This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nichol, K. A.
Right arrow Articles by Hoban, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nichol, K. A.
Right arrow Articles by Hoban, D. J.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, October 2002, p. 3261-3264, Vol. 46, No. 10
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.10.3261-3264.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Penicillin-Binding Protein 1A, 2B, and 2X Alterations in Canadian Isolates of Penicillin-Resistant Streptococcus pneumoniae

Kimberly A. Nichol,1,2* George G. Zhanel,1,2,3,4 and Daryl J. Hoban1,2

Department of Medical Microbiology, Faculty of Medicine,1 Faculty of Pharmacy, University of Manitoba,3 Departments of Medicine,4 Clinical Microbiology, Health Sciences Centre, Winnipeg, Manitoba R3A 1R9, Canada2

Received 30 October 2001/ Returned for modification 16 March 2002/ Accepted 10 July 2002


arrow
ABSTRACT
 
Alterations within the penicillin-binding domain of penicillin-binding protein (PBP) genes pbp1a, pbp2b, and pbp2x were determined for 15 Canadian isolates of Streptococcus pneumoniae. All penicillin-nonsusceptible S. pneumoniae isolates showed a variety of PBP 2X substitutions and contained a Thr445-Ala change after the PBP 2B SSN motif. Only isolates for which penicillin MICs were >=0.5 µg/ml had PBP 1A alterations near the STMK and SRN motifs. Sequence analysis revealed identical PBP 1A, PBP 2B, and PBP 2X substitution patterns among all isolates for which penicillin MICs were >=1 µg/ml.


arrow
TEXT
 
Streptococcus pneumoniae remains one of the most important bacterial pathogens associated with community-acquired pneumonia, meningitis, sinusitis, and acute otitis media (3). Penicillin has traditionally been used for the treatment of most pneumococcal infections. Recently, however, the efficacy of ß-lactam antibiotics has been compromised by rapid increases in the prevalence of penicillin-resistant S. pneumoniae (3). In Canada, data from a 1997-1998 national surveillance study have demonstrated that S. pneumoniae strains with reduced susceptibility to penicillin constitute 21.2% of respiratory tract isolates (23).

The major antibacterial action of penicillin is derived from its ability to bind to and inactivate penicillin-binding proteins (PBPs). PBPs are membrane-associated serine peptidases that catalyze the polymerization and transpeptidation of glycan strands during the final steps of peptidoglycan biosynthesis (22). In all PBPs, the catalytic centers of transpeptidase activity are defined by three conserved amino acid motifs: SXXK (including the active-site serine residue), SXN and KXG (9). Six PBPs have been identified in S. pneumoniae, including five high-molecular-weight PBPs (1A, 1B, 2A, 2B, and 2X) and the low-molecular-weight PBP 3 (11). Pneumococcal resistance to penicillin is attributed to altered PBPs 1A, 2B, and 2X with reduced affinities for ß-lactam antibiotics (4, 13, 15). The mosaic genes that encode these low-affinity variants are the product of interspecies recombinational events involving horizontal transfer of PBP genes from closely related species (6, 15, 17).

Genetic analyses of pbp1a, pbp2b, and pbp2x have previously been conducted in penicillin-susceptible and -resistant S. pneumoniae isolates from Czechoslovakia (6), Japan (1, 2), Papua New Guinea (6), South Africa (6, 10, 17, 19-21), Spain (6, 10, 17), and the United States (1, 6). To our knowledge, similar studies have not been conducted with penicillin-resistant isolates from across Canada. The purpose of this study was to determine the nucleotide sequence of a 1-kb region encoding the penicillin-binding domain (PBD) of pbp1a, pbp2b, and pbp2x from Canadian isolates of S. pneumoniae.

