This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, X. X.
Right arrow Articles by Hiramatsu, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, X. X.
Right arrow Articles by Hiramatsu, K.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, April 2002, p. 1147-1152, Vol. 46, No. 4
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.4.1147-1152.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains

Xiao Xue Ma,1 Teruyo Ito,1 Chuntima Tiensasitorn,1 Mantana Jamklang,1 Piriyaporn Chongtrakool,1 Susan Boyle-Vavra,2 Robert S. Daum,2 and Keiichi Hiramatsu1*

Department of Bacteriology, Juntendo University, Tokyo, Japan,1 Department of Pediatrics, University of Chicago Children's Hospital, Chicago, Illinois2

Received 25 July 2001/ Returned for modification 10 October 2001/ Accepted 28 November 2001


arrow
ABSTRACT
 
We identified a new type of staphylococcal cassette chromosome mec (SCCmec) from two community-acquired methicillin-resistant Staphylococcus aureus (MRSA) strains. The novel element, designated type IV SCCmec, had a unique combination of the class B mec gene complex and the type 2 ccr gene complex and was much smaller in size (21 to 24 kb) than previously identified SCCmec elements of hospital-acquired MRSA. Consistent with the strains' susceptibilities to various non-ß-lactam antibiotics, the type IV SCCmec was devoid of any antibiotic resistance genes other than the mecA gene.


arrow
TEXT
 
Since the first discovery of methicillin-resistant Staphylococcus aureus (MRSA) in 1961 in England, MRSA has become one of the most prevalent pathogens that cause nosocomial infections (13). MRSA produces a specific penicillin-binding protein (PBP) called PBP 2' (or PBP 2a) that possesses reduced affinities for binding to ß-lactam antibiotics (2, 7, 22). PBP 2' is encoded by the mecA gene, which is carried by a large mobile genetic element that is designated staphylococcal cassette chromosome mec (SCCmec) and that is integrated on the chromosomes of MRSA strains isolated from hospitals in various countries throughout the world (11, 12, 14, 15).

Recently, MRSA infections have increasingly been reported among groups of patients with no apparent connection to hospitals (4). Those strains, designated community-acquired MRSA (C-MRSA) strains, have been reported in various countries such as Australia (16, 18), New Zealand (19), the United Kingdom (20), Canada (5), and the United States (6, 8). The death of four children caused by C-MRSA strains has alerted us to the threat of latent dissemination of highly virulent C-MRSA strains in the community in the United States (3).

In contrast to hospital-acquired MRSA (H-MRSA), C-MRSA is characteristically susceptible to many antibiotics (3, 21), but it remains unclear whether C-MRSA is a descendant of H-MRSA or was born and evolved independently of the hospital environment (4). In order to understand the evolutionary relationship between C-MRSA and H-MRSA, we determined the entire nucleotide sequences of the SCCmec elements integrated into the chromosomes of two C-MRSA clinical strains. Strain CA05 (JCSC1968) was isolated from the joint fluid of a patient with septic arthritis and osteomyelitis, and strain 8/6-3P (JCSC1978) was isolated from the perineum of another patient (10).

