Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, December 2002, p. 3770-3775, Vol. 46, No. 12
0066-4804/02/$04.00+0 DOI: 10.1128/AAC.46.12.3770-3775.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Patrick T. Lyden, William A. LaMarr, and Kimberly A. Foster
Microbiotix, Inc., Worcester, Massachusetts
Received 13 May 2002/ Returned for modification 25 July 2002/ Accepted 6 September 2002
|
|
|---|
|
|
|---|
New antibacterial targets and agents are needed to combat this growing antibiotic resistance problem. A promising and unexploited target is replication-specific DNA polymerase IIIC (Pol IIIC), an enzyme product of the polC gene (8, 17). Pol IIIC is found only in Gr+ bacteria with low G+C contents, including Staphylococcus, Enterococcus, Streptococcus, Bacillus, and Listeria species (3, 12). This enzyme is not found in Gr+ bacteria with high G+C contents such as Mycobacterium and Corynebacterium species or in any of the gram-negative (Gr-) organisms (12). We have targeted Pol IIIC for three reasons. First, it is essential for bacterial DNA replication; when its action is blocked, chromosomal DNA fails to replicate and the bacterium dies. Accordingly, Pol IIIC inhibitors are bactericidal (20, 24). Second, the structure of Pol IIIC is highly conserved among Gr+ bacteria (12), suggesting that an effective Pol III inhibitor would display activity against a broad array of clinically relevant Gr+ pathogens. Third, the active site of Pol IIIC is unique in that it has been shown to bind specifically to the small-molecule inhibitors of the 6-anilinouracil (AU) family of inhibitors (6). The AUs act through their capacity to mimic the guanine moiety of dGTP by forming base pairs with an unpaired cytosine on the DNA template (Fig. 1A). The aryl domain of AUs is available to bind to Pol IIIC; the domain then sequesters the enzyme into a nonproductive complex with template primer DNA (5) (Fig. 1B).
![]() View larger version (20K): [in a new window] |
FIG. 1. Mechanisms of action of AU compounds. (A) Structure of HBEMAU with base pairing and aryl domains indicated. (B) Schematic of the inactive complex formed by the AU compounds with the polymerase and DNA template-primer.
|
As more potent inhibitors of the N3-substituted AU family are discovered, it becomes imperative to judge compounds according to the level of resistance development in S. aureus and Enterococcus species. Knowledge of how antibiotic resistance develops is essential to designing variants of a pharmacophore which have minimal liability for generating resistance. We report here on the frequencies of single-step mutations for resistance to HBEMAU compared to the frequencies of resistance to commercial antibiotics for a panel of Gr+ organisms. In addition, resistant Pol IIIC enzymes were sequenced and purified for an analysis of single-site amino acid changes.
(The results presented here were also presented in part at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, Ill., 2001 [M. M. Butler, D. J. Skow, R. Stephenson, P. J. Lyden, W. A. LaMarr, and K. Foster, 41st Intersci. Conf. Antimicrob. Agents Chemother., abstr. 139, 2001].)
|
|
|---|
MIC determinations. Each antimicrobial drug (commercial drug or AU compound) was dissolved in dimethyl sulfoxide (DMSO) and added to one well of a 96-well microassay plate at a concentration of 2,000 or 20 µg/ml, depending on the expected MIC. Twofold serial drug dilutions were made across the plate in DMSO to yield 11 concentrations; in addition, an untreated control was included. The drugs were then transferred to fresh plates at 1.5 µl per well with an electronic multichannel pipette (Matrix, Hudson, N.H.). Log-phase cultures were diluted to yield a concentration of 105 CFU/ml in either Luria broth or BHI medium and transferred to the plates containing drug for a final volume of 150 µl. Each well, including the DMSO controls, contained a final concentration of 1% DMSO. The plates were incubated with shaking at 37°C for 16 to 18 h. Cell growth was determined by measuring the optical density (570 nm; path length, 1 cm) in a microplate reader (Dynex Technologies, Chantilly, Va.). The MICs for the antimicrobial drug-treated cultures were the lowest concentration of drug at which growth was not apparent (less than 25% of the growth for the DMSO control).