Fifteen clinical isolates of S. pneumoniae were selected from more than 2,500 isolates collected between 1997 and 1999 as part of an ongoing Canadian national surveillance study (23). Selection of isolates was based upon the penicillin MIC and included five penicillin-susceptible (MIC, <=0.06 µg/ml), five penicillin-intermediate (MIC, 0.12 to 1 µg/ml), and five penicillin-resistant (MIC, >=2 µg/ml) isolates. The clinical and demographic parameters of the S. pneumoniae isolates examined in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Penicillin susceptibility and demographics of S. pneumoniae isolates recovered in Canada

Chromosomal DNA was extracted and 1.1-, 1.3-, and 1.1-kb fragments encoding the PBDs of pbp1a, pbp2b, and pbp2x, respectively, were amplified by PCR. The primers used for amplification of these genes were as follows: pbp1a, 5'-T1827GGGATGGATGTTTACACAAATG1849 and 5'-G3023TCGTACTATTATTTGTGCTTGG3001; pbp2b, 5'-G995GCTATTCTCTAAATGACCGT1015 and 5'-A2311GCTTAGCAATAGGTGTTGG2292;and pbp2x, 5'-T958ATGAAAA(G/A)GA(T/C)CGT(C/G)T(G/A)GG977 and 5'-A2105GAGAGTCTTTCATAGCTGAAGC2083. PCR was performed with a Perkin-Elmer GeneAmp PCR System 9700 under the following conditions: 94°C for 5 min; 30 cycles at 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 7 min. The nucleotide sequences of the PBD of pbp1a, pbp2b, and pbp2x were determined by sequencing with a series of oligonucleotides that were primed at intervals of ±275 nucleotides along each gene. Sequencing reactions were performed with the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction kit and analyzed with an ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems, Foster City, Calif.). The nucleotide and deduced amino acid sequences of PBP 1A, PBP 2B, and PBP 2X were aligned and compared with the published sequence of penicillin-susceptible S. pneumoniae R6 (8, 14, 16).

Four of five penicillin-susceptible isolates (3203, 8099, 11184, and 14016) had PBP 2X nucleotide and amino acid sequences highly homologous (>=99.7%) to R6 (Table 2). In contrast, isolate 12244 carried 57 (5.7%) nucleotide alterations, 9 of which were nonsynonymous substitutions, and possessed a Thr338-Ala alteration within the STMK motif. Although alterations in PBP 2X may mediate low-level resistance to cephalosporins with almost no effect on penicillin susceptibility (1, 10), this isolate remained susceptible to cefotaxime and ceftriaxone (MICs, <=0.06 µg/ml) as well as related ß-lactams (data not shown). S. pneumoniae isolates for which penicillin MICs were >=0.5 µg/ml had identical pbp2x genes and revealed extensive sequence divergence from R6, differing by 177 (17.7%) nucleotide substitutions and 38 (11.4%) amino acid alterations. These isolates had altered pbp1a, pbp2b, and pbp2x genes and two key amino acid substitutions (Thr338-Ala and Leu546-Val) within the pbp2x gene product. The majority of amino acid changes within the PBP 2X transpeptidase domain of these isolates were found to lie between the STMK and SSN motifs and/or within the locality of the C-terminal KSG motif. Recently, structural evidence linking penicillin resistance to the absence of a hydroxyl group following substitution of Ala for Thr338 has been presented (18). Kinetic parameters of PBP 2X variants have suggested that the substitution of Thr338 near the active-site serine residue significantly reduces the acylation efficiency of this resistance determinant by modifying the reactivity of Ser337 toward both the antibiotic and substrate analogues (18).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Distribution of nucleotide and amino acid substitutions in the PBD of PBP 2X from clinical isolates of S. pneumoniae