We amplified DNAs encompassing the entire SCCmec sequence by long-range PCR with several sets of primers, as follows. The region from the left extremity to the ccr genes (L-C region) was covered by primer sets {alpha}5 and cLs1 (CA05) or CL2b (8/6-3P) (Fig. 1). Primers {alpha}6 and mcR8 were used to cover the middle part (from the region just upstream of ccrA to mecR1; the C-M region). Two overlapping primer sets (primers is4 and mA2 and primers mA3 and cR1) were used to cover the right extremities (from IS431mec to orfX; the I-R region) (Fig. 1) (11, 12, 14). The rest of the element was amplified and sequenced with primers as described previously (11, 12, 14). The PCR products were purified with a High Pure PCR product purification kit (Roche Diagnostics GmbH, Mannheim, Germany), and their nucleotide sequences were determined as described previously (9).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Structure of the SCCmec elements identified from C-MRSA strains in comparison with the three types of SCCmec elements. (A) Type I SCCmec carried by NCTC 10442. (B) Type IV SCCmec carried by strain CA05 (subtype a). (C) Type IV SCCmec carried by strain 8/6-3P (subtype b). (D) Type II SCCmec carried by N315. (E) Type III SCCmec carried by 85/2082. The ORFs of greater than 200 nucleotides in six possible reading frames of type IV SCCmec elements are illustrated in the squares under the bars that represent essential genes and restriction sites for HindIII and XbaI. Differences in coloration correspond to differences in the nucleotide sequences. Color codes are as follows: white, ORFs or the parts of ORFs that are conserved in all four types of SCCmec elements with greater than 99% amino acid identities; gray, ORFs or the parts of ORFs that are conserved in four types of SCCmec with amino acid identities of 46 to 98%; magenta, ORFs or the parts of ORFs that are common to type I and type II SCCmec elements; yellow, ORFs or the parts of ORFs that are common to type II and type III SCCmec elements; blue, ORFs or the parts of ORFs that are unique to type I SCCmec; red, ORFs or the parts of ORFs that are unique to type II SCCmec; green, ORFs or the parts of ORFs that are unique to type III SCCmec, light green, ORFs or the parts of ORFs that are unique to type IVa SCCmec; and orange, ORFs or the parts of ORFs that are unique to type IVb SCCmec. The locations of primers used for amplification of the type IV SCCmec are indicated by arrows: they are primers {alpha}5 (5'-TGTTAAGTATATTGCACTTTATGATTCAATGCCT-3'), cLs1 (5'-TGCCAATCACAGTTCAATCAATT-3'), {alpha}6 (5'-ATTAGCCGATTTGGTAATTGAA-3'), mCR8 (5'-ATATTCCCGTATGAAAAACAGGACTTGAACTTGCA-3'), and CL2b (ATATTCCCGATAGAAAAACAGGACTTGAACTTGCA) and previously described primers is4, mA2, mA3, and cR1 (11, 12, 14). The entire nucleotide sequences of the type IV SCCmec elements are available in the DDBJ/EMBL/GenBank databases under accession no. AB063172 (subtype a) and AB063173 (subtype b). H, HindIII, X, XbaI; E, EcoRI; P, Pst1.

Figure 1 illustrates the genomic organizations of the SCCmec elements identified from the two C-MRSA strains in comparison with the three extant types of SCCmec. The SCCmec elements of strains CA05 and 8/6-3P were 24,248 and 20,920 bp, respectively, and were much smaller (34 to 67 kb) than three types of SCCmec elements identified from H-MRSA strains (12). Both elements were found to be integrated at the integration site for SCCmec, attBscc, which is found inside orfX, which has an unknown function and is located near the origin of replication of the S. aureus chromosome (12, 15). The SCCmec elements shared a pair of 15-bp direct repeat sequences: one (DRscc-R) at the right extremities and the other (DRscc-L) on the chromosome region abutting the left termini of the elements (shown as thick arrows in Fig. 2). Degenerate inverted repeats were also found in the extremities of the two SCCmec elements (shown by thin arrows in Fig. 2). The authenticity of the SCCmec boundaries was vindicated by using a previously described method (14); i.e., by confirming that the element was precisely cut out from the chromosomes of the two C-MRSA strains, regenerating attBscc in the chromosomes of the cell populations from which it was excised.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. Chromosome-SCCmec junction sequences of type IV SCCmec. The nucleotide sequences around the left and right boundaries of the SCCmec elements of CA05 and 8/6-3P are aligned with those of type II SCCmec. Thin arrows indicate inverted repeats IR-L and IR-R at both extremities of SCCmec elements. Thick arrows indicate direct repeats DRscc-L and DRscc-R.

The nucleotide sequences of the L-C regions of the two SCCmec elements differed from each other, but otherwise, they shared the same features: type 2 ccr gene complexes, the class B mec gene complexes (IS1272-{Delta}mecR1-mecA-IS431), and the I-R region that was 99.9% identical to that of type II SCCmec elements (Fig. 1). This combination of ccr and mec gene complexes was a novel one. That is, the class B mec gene complex has been found to be in close linkage with the type 1 ccr gene complex in type I SCCmec (12). However, the ccr gene complexes of the novel SCCmec elements were more similar to the type 2 gene complex than to the type 1 ccr gene complex: the amino acid identities between the novel CcrA proteins and the type 2 CcrA (CcrA2) and type 1 CcrA (CcrA1) proteins were about 98 and 75%, respectively; and those between the novel CcrB proteins and the CcrB2 and CcrB1 proteins were 97 to 99 and 72 to 81%, respectively (Table 1). Accordingly, we classified the genes as variants of ccrA2 and ccrB2 by designating them the ccrA2.1 and ccrA2.2 genes and the ccrB2.1 and ccrB2.2 genes, respectively (Table 1). As shown in Table 1, the predicted proteins encoded by the open reading frames (ORFs) surrounding the ccrA and ccrB genes also had significantly higher degrees of similarity to those of the type 2 gene complex than to those of the type 1 ccr gene complex. On the basis of this unique combination of the two complexes, we named the novel SCCmec elements type IV SCCmec and assigned the designations subtypes IVa and IVb to the individual elements of CA05 and 8/6-3P, respectively, on the basis of their unique nucleotide sequences in the L-C region (Fig. 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. ORFs in SCCmec’s of CA05 and 8/6-3P