Resistance frequency determinations. The frequencies of single-step spontaneous mutations in five bacterial strains were determined. Log-phase bacteria at a concentration of 106 to 1010 CFU were plated onto BHI agar plates containing drug at eight times the MIC of each drug, and the plates were incubated at 37°C for 48 h. In addition, several dilutions of each culture were plated on drug-free media in order to provide accurate colony counts. Resistance frequencies were calculated by dividing the number of colonies growing on antibiotic plates by the total number of CFU plated (10). Each experiment was performed in triplicate on separate days, and mutation frequencies represent average values. In order to verify the stability of each resistant organism, the organisms were transferred several times in drug-free medium and medium containing drug at eight times the MIC and were again tested for resistance.
Isolation of HBEMAU-resistant organisms. HBEMAU-resistant S. aureus and E. faecalis colonies were isolated and tested for target-specific (i.e., polymerase) resistance. The MICs of a variety of AU inhibitors and commercially available antibiotics for all isolated colonies were determined (as described above). Those isolates that were resistant to HBEMAU (i.e., isolates for which the MICs were at least eightfold greater than that for the wild type) and additional AU compounds, but not to other types of antibiotics, were selected for further analysis.
Purification of native wild-type and HBEMAU-resistant Pol IIIC from Bacillus subtilis, S. aureus, and E. faecalis. Pol IIIC enzymes were purified from native organisms by a modified version of a previously described method (2). Wild-type and HBEMAU-resistant B. subtilis isolates were included in this study because purification and analysis of the enzymes from these organisms have been well characterized (4, 11). Briefly, cultures were grown at 37°C in BHI medium to an optical density of 1 (600 nm; path length, 1 cm) and harvested by centrifugation at 4,600 x g (15,000 x g for S. aureus) for 15 min at 4°C. The cell pellets were resuspended in standard buffer (20 mM Tris acetate [pH 8.2], 0.5 mM EDTA, 10 mM magnesium acetate, 20 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride) and lysed by passage through an Aminco French pressure cell (Thermo Spectronic, Rochester, N.Y.) at 20,000 lb/in2. The lysate was briefly sonicated with a Virsonic sonicator (The Virtis Company, Inc., Gardiner, N.Y.) with a medium probe at setting 6 for three 30-s pulses. The lysate was then centrifuged at 40,000 x g for 30 min at 4°C to remove cell debris. The supernatant was mixed with ammonium sulfate (0.5 g per ml) and stirred at 4°C for 30 min. After centrifugation at 40,000 x g for 30 min, the pellet was dissolved in standard buffer plus 20% glycerol and applied to a Sephadex G-25 column (Sigma Aldrich) that had been equilibrated with GAPE buffer (20% glycerol, 200 mM ammonium sulfate, 10 mM potassium phosphate [pH 6.5], 0.5 mM EDTA, 20 mM 2-mercaptoethanol). After the void volume was removed, the desalted protein was eluted with 0.5 column volumes of GAPE buffer. The protein solution was eluted across a DEAE cellulose column (DE52; Whatman, Clifton, N.J.) to remove contaminating DNA. The DE52 column was equilibrated with GAPE buffer and subsequently eluted with GAPE buffer. Further desalting was achieved by application to a second Sephadex G-25 column equilibrated with weak buffer (20% glycerol, 50 mM potassium phosphate [pH 6.5], 20 mM 2-mercaptoethanol), followed by elution with weak buffer. Separation of Pol IIIC from the other replication-specific polymerase found in Gr+ organisms, Pol IIIE, was attained by application to a second DE52 column. The column was equilibrated with weak buffer, protein was applied, and the column was washed with the same buffer. A linear gradient of 0.05 to 0.6 M phosphate in weak buffer was applied to the column, and fractions were collected and assayed as described below. The first peak containing polymerase activity was identified as Pol IIIE (the other replication-specific polymerase found in Gr+ organisms [24]) by Western analysis with an anti-Pol IIIE antibody (see below), while the second peak contained a mixture of Pol IIIC and Pol I (Pol I is the native polymerase responsible for DNA repair [16]). Pol IIIC from the second DE52 peak was further purified from Pol I by application to a Mono-Q column (Pharmacia, Peapack, N.J.) with a Waters (Milford, Mass.) M-45 high-pressure liquid chromatography pump. The peak was first desalted by application to a G-25 column equilibrated with weak buffer and elution with the same buffer. The desalted material was then applied to the Mono-Q column that had been equilibrated with phosphate buffer (50 mM potassium phosphate [pH 7.5], 20% glycerol, 2 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride). After the column was washed with phosphate buffer, a linear gradient of 0 to 1 M NaCl in phosphate buffer was applied. Fractions were collected and assayed as described below. Pol I eluted prior to elution of the peak identified as Pol IIIC by Western analysis with a Pol IIIC-specific antibody (see below) and HBEMAU inhibition polymerase assays.