Within the PBD of pbp2b, penicillin-intermediate and -resistant isolates carried a variety of nonsynonymous substitutions (Table 3). The majority of these nucleotide and associated amino acid alterations occurred within a ±250-bp area between Asn404 and Thr488 and were located within the vicinity of the SVVK tetrad (which houses the active-site serine) and the SSN motif. Four prominent substitutions were common to all isolates for which the MIC was at least 0.12 µg/ml. These included the replacement of Glu332 by Gly, Thr445 by Ala, Glu475 by Gly, and Thr488 by Ser or Ala. The importance of the exchange of Ala for Thr445, which has similarly been identified in all resistant isolates analyzed to date (10), was previously noted by Dowson and coworkers (7) and occurs adjacent to the conserved SSN motif. Because the Asn residue of this motif has been proposed to form a hydrogen bond with the carbonyl group of the penicillin R1 side chain, the substitution of Ala for Thr445 presumably disrupts this hydrogen bond and leads to a reduction in the affinity of the protein (12).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Distribution of nucleotide and amino acid substitutions in the PBD of PBP 2B from clinical isolates of S. pneumoniae

Analysis of pbp2b revealed highly similar patterns of nucleotide and amino acid sequence variation among all resistant isolates (MICs, >=2 µg/ml), as well as penicillin-intermediate isolate 3455 (MIC, 1 µg/ml). These isolates showed simultaneous alterations in pbp1a, pbp2b, and pbp2x and substitution of Thr445-Ala immediately following the SSN motif. A similar substitution pattern within or adjacent to the three conserved amino acid motifs was likewise seen when the penicillin MIC was 0.5 µg/ml. By comparison, penicillin MICs were 0.12 to 0.25 µg/ml when the same Thr445-Ala substitution was detected, but only two of three PBP genes were altered.

All penicillin-susceptible isolates and three of five penicillin-intermediate (MICs, 0.12 to 0.25 µg/ml) isolates (12276, 3996, and 11413) showed a low degree of PBP 1A sequence variation (<1%) when compared to R6. The PBD of PBP 1A from these isolates revealed four to six nucleotide alterations and up to three amino acid substitutions (Table 4). In isolates with MICs between 0.03 and 0.25 µg/ml, nucleotide and amino acid alterations were essentially confined to an area surrounding the KTG motif. This included substitution of Asp533 by Glu or replacement of Ser540 with Thr. Widespread alterations within the PBD of PBP 1A were observed among five penicillin-resistant isolates (MICs, >=2 µg/ml) and penicillin-intermediate isolate 3455 (MIC, 1 µg/ml), where nucleotide and amino acid sequences differed from those of R6 by 18.3 and 11.6%, respectively. Only isolates for which MICs were >=0.5 µg/ml had amino acid alterations within the locality of the STMK and SRN motifs. Two key changes within these regions included the substitution of Ser or Ala for Thr371 adjacent to the active-site serine residue and that of Thr for Pro432 just after the SRN motif.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Distribution of nucleotide and amino acid substitutions in the PBD of PBP 1A from clinical isolates of S. pneumoniae

Examination of the PBD of PBP 1A from resistant isolates has revealed that substitution of Thr371 by Ser or Ala is predominant and is furthermore associated with the high level of resistance in strains having simultaneous alterations in PBP 2X and PBP 2B. It has been hypothesized, therefore, that substitution of Thr371 adjacent to the active-site serine may change the three-dimensional structure of the transpeptidase domain and alter enzymatic activity for peptidoglycan synthesis (2). Consequently, for isolates with altered pbp2x and pbp2b genes and in which Thr371 was substituted by Ala in the PBP 1A STMK motif, penicillin MICs were >=1 µg/ml. For isolate 14126, which likewise had altered pbp2x and pbp2b genes, but which carried a Thr371-to-Ser substitution in PBP 1A, the penicillin MIC was 0.5 µg/ml. For three isolates (11413, 3996, and 12276) with alterations in two PBP genes, but not in the PBP 1A STMK or SRN motifs, penicillin MICs were 0.12 to 0.25 µg/ml. No substitutions within or adjacent to the conserved amino acid motifs of PBP 1A were observed in penicillin-susceptible isolates.