The BLAST and MOTIF programs failed to assign any biological functions to the hypothetical ORFs in the L-C regions of type IV SCCmec elements (1, 17). With their simple genetic organizations, neither a virulence factor nor antibiotic resistance other than that encoded by mecA was found to be encoded by the entire regions of the novel SCCmec elements. This lack of genes encoding resistance to non-ß-lactam antibiotics in the type IV SCCmec was consistent with the notable characteristic of C-MRSA; i.e., its susceptibility to various antibiotics except ß-lactams (3, 6). In fact, as shown in Table 2, the two strains were susceptible to all the non-ß-lactam antibiotics tested.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Antibiotic susceptibility profiles of the two C-MRSA strains in comparison with those of H-MRSA strains

The lack of function of type IV SCCmec other than those for the movement of the element (ccr genes) and methicillin resistance (mecA), together with its small size, may lead to the view that the element has gone through evolutionary refinement as a specific carrier of DNA for methicillin resistance. Furthermore, the lack of superfluous functions may make the element more fit as a mobile genetic element for S. aureus in the community than any other type of SCCmec, for the following reasons. A number of ORFs carried by type I and type II SCCmec elements in their long L-C regions are considered unnecessary for the benefit of the host cells that carry the elements (11, 12). Actually, many of them are mutated or partially deleted and do not seem to be active. Moreover, an ORF for type I SCCmec encoding plasmin-sensitive surface protein may even be hazardous to the host cell because it interferes with the fibrinogen- and fibronectin-binding properties of the host cell (23). Although the type III SCCmec has a short L-C region comparable in size to those of type IV SCCmec elements, the size of the element is extremely large (68 kb) because of the accumulation of multiple genes for resistance to various antibiotics and heavy metals (12). The determinants for resistance to multiple antibiotics carried by the previously studied types of SCCmec elements (type II and type III elements) may be suited for the survival of H-MRSA in the hospital environment, where various antibiotics as well as antiseptics provide selective pressure, but their large sizes and potentially hazardous arrays of exogenous genes may not be suited to MRSA strains in the community, where selective advantage would make strains more inclined to have a higher growth rate and to be better able to colonize humans than to have a multidrug resistance phenotype. From this viewpoint, the type IV SCCmec may be one of the fit SCCmec types that can confer ß-lactam resistance to community strains of S. aureus without greatly compromising their competitiveness among the natural flora of humans. Future analyses of many community-acquired strains will be required to test if this hypothesis holds true.