Pol IIIC assay. DNA polymerase activity was measured in a 96-well plate format. Each 25-µl assay mixture contained 30 mM Tris (pH 7.5), 10 mM magnesium acetate, 4 mM dithiothreitol, and 20% glycerol, with 25 µM dATP, dCTP, and dGTP, 10 µM dTTP (labeled with 3H at 1.44 Ci/mmol), and 0.4 mg of activated calf thymus DNA per ml as substrates, as described previously (2). Reactions were initiated by the addition of 0.025 to 0.06 U of enzyme (1 U is the amount required to incorporate 250 pmol of [3H]dTMP in a standard assay), and the mixture was incubated for 10 min at 30°C. The reaction was terminated by the addition of 100 µl of cold 10% trichloroacetic acid and 10 mM sodium pyrophosphate. Precipitated 3H-labeled DNA was collected on glass fiber filter plates (Millipore, Bedford, Mass.), washed with cold 1 M HCl-100 mM sodium pyrophosphate and then cold 90% ethanol, and dried. The incorporated radioactivity was measured by scintillation counting in a MicroBeta Trilux instrument (Perkin-Elmer Wallac, Inc., Gaithersburg, Md.) in the presence of OptiPhase Supermix (Perkin Elmer Wallac, Inc.). Apparent inhibitor constants (Kis) were determined directly by a truncated assay in the absence of dGTP as described previously (23). The activities of the purified enzyme fractions were measured by using all four deoxynucleoside triphosphates in the reaction mixtures.
Identification of Pol IIIE and Pol IIIC by Western blot analysis. Peak fractions were denatured and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis with PAGEr precast gels (BioWhittaker Molecular Applications, Rockland, Maine) with a 4 to 20% gradient. Proteins were transferred to polyvinylidene fluoride membranes at 100 V in transfer buffer (200 mM glycine, 25 mM Tris base, 20% methanol) at 4°C for 2 h. Blocking was completed by incubation with blocking buffer (2% nonfat milk, TBST [100 mM Tris {pH 7.5}, 150 mM NaCl, 0.1% Tween 20]) at 4°C overnight. Membranes were incubated with polyclonal antibodies (either anti-Pol IIIC or anti-Pol IIIE) in blocking buffer at room temperature for 1 h. The membranes were then washed five times (10 min each) with TBST prior to application of the secondary antibody. Anti-rabbit immunoglobulin G-horseradish peroxidase conjugate (Promega, Madison, Wis.) was applied to the membranes in blocking buffer at room temperature for 1 h. The membranes were washed 10 times (10 min each) with TBST. SuperSignal chemiluminescent substrate (Pierce, Rockford, Ill.) was applied for 1 min, and the membranes were subsequently developed by using BioMax film (Eastman Kodak Co., Rochester, N.Y.).