Sequence analysis revealed identical PBP 1A, 2B, and 2X substitution patterns among all isolates for which penicillin MICs were >=1 µg/ml. PBP gene sequences from these isolates showed 99 to 100% identity with those previously described in isolates from Japan, South Africa, and Spain (2, 17, 20). Evaluation of pulsed-field gel electrophoresis patterns showed that four of five penicillin-resistant isolates were genetically related and may be variants of the international Spanish/USA serotype 23F clone (data not shown).

In summary, penicillin MICs for clinical isolates of S. pneumoniae appear to be influenced by alterations in various combinations of the pbp1a, pbp2b, and pbp2x genes. Characterization of the PBP sequence profiles of these isolates, however, has suggested that not all steps of resistance increase are mediated solely by alterations in the genes encoding PBPs 1A, 2B, and 2X. In Canadian S. pneumoniae isolates, for example, identical mosaic PBP arrangements were found to occur at widely different MICs (1 to 4 µg/ml). This suggests that a limited number of analogous amino acid changes are associated with resistance in clinical isolates and that, at least theoretically, additional PBP and non-PBP genes may also be involved in the development of resistance. PBP 1B variants with reduced affinity have been previously described in interspecies transformations to penicillin resistance (5), and a low-affinity PBP 2A has been noted in several penicillin-resistant clinical isolates of S. pneumoniae (15). Further analysis will therefore determine whether amino acid substitutions in PBP 1B and PBP 2A contribute to the development of penicillin resistance in Canadian clinical isolates of S. pneumoniae.


arrow
ACKNOWLEDGMENTS
 
We thank the participating centers, investigators, and laboratory site staff for their continued support. The technical assistance of L. Palatnick, B. Weshnoweski, and T. Bellyou is appreciated.

Financial support from Abbott Laboratories, Ltd., Aventis Pharma, Bayer, Inc., Bristol-Myers Squibb Pharmaceutical Group, GlaxoSmithKline, Janssen-Ortho, Inc., Merck Frosst Canada & Co., and Pharmacia Upjohn is gratefully acknowledged.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Clinical Microbiology, Health Sciences Centre, MS673-820 Sherbrook St., Winnipeg, Manitoba R3A 1R9, Canada. Phone: (204) 787-4684. Fax: (204) 787-4699. E-mail: knichol{at}hsc.mb.ca. Back