Nucleotide sequence accession numbers. The subtype a and b type IV SCCmec elements have been deposited in the DDBJ/EMBL/GenBank databases under accession no. AB063172 and AB063173, respectively.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the Core University System Exchange Program under the Japan Society for the Promotion of Science, coordinated by the University of Tokyo Graduate School of Medicine and Mahidol University. The study was also partly supported by a grant for International Health Cooperation Research (grant 11C-4) from the Ministry of Health and Welfare of Japan.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Bacteriology, Juntendo University, 2-1-1 Hongo, Bunkyo-ku, Tokyo, Japan 113-8421. Phone: 81-3-5802-1040. Fax: 81-3-5684-7830. E-mail: hiram{at}med.juntendo.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
  2. 2
  3. Brown, D. F., and P. E. Reynolds. 1980. Intrinsic resistance to beta-lactam antibiotics in Staphylococcus aureus. FEBS Lett. 122:275-278.[CrossRef][Medline]
  4. 3
  5. Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota, 1997-1999. Morb. Mortal. Wkly. Rep. 48:707-710.
  6. 4
  7. Chambers, H. F. 2001. The changing epidemiology of Staphylococcus aureus. Emerg. Infect. Dis. 7:178-182.[Medline]
  8. 5
  9. Embil, J., K. Ramotar, L. Tomance, M. Alfa, J. Conly, S. Cronk, G. Taylor, B. Sutherland, T. Louie, E. Henderson, et al. 1994. Methicillin-resistant Staphylococcus aureus in tertiary care institutions on the Canadian prairies 1990-1992. Infect. Control. Hosp. Epidemiol. 15:646-651.[Medline]
  10. 6
  11. Gross-Schulman, S., D. Dassey, L. Mascola, and C. Anaya. 1998. Community-acquired methicillin-resistant Staphylococcus aureus. JAMA 280:421-422.[Free Full Text]
  12. 7
  13. Hartman, B. J., and A. Tomasz. 1984. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. J. Bacteriol. 158:513-516.[Abstract/Free Full Text]
  14. 8
  15. Herold, B. C., L. C. Immergluck, M. C. Maranan, D. S. Lauderdale, R. E. Gaskin, S. Boyle-Vavra, C. D. Leitch, and R. S. Daum. 1998. Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279:593-598.[Abstract/Free Full Text]
  16. 9
  17. Hiramatsu, K., K. Asada, E. Suzuki, K. Okonogi, and T. Yokota. 1991. Molecular cloning and nucleotide sequence determination of the regulator region of mecA gene in methicillin-resistant Staphylococcus aureus (MRSA). FEBS Lett. 298:133-136.
  18. 10
  19. Hussain, F. M., S. Boyle-Vavra, C. D. Bethel, and R. S. Daum. 2000. Current trends in community-acquired methicillin-resistant Staphylococcus aureus at a tertiary care pediatric facility. Pediatr. Infect. Dis. J. 19:1163-1166.[Medline]
  20. 11
  21. Ito, T., Y. Katayama, and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob. Agents Chemother. 43:1449-1458.[Abstract/Free Full Text]
  22. 12
  23. Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323-1336.[Abstract/Free Full Text]
  24. 13
  25. Jevons, M. P. 1961. "Celbenin"-resistant staphylococci. Br. Med. J. 124:124-125.
  26. 14
  27. Katayama, Y., T. Ito, and K. Hiramatsu. 2000. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 44:1549-1555.[Abstract/Free Full Text]
  28. 15
  29. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I Kobayashi, L. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Lian, T. Ito, M. Kanamori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama, Y. Mizutani-Ui, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K. Sekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shiba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225-1240.[CrossRef][Medline]
  30. 16
  31. Maguire, G. P., A. D. Arthur, P. J. Boustead, B. Dwyer, and B. J. Currie. 1998. Clinical experience and outcomes of community-acquired and nosocomial methicillin-resistant Staphylococcus aureus in a northern Australian hospital. J. Hosp. Infect. 38:273-281.[CrossRef][Medline]
  32. 17
  33. Nakai, K., and P. Horton. 1999. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem. Sci. 24:34-36.[CrossRef][Medline]
  34. 18
  35. Nimmo, G. R., J. Schooneveldt, G. O'Kane, B. McCall, and A. Vickery. 2000. Community acquisition of gentamicin-sensitive methicillin-resistant Staphylococcus aureus in southeast Queensland, Australia. J. Clin. Microbiol. 38:3926-3931.[Abstract/Free Full Text]
  36. 19
  37. Rings Terry, R. F., and S. Lang. 1998. Ethnicity and methicillin-resistant S. aureus in South Auckland. N. Z. Med. J. 24:151.
  38. 20
  39. Stacey, A. R., K. E. Endersby, P. C. Chan, and R. R. Marples. 1998. An outbreak of methicillin-resistant Staphylococcus aureus infection in a rugby football team. Br. J. Sports Med. 32:153-154.[Abstract/Free Full Text]
  40. 21
  41. Suggs, A. H., M. C. Maranan, A. Boyle-Vavra, and R. S. Daum. 1999. Methicillin-resistant and borderline methicillin-resistant asymptomatic Staphylococcus aureus colonization in children without identifiable risk factors. Pediatr. Infect. Dis. J. 18:410-414.[CrossRef][Medline]
  42. 22
  43. Utsui, Y., and T. Yokota. 1985. Role of an altered penicillin-binding protein in methicillin- and cephem-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 28:397-403.[Abstract/Free Full Text]
  44. 23
  45. Vaudaux, P. E., V. Monzillo, P. Francois, D. P. Lew, T. J. Foster, and B. Berger-Bachi. 1998. Introduction of the mec element (methicillin resistance) into Staphylococcus aureus alters in vitro functional activities of fibrinogen and fibronectin adhesins. Antimicrob. Agents Chemother. 42:564-570.[Abstract/Free Full Text]