Cloning and sequencing of wild-type and HBEMAU-resistant Pol IIIC. E. faecalis genomic DNA was purified with a Dneasy tissue kit (Qiagen, Valencia, Calif.). The polC gene was amplified by PCR with the Taq PCR master mix kit (Qiagen). A 27-mer (GCGATTTATTTCTCGAGCTGATGACGC) containing an XhoI restriction site (underlined) and the ATG start sequence (in boldface) was used to prime the sequence upstream of the polC gene. A 31-mer downstream of the stop codon (ATTCACAACATTTCCGGATCCCCAGACCATG) containing a BamHI restriction site (underlined) was used to prime the sequence downstream of the polC gene. The resulting PCR product was digested with XhoI and BamHI and inserted into pBluescript SK(+) (Stratagene, La Jolla, Calif.) that had previously been digested with XhoI and BamHI.
The S. aureus polC gene was amplified by PCR and cloned as described above for E. faecalis polC by using as primers an upstream 26-mer (GGTGGTCTCGAGCTTGGCAATGACAG) and a downstream 30-mer (GGTATTGGATCCACTACGCCATACGCATTA). These primers successfully amplified the polC gene.
Plasmid DNA was prepared for sequencing by using the Plasmid Midi kit (Qiagen). Automated DNA sequencing was performed (Davis Sequencing, Davis, Calif.), and the DNA sequence was translated to the amino acid sequence by using Sequencher software (Gene Codes Corp., Ann Arbor, Mich.). Sequence data for wild-type and resistant B. subtilis polC isolates have been published previously (11).
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Frequency of single-step mutations for five Gr+ organisms
|
Isolation and inhibitor-based analysis of HBEMAU-resistant Pol IIIC enzymes. In order to account for the resistance observed in the whole bacteria, Pol IIIC preparations from wild-type and HBEMAU-resistant organisms were isolated as detailed in Materials and Methods by using wild-type and HBEMAU-resistant B. subtilis isolates as controls. The identity of wild-type Pol IIIC was determined by measuring the HBEMAU-inhibitable activities of the fractions obtained by chromatography. As can be seen in Fig. 2A, separation of wild-type S. aureus Pol IIIC from the other replication-specific polymerase, Pol IIIE, was attained following two rounds of DE52 chromatography. The first column (data not shown) served to remove contaminating DNA. The second DE52 column (Fig. 2A), eluted with a phosphate gradient, separated Pol IIIE from Pol IIIC, but Pol I continued to coelute with Pol IIIC. HBEMAU inhibition of this peak was approximately 53% due to the presence of the contaminating Pol I enzyme, which is insensitive to HBEMAU. The peak identified as containing Pol IIIE was only somewhat sensitive to 250 µM HBEMAU (inhibition, approximately 33%). This observation was reasonable since the 50% inhibitory concentration of HBEMAU for Pol IIIE is quite high (approximately 700 µM). Separation of Pol IIIC from Pol I was achieved with a Mono-Q ion-exchange column (Fig. 2B). As expected, Pol IIIC isolated from the wild-type organism was inhibited approximately 99% by 250 µM HBEMAU, while Pol IIIE and Pol I were either slightly inhibited or not inhibited at all by the same concentration of HBEMAU.
![]() ![]() View larger version (38K): [in a new window] |
FIG. 2. Purification of wild-type S. aureus Pol IIIC from the native organism. Points represent DNA polymerase activity. (A) DEAE cellulose column purification; (B) Mono-Q column purification. , DMSO control; , with 250 µM HBEMAU.
|
![]() ![]() View larger version (39K): [in a new window] |
FIG. 3. Purification of HBEMAU-resistant S. aureus Pol IIIC from the native organism. Points represent DNA polymerase activity. (A) DEAE cellulose column purification; (B) Mono-Q column purification. , DMSO control; , with 250 µM HBEMAU.