arrow
REFERENCES
 
    1
  1. Asahi, Y., Y. Takeuchi, and K. Ubukata. 1999. Diversity of substitutions within or adjacent to conserved amino acid motifs of penicillin-binding protein 2X in cephalosporin-resistant Streptococcus pneumoniae isolates. Antimicrob. Agents Chemother. 43:1252-1255.[Abstract/Free Full Text]
  2. 2
  3. Asahi, Y., and K. Ubukata. 1998. Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:2267-2273.[Abstract/Free Full Text]
  4. 3
  5. Ball, P. 1999. Therapy for pneumococcal infection at the millenium: doubts and certainties. Am. J. Med. 107:77S-85S.[CrossRef][Medline]
  6. 4
  7. Barcus, V. A., K. Ghanekar, M. Yeo, T. J. Coffey, and C. G. Dowson. 1995. Genetics of high-level penicillin resistance in clinical isolates of Streptococcus pneumoniae. FEMS Microbiol. Lett. 126:299-304.[CrossRef][Medline]
  8. 5
  9. Chalkley, L. J., and H. J. Koornhof. 1990. Intra- and interspecific transformation of Streptococcus pneumoniae to penicillin resistance. J. Antimicrob. Chemother. 26:21-28.[Abstract/Free Full Text]
  10. 6
  11. Dowson, C. G., A. Hutchinson, J. A. Brannigan, R. C. George, D. Hansman, J. Liñares, A. Tomasz, J. M. Smith, and B. G. Spratt. 1989. Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 86:8842-8846.[Abstract/Free Full Text]
  12. 7
  13. Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Extensive remodelling of the transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South African isolate of Streptococcus pneumoniae. Mol. Microbiol. 3:95-102.[Medline]
  14. 8
  15. Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Nucleotide sequence of the penicillin-binding protein 2B gene of Streptococcus pneumoniae strain R6. Nucleic Acids Res. 17:7518.[Free Full Text]
  16. 9
  17. Ghuysen, J. 1991. Serine ß-lactamases and penicillin-binding proteins. Annu. Rev. Microbiol. 45:37-67.[CrossRef][Medline]
  18. 10
  19. Grebe, T., and R. Hakenbeck. 1996. Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of ß-lactam antibiotics. Antimicrob. Agents Chemother. 40:829-834.[Abstract]
  20. 11
  21. Hakenbeck, R., H. Ellerbrok, T. Briese, S. Handwerger, and A. Tomasz. 1986. Penicillin-binding proteins of penicillin-susceptible and -resistant pneumococci: immunological relatedness of altered proteins and changes in peptides carrying the ß-lactam binding site. Antimicrob. Agents Chemother. 30:553-558.[Abstract/Free Full Text]
  22. 12
  23. Herzberg, O., and J. Moult. 1987. Bacterial resistance to ß-lactam antibiotics: crystal structure of ß-lactamase from Staphylococcus aureus PCI at 2.5 Å resolution. Science 236:694-701.[Abstract/Free Full Text]
  24. 13
  25. Kell, C. M., U. K. Sharma, C. G. Dowson, C. Town, T. S. Balganesh, and B. G. Spratt. 1993. Deletion analysis of the essentiality of penicillin-binding proteins 1A, 2B and 2X of Streptococcus pneumoniae. FEMS Microbiol. Lett. 106:171-175.[CrossRef][Medline]
  26. 14
  27. Laible, G., R. Hakenbeck, M. A. Sicard, B. Joris, and J. M. Ghuysen. 1989. Nucleotide sequences of the pbpX genes encoding the penicillin-binding proteins 2x from Streptococcus pneumoniae R6 and a cefotaxime-resistant mutant, C506. Mol. Microbiol. 3:1337-1348.[CrossRef][Medline]
  28. 15
  29. Laible, G., B. G. Spratt, and R. Hakenbeck. 1991. Interspecies recombinational events during the evolution of altered PBP 2X genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5:1993-2000.[Medline]
  30. 16
  31. Martin, C., T. Briese, and R. Hakenbeck. 1992. Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin-binding proteins 1A and 1B. J. Bacteriol. 174:4517-4523.[Abstract/Free Full Text]
  32. 17
  33. Martin, C., C. Sibold, and R. Hakenbeck. 1992. Relatedness of penicillin-binding protein 1a genes from different clones of penicillin-resistant Streptococcus pneumoniae isolated in South Africa and Spain. EMBO J. 11:3831-3836.[Medline]
  34. 18
  35. Mouz, N., E. Gordon, A.-M. di Guilmi, I. Petit, Y. Petillot, Y. Dupont, R. Hakenbeck, T. Vernet, and O. Dideberg. 1998. Identification of a structural determinant for resistance to ß-lactam antibiotics in gram-positive bacteria. Proc. Natl. Acad. Sci. USA 95:13403-13406.[Abstract/Free Full Text]
  36. 19