Antimicrobial Agents and Chemotherapy, April 2002, p. 1147-1152, Vol. 46, No. 4
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.4.1147-1152.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • International Working Group on the Classification, (2009). Classification of Staphylococcal Cassette Chromosome mec (SCCmec): Guidelines for Reporting Novel SCCmec Elements. Antimicrob. Agents Chemother. 53: 4961-4967 [Full Text]  
  • Crawford, S. E., David, M. Z., Glikman, D., King, K. J., Boyle-Vavra, S., Daum, R. S. (2009). Clinical Importance of Purulence in Methicillin-Resistant Staphylococcus aureus Skin and Soft Tissue Infections. J Am Board Fam Med 22: 647-654 [Abstract] [Full Text]  
  • Chen, L., Mediavilla, J. R., Oliveira, D. C., Willey, B. M., de Lencastre, H., Kreiswirth, B. N. (2009). Multiplex Real-Time PCR for Rapid Staphylococcal Cassette Chromosome mec Typing. J. Clin. Microbiol. 47: 3692-3706 [Abstract] [Full Text]  
  • Higgins, P. G., Rosato, A. E., Seifert, H., Archer, G. L., Wisplinghoff, H. (2009). Differential Expression of ccrA in Methicillin-Resistant Staphylococcus aureus Strains Carrying Staphylococcal Cassette Chromosome mec Type II and IVa Elements. Antimicrob. Agents Chemother. 53: 4556-4558 [Abstract] [Full Text]  
  • Wang, J.-T., Liao, C.-H., Fang, C.-T., Chie, W.-C., Lai, M.-S., Lauderdale, T.-L., Lee, W.-S., Huang, J.-H., Chang, S.-C. (2009). Prevalence of and Risk Factors for Colonization by Methicillin-Resistant Staphylococcus aureus among Adults in Community Settings in Taiwan. J. Clin. Microbiol. 47: 2957-2963 [Abstract] [Full Text]  
  • Ahmad, N., Ruzan, I. N., Abd Ghani, M. K., Hussin, A., Nawi, S., Aziz, M. N., Maning, N., Eow, V. L. K. (2009). Characteristics of community- and hospital-acquired meticillin-resistant Staphylococcus aureus strains carrying SCCmec type IV isolated in Malaysia. J Med Microbiol 58: 1213-1218 [Abstract] [Full Text]  
  • Cai, L., Kong, F., Wang, Q., Wang, H., Xiao, M., Sintchenko, V., Gilbert, G. L. (2009). A new multiplex PCR-based reverse line-blot hybridization (mPCR/RLB) assay for rapid staphylococcal cassette chromosome mec (SCCmec) typing. J Med Microbiol 58: 1045-1057 [Abstract] [Full Text]  
  • Argudin, M. A., Mendoza, M. C., Mendez, F. J., Martin, M. C., Guerra, B., Rodicio, M. R. (2009). Clonal Complexes and Diversity of Exotoxin Gene Profiles in Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates from Patients in a Spanish Hospital. J. Clin. Microbiol. 47: 2097-2105 [Abstract] [Full Text]  
  • Ruppe, E., Barbier, F., Mesli, Y., Maiga, A., Cojocaru, R., Benkhalfat, M., Benchouk, S., Hassaine, H., Maiga, I., Diallo, A., Koumare, A. K., Ouattara, K., Soumare, S., Dufourcq, J.-B., Nareth, C., Sarthou, J.-L., Andremont, A., Ruimy, R. (2009). Diversity of Staphylococcal Cassette Chromosome mec Structures in Methicillin-Resistant Staphylococcus epidermidis and Staphylococcus haemolyticus Strains among Outpatients from Four Countries. Antimicrob. Agents Chemother. 53: 442-449 [Abstract] [Full Text]  
  • Zhang, K., McClure, J.-A., Elsayed, S., Conly, J. M. (2009). Novel Staphylococcal Cassette Chromosome mec Type, Tentatively Designated Type VIII, Harboring Class A mec and Type 4 ccr Gene Complexes in a Canadian Epidemic Strain of Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 53: 531-540 [Abstract] [Full Text]  
  • Ibrahem, S., Salmenlinna, S., Virolainen, A., Kerttula, A.-M., Lyytikainen, O., Jagerroos, H., Broas, M., Vuopio-Varkila, J. (2009). Carriage of Methicillin-Resistant Staphylococci and Their SCCmec Types in a Long-Term-Care Facility. J. Clin. Microbiol. 47: 32-37 [Abstract] [Full Text]  
  • Berglund, C., Ito, T., Ma, X. X., Ikeda, M., Watanabe, S., Soderquist, B., Hiramatsu, K. (2009). Genetic diversity of methicillin-resistant Staphylococcus aureus carrying type IV SCCmec in Orebro County and the western region of Sweden. J Antimicrob Chemother 63: 32-41 [Abstract] [Full Text]  
  • Shore, A. C., Rossney, A. S., O'Connell, B., Herra, C. M., Sullivan, D. J., Humphreys, H., Coleman, D. C. (2008). Detection of Staphylococcal Cassette Chromosome mec-Associated DNA Segments in Multiresistant Methicillin-Susceptible Staphylococcus aureus (MSSA) and Identification of Staphylococcus epidermidis ccrAB4 in both Methicillin-Resistant S. aureus and MSSA. Antimicrob. Agents Chemother. 52: 4407-4419 [Abstract] [Full Text]  
  • Jamaluddin, T. Z. M. T., Kuwahara-Arai, K., Hisata, K., Terasawa, M., Cui, L., Baba, T., Sotozono, C., Kinoshita, S., Ito, T., Hiramatsu, K. (2008). Extreme Genetic Diversity of Methicillin-Resistant Staphylococcus epidermidis Strains Disseminated among Healthy Japanese Children. J. Clin. Microbiol. 46: 3778-3783 [Abstract] [Full Text]  
  • Dauwalder, O., Lina, G., Durand, G., Bes, M., Meugnier, H., Jarlier, V., Coignard, B., Vandenesch, F., Etienne, J., Laurent, F. (2008). Epidemiology of Invasive Methicillin-Resistant Staphylococcus aureus Clones Collected in France in 2006 and 2007. J. Clin. Microbiol. 46: 3454-3458 [Abstract] [Full Text]  
  • Ma, X. X., Ito, T., Kondo, Y., Cho, M., Yoshizawa, Y., Kaneko, J., Katai, A., Higashiide, M., Li, S., Hiramatsu, K. (2008). Two Different Panton-Valentine Leukocidin Phage Lineages Predominate in Japan. J. Clin. Microbiol. 46: 3246-3258 [Abstract] [Full Text]  
  • Berglund, C., Ito, T., Ikeda, M., Ma, X. X., Soderquist, B., Hiramatsu, K. (2008). Novel Type of Staphylococcal Cassette Chromosome mec in a Methicillin-Resistant Staphylococcus aureus Strain Isolated in Sweden. Antimicrob. Agents Chemother. 52: 3512-3516 [Abstract] [Full Text]  
  • Luczak-Kadlubowska, A., Sulikowska, A., Empel, J., Piasecka, A., Orczykowska, M., Kozinska, A., Hryniewicz, W. (2008). Countrywide Molecular Survey of Methicillin-Resistant Staphylococcus aureus Strains in Poland. J. Clin. Microbiol. 46: 2930-2937 [Abstract] [Full Text]  
  • Kishii, K., Ito, T., Watanabe, S., Okuzumi, K., Hiramatsu, K. (2008). Recurrence of heterogeneous methicillin-resistant Staphylococcus aureus (MRSA) among the MRSA clinical isolates in a Japanese university hospital. J Antimicrob Chemother 62: 324-328 [Abstract] [Full Text]  
  • Fritz, S. A., Garbutt, J., Elward, A., Shannon, W., Storch, G. A. (2008). Prevalence of and Risk Factors for Community-Acquired Methicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Colonization in Children Seen in a Practice-Based Research Network. Pediatrics 121: 1090-1098 [Abstract] [Full Text]  
  • Noto, M. J., Fox, P. M., Archer, G. L. (2008). Spontaneous Deletion of the Methicillin Resistance Determinant, mecA, Partially Compensates for the Fitness Cost Associated with High-Level Vancomycin Resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 52: 1221-1229 [Abstract] [Full Text]  
  • Noto, M. J., Kreiswirth, B. N., Monk, A. B., Archer, G. L. (2008). Gene Acquisition at the Insertion Site for SCCmec, the Genomic Island Conferring Methicillin Resistance in Staphylococcus aureus. J. Bacteriol. 190: 1276-1283 [Abstract] [Full Text]  
  • Baba, T., Bae, T., Schneewind, O., Takeuchi, F., Hiramatsu, K. (2008). Genome Sequence of Staphylococcus aureus Strain Newman and Comparative Analysis of Staphylococcal Genomes: Polymorphism and Evolution of Two Major Pathogenicity Islands. J. Bacteriol. 190: 300-310 [Abstract] [Full Text]  
  • Klevens, R. M., Morrison, M. A., Nadle, J., Petit, S., Gershman, K., Ray, S., Harrison, L. H., Lynfield, R., Dumyati, G., Townes, J. M., Craig, A. S., Zell, E. R., Fosheim, G. E., McDougal, L. K., Carey, R. B., Fridkin, S. K., for the Active Bacterial Core surveillance (ABCs), (2007). Invasive Methicillin-Resistant Staphylococcus aureus Infections in the United States. JAMA 298: 1763-1771 [Abstract] [Full Text]  
  • Mombach Pinheiro Machado, A. B., Reiter, K. C., Paiva, R. M., Barth, A. L. (2007). Distribution of staphylococcal cassette chromosome mec (SCCmec) types I, II, III and IV in coagulase-negative staphylococci from patients attending a tertiary hospital in southern Brazil. J Med Microbiol 56: 1328-1333 [Abstract] [Full Text]  
  • Milheirico, C., Oliveira, D. C., de Lencastre, H. (2007). Update to the Multiplex PCR Strategy for Assignment of mec Element Types in Staphylococcus aureus. Antimicrob. Agents Chemother. 51: 3374-3377 [Abstract] [Full Text]  
  • Stephens, A. J., Huygens, F., Giffard, P. M. (2007). Systematic Derivation of Marker Sets for Staphylococcal Cassette Chromosome mec Typing. Antimicrob. Agents Chemother. 51: 2954-2964 [Abstract] [Full Text]  
  • Brady, J. M., Stemper, M. E., Weigel, A., Chyou, P.-H., Reed, K. D., Shukla, S. K. (2007). Sporadic "Transitional" Community-Associated Methicillin-Resistant Staphylococcus aureus Strains from Health Care Facilities in the United States. J. Clin. Microbiol. 45: 2654-2661 [Abstract] [Full Text]  
  • Rossney, A. S., Shore, A. C., Morgan, P. M., Fitzgibbon, M. M., O'Connell, B., Coleman, D. C. (2007). The Emergence and Importation of Diverse Genotypes of Methicillin-Resistant Staphylococcus aureus (MRSA) Harboring the Panton-Valentine Leukocidin Gene (pvl) Reveal that pvl Is a Poor Marker for Community-Acquired MRSA Strains in Ireland. J. Clin. Microbiol. 45: 2554-2563 [Abstract] [Full Text]  
  • Milheirico, C., Oliveira, D. C., de Lencastre, H. (2007). Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. J Antimicrob Chemother 60: 42-48 [Abstract] [Full Text]  
  • Hanssen, A.-M., Sollid, J. U. E. (2007). Multiple Staphylococcal Cassette Chromosomes and Allelic Variants of Cassette Chromosome Recombinases in Staphylococcus aureus and Coagulase-Negative Staphylococci from Norway. Antimicrob. Agents Chemother. 51: 1671-1677 [Abstract] [Full Text]  
  • Sasaki, T., Kikuchi, K., Tanaka, Y., Takahashi, N., Kamata, S., Hiramatsu, K. (2007). Methicillin-Resistant Staphylococcus pseudintermedius in a Veterinary Teaching Hospital. J. Clin. Microbiol. 45: 1118-1125 [Abstract] [Full Text]  
  • Moroney, S. M., Heller, L. C., Arbuckle, J., Talavera, M., Widen, R. H. (2007). Staphylococcal Cassette Chromosome mec and Panton-Valentine Leukocidin Characterization of Methicillin-Resistant Staphylococcus aureus Clones. J. Clin. Microbiol. 45: 1019-1021 [Abstract] [Full Text]  
  • Ghebremedhin, B., Konig, W., Witte, W., Hardy, K. J., Hawkey, P. M., Konig, B. (2007). Subtyping of ST22-MRSA-IV (Barnim epidemic MRSA strain) at a university clinic in Germany from 2002 to 2005. J Med Microbiol 56: 365-375 [Abstract] [Full Text]  
  • Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., Hiramatsu, K. (2007). Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions. Antimicrob. Agents Chemother. 51: 264-274 [Abstract] [Full Text]  