|
An identical purification methodology was used to successfully isolate both wild-type and HBEMAU-resistant Pol IIIC enzyme fractions from B. subtilis and E. faecalis (data not shown). Inhibition assays with HBEMAU were performed with each of the six purified Pol IIIC enzymes. As Table 2 demonstrates, the Ki values for all three wild-type Pol IIIC enzymes were in the submicromolar range, as expected. Accordingly, the Ki values for the resistant enzymes were more than 1,000-fold higher than those for their wild-type counterparts. The results of these enzyme isolation studies suggest that the HBEMAU resistance observed is the result of a modification of the Pol IIIC enzyme. Sequencing of the polC gene from each organism was done to definitively prove that Pol IIIC was mutated and to identify the specific site of the mutation in the genome.
|
View this table: [in a new window] |
TABLE 2. HBEMAU Ki values for wild-type versus resistant Pol IIIC
|
|
View this table: [in a new window] |
TABLE 3. Prediction of protein sequences of HBEMAU-resistant organismsa
|
|
|
|---|
Analysis of the MICs for both HBEMAU-sensitive and -resistant organisms suggested that each of the mutations was target specific. In other words, each resistant isolate was resistant only to the AU compounds and not to commercially available antibiotics representing the rifamycin, aminoglycoside, fluoroquinolone, and glycopeptide families. The data appear to be consistent with a target-specific mechanism of action, which is confirmed by the sequence analysis and the enzymology studies. One would expect to obtain non-target-related changes such as uptake, efflux, or drug metabolism mutations. The fact that the MICs of five unrelated antibiotics remained unchanged points against this possibility.
The next logical step in this study was to isolate the putative target (Pol IIIC) encoded by the resistance mutation in the polC gene. Mutants of B. subtilis polC have been described previously (11) and were available for use as a reference. Growth of wild-type and resistant S. aureus and E. faecalis cultures and purification of Pol IIIC from these native (nonrecombinant) sources was accomplished successfully. The altered Pol IIIC enzymes displayed as much polymerase activity as their wild-type counterparts. Inhibition or Ki analysis with purified wild-type Pol IIIC enzymes demonstrated that HBEMAU is as potent against wild-type S. aureus and E. faecalis enzymes as it is against the reference enzyme from B. subtilis. Not unexpectedly, all three enzymes isolated from HBEMAU-resistant hosts had very high Ki values for HBEMAU. The ratio between the Ki values of HBEMAU-resistant and wild-type strains ranged from 2,200 to 3,400 for the three organisms tested. This clearly accounts for the >13- to 26-fold differences in the MICs for these resistant organisms. Higher MIC ratios could not be observed due to limits in drug solubility.
Sequencing of the polC gene in this study has shown, as in previous studies, that a common change associated with AU resistance is Phe1264
Leu, Ile, or Ser. This amino acid (located at position 1261 in S. aureus Pol IIIC) is positioned within the known inhibitor or aryl binding region encompassed by amino acids 1175 to 1273 (4). This region of AU-resistant B. subtilis isolates contains at least four amino acids whose DNA sequences are known to be altered (4). An analysis of the seven mutants isolated from each organism showed that only position 1264 (position 1261 in S. aureus) contained changes (data not shown). Previous studies have shown that transformation of the mutant polC gene (polC27) back into the chromosome of a sensitive parent strain of B. subtilis imparts comparable levels of resistance to the AU compounds (11). This further supports the suggestion that the Pol IIIC enzyme encoded by polC is the sole target of the AU compounds and that its mutation is responsible for resistance.
The AU family of selective inhibitors of Pol IIIC has been exploited, both here and in the past, to demonstrate that Pol IIIC of Gr+ organisms is, indeed, a valid antibiotic target. The AU compounds are effective against many pathogenic strains of S. aureus and Enterococcus species, including antibiotic-resistant organisms (9, 20). In addition, they are protective against lethal staphylococcal infections in vivo (20). In the system used here, resistance in general populations of bacteria was less likely to develop after the use of HBEMAU than after the use of rifampin and gentamicin and was no more likely to develop after the use of HBEMAU than after the use of ciprofloxacin. The results presented here suggest that further study of HBEMAU and its successors is warranted.
This work was supported by Shire BioChem, Inc.
Present address: University of New England College of Osteopathic Medicine, Biddeford, ME 04005. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»