  37. Smith, A. M., and K. P. Klugman. 1995. Alterations in penicillin-binding protein 2B from penicillin-resistant wild-type strains of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 39:859-867.[Abstract]
  38. 20
  39. Smith, A. M., and K. P. Klugman. 1998. Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:1329-1333.[Abstract/Free Full Text]
  40. 21
  41. Smith, A. M., K. P. Klugman, T. J. Coffey, and B. G. Spratt. 1993. Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa. Antimicrob. Agents Chemother. 37:1938-1944.[Abstract/Free Full Text]
  42. 22
  43. Yao, J. D. C., and R. C. Moellering, Jr. 1995. Antibacterial agents, p. 1281-1307. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 6th ed. ASM Press, Washington, D.C.
  44. 23
  45. Zhanel, G. G., J. A. Karlowsky, L. Palatnick, L. Vercaigne, D. E. Low, Canadian Respiratory Infection Study Group, and D. J. Hoban. 1999. Prevalence of antimicrobial resistance in respiratory tract isolates of Streptococcus pneumoniae: results of a Canadian national surveillance study. Antimicrob. Agents Chemother. 43:2504-2509.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, October 2002, p. 3261-3264, Vol. 46, No. 10
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.10.3261-3264.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Davies, T. A., Page, M. G. P., Shang, W., Andrew, T., Kania, M., Bush, K. (2007). Binding of Ceftobiprole and Comparators to the Penicillin-Binding Proteins of Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus pneumoniae. Antimicrob. Agents Chemother. 51: 2621-2624 [Abstract] [Full Text]  
  • Davies, T. A., Shang, W., Bush, K. (2006). Activities of Ceftobiprole and Other {beta}-Lactams against Streptococcus pneumoniae Clinical Isolates from the United States with Defined Substitutions in Penicillin-Binding Proteins PBP 1a, PBP 2b, and PBP 2x.. Antimicrob. Agents Chemother. 50: 2530-2532 [Abstract] [Full Text]  
  • Marimon, J. M., Perez-Trallero, E., Ercibengoa, M., Gonzalez, A., Fenoll, A., on behalf of the Spanish Pneumococcal Infection St, (2006). Molecular epidemiology and variants of the multidrug-resistant Streptococcus pneumoniae Spain14-5 international clone among Spanish clinical isolates. J Antimicrob Chemother 57: 654-660 [Abstract] [Full Text]  
  • Granger, D., Boily-Larouche, G., Turgeon, P., Weiss, K., Roger, M. (2006). Molecular characteristics of pbp1a and pbp2b in clinical Streptococcus pneumoniae isolates in Quebec, Canada. J Antimicrob Chemother 57: 61-70 [Abstract] [Full Text]  
  • Granger, D., Boily-Larouche, G., Turgeon, P., Weiss, K., Roger, M. (2005). Genetic analysis of pbp2x in clinical Streptococcus pneumoniae isolates in Quebec, Canada. J Antimicrob Chemother 55: 832-839 [Abstract] [Full Text]  
  • Hauser, C., Aebi, S., Muhlemann, K. (2004). An Internationally Spread Clone of Streptococcus pneumoniae Evolves from Low-Level to Higher-Level Penicillin Resistance by Uptake of Penicillin-Binding Protein Gene Fragments from Nonencapsulated Pneumococci. Antimicrob. Agents Chemother. 48: 3563-3566 [Abstract] [Full Text]  
  • Sanbongi, Y., Ida, T., Ishikawa, M., Osaki, Y., Kataoka, H., Suzuki, T., Kondo, K., Ohsawa, F., Yonezawa, M. (2004). Complete Sequences of Six Penicillin-Binding Protein Genes from 40 Streptococcus pneumoniae Clinical Isolates Collected in Japan. Antimicrob. Agents Chemother. 48: 2244-2250 [Abstract] [Full Text]  
  • Pagliero, E., Chesnel, L., Hopkins, J., Croize, J., Dideberg, O., Vernet, T., Di Guilmi, A. M. (2004). Biochemical Characterization of Streptococcus pneumoniae Penicillin-Binding Protein 2b and Its Implication in {beta}-Lactam Resistance. Antimicrob. Agents Chemother. 48: 1848-1855 [Abstract] [Full Text]  
  • Baek, J. Y., Ko, K. S., Oh, W. S., Jung, S.-I., Kim, Y. S., Chang, H.-H., Lee, H., Kim, S. W., Peck, K. R., Lee, N. Y., Song, J.-H. (2004). Unique Variations of pbp2b Sequences in Penicillin-Nonsusceptible Streptococcus pneumoniae Isolates from Korea. J. Clin. Microbiol. 42: 1746-1750 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nichol, K. A.
Right arrow Articles by Hoban, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nichol, K. A.
Right arrow Articles by Hoban, D. J.