  • Heusser, R., Ender, M., Berger-Bachi, B., McCallum, N. (2007). Mosaic Staphylococcal Cassette Chromosome mec Containing Two Recombinase Loci and a New mec Complex, B2. Antimicrob. Agents Chemother. 51: 390-393 [Abstract] [Full Text]  
  • Ma, X. X., Ito, T., Chongtrakool, P., Hiramatsu, K. (2006). Predominance of Clones Carrying Panton-Valentine Leukocidin Genes among Methicillin-Resistant Staphylococcus aureus Strains Isolated in Japanese Hospitals from 1979 to 1985. J. Clin. Microbiol. 44: 4515-4527 [Abstract] [Full Text]  
  • Oliveira, D. C., Milheirico, C., de Lencastre, H. (2006). Redefining a Structural Variant of Staphylococcal Cassette Chromosome mec, SCCmec Type VI. Antimicrob. Agents Chemother. 50: 3457-3459 [Abstract] [Full Text]  
  • Noto, M. J., Archer, G. L. (2006). A Subset of Staphylococcus aureus Strains Harboring Staphylococcal Cassette Chromosome mec (SCCmec) Type IV Is Deficient in CcrAB-Mediated SCCmec Excision. Antimicrob. Agents Chemother. 50: 2782-2788 [Abstract] [Full Text]  
  • Malik, S., Coombs, G. W., O'Brien, F. G., Peng, H., Barton, M. D. (2006). Molecular typing of methicillin-resistant staphylococci isolated from cats and dogs. J Antimicrob Chemother 58: 428-431 [Abstract] [Full Text]  
  • Patel, M., Waites, K. B., Moser, S. A., Cloud, G. A., Hoesley, C. J. (2006). Prevalence of Inducible Clindamycin Resistance among Community- and Hospital-Associated Staphylococcus aureus Isolates. J. Clin. Microbiol. 44: 2481-2484 [Abstract] [Full Text]  
  • Oliveira, D. C., Milheirico, C., Vinga, S., de Lencastre, H. (2006). Assessment of allelic variation in the ccrAB locus in methicillin-resistant Staphylococcus aureus clones. J Antimicrob Chemother 58: 23-30 [Abstract] [Full Text]  
  • Jansen, W. T. M., Beitsma, M. M., Koeman, C. J., van Wamel, W. J. B., Verhoef, J., Fluit, A. C. (2006). Novel Mobile Variants of Staphylococcal Cassette Chromosome mec in Staphylococcus aureus. Antimicrob. Agents Chemother. 50: 2072-2078 [Abstract] [Full Text]  
  • Sabol, K. E, Echevarria, K. L, Lewis, J. S II (2006). Community-Associated Methicillin-Resistant Staphylococcus aureus: New Bug, Old Drugs. The Annals of Pharmacotherapy 40: 1125-1133 [Abstract] [Full Text]  
  • Graham, P. L. III, Lin, S. X., Larson, E. L. (2006). A U.S. population-based survey of Staphylococcus aureus colonization.. ANN INTERN MED 144: 318-325 [Abstract] [Full Text]  
  • Chongtrakool, P., Ito, T., Ma, X. X., Kondo, Y., Trakulsomboon, S., Tiensasitorn, C., Jamklang, M., Chavalit, T., Song, J.-H., Hiramatsu, K. (2006). Staphylococcal Cassette Chromosome mec (SCCmec) Typing of Methicillin-Resistant Staphylococcus aureus Strains Isolated in 11 Asian Countries: a Proposal for a New Nomenclature for SCCmec Elements. Antimicrob. Agents Chemother. 50: 1001-1012 [Abstract] [Full Text]  
  • Jones, C. H., Tuckman, M., Howe, A. Y. M., Orlowski, M., Mullen, S., Chan, K., Bradford, P. A. (2006). Diagnostic PCR Analysis of the Occurrence of Methicillin and Tetracycline Resistance Genes among Staphylococcus aureus Isolates from Phase 3 Clinical Trials of Tigecycline for Complicated Skin and Skin Structure Infections. Antimicrob. Agents Chemother. 50: 505-510 [Abstract] [Full Text]  
  • Yang, J. A., Park, D. W., Sohn, J. W., Kim, M. J. (2006). Novel PCR-Restriction Fragment Length Polymorphism Analysis for Rapid Typing of Staphylococcal Cassette Chromosome mec Elements. J. Clin. Microbiol. 44: 236-238 [Abstract] [Full Text]  
  • van der Zee, A., Heck, M., Sterks, M., Harpal, A., Spalburg, E., Kazobagora, L., Wannet, W. (2005). Recognