
| 11. | Craxton, M. 1991. Linear amplification sequencing, a powerful method for sequencing DNA. Methods Companion Methods Enzymol. 3:20-26. |
| 12. | Garrod, L. P., H. P. Lambert, and F. O'Grady. 1981. Antibiotic and chemotherapy, 5th ed. Churchill Livingstone, Edinburgh, United Kingdom. |
| 13. | Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15:593-600[CrossRef][Medline]. |
| 14. |
Laraki, N.,
M. Galleni,
I. Thamm,
M. L. Riccio,
G. Amicosante,
J. M. Frere, and G. M. Rossolini.
1999.
Structure of In31, a blaIMP-containing Pseudomonas aeruginosa integron phyletically related to In5, which carries an unusual array of gene cassettes.
Antimicrob. Agents Chemother.
43:890-901 |
| 15. | Levesque, C., L. Piche, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185-191[Abstract]. |
| 16. |
Liebert, C. A.,
R. M. Hall, and A. O. Summers.
1999.
Transposon Tn21, flagship of the floating genome.
Microbiol. Mol. Biol. Rev.
63:507-522 |
| 17. |
Martinez-Freijo, P.,
A. C. Fluit,
F. J. Schmitz,
V. S. C. Grek,
J. Verhoef, and M. E. Jones.
1998.
Class 1 integrons in Gram-negative isolates from different European hospitals and association with decreased susceptibility to multiple antibiotic compounds.
J. Antimicrob. Chemother.
42:689-696 |
| 18. |
Mazel, D.,
B. Dychinco,
V. A. Webb, and J. Davies.
1998.
A distinctive class of integron in the Vibrio cholerae genome.
Science
280:605-608 |
| 19. | Minakhina, S., G. Kholodii, S. Mindlin, O. Yurieva, and V. Nikiforov. 1999. Tn5053 family transposons are res site hunters sensing plasmidal res sites occupied by cognate resolvases. Mol. Microbiol. 33:1059-1068[CrossRef][Medline]. |
| 20. | Ploy, M. C., T. Lambert, J. P. Couty, and F. Denis. 2000. Integrons: an antibiotic resistance gene capture and expression system. Clin. Chem. Lab. Med. 38:483-487[CrossRef][Medline]. |
| 21. |
Recchia, G. D., and R. M. Hall.
1995.
Gene cassettesa new class of mobile element.
Microbiology
141:3015-3027[Medline].
|
| 22. | Senda, K., Y. Arakawa, S. Ichiyama, K. Nakashima, H. Ito, S. Ohsuka, K. Shimokata, N. Kato, and M. Ohta. 1996. PCR detection of metallo-beta-lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum beta-lactams. J. Clin. Microbiol. 34:2909-2913[Abstract]. |
| 23. | White, P. A., C. J. McIver, Y. M. Deng, and W. D. Rawlinson. 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182:265-269[CrossRef][Medline]. |
| 24. |
White, P. A., and W. D. Rawlinson.
2001.
Current status of the aadA and dfr gene cassette families.
J. Antimicrob. Chemother.
47:495-496 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clin. Vaccine Immunol. | Clin. Microbiol. Rev. |
|---|---|
| J. Clin. Microbiol. | ALL ASM JOURNALS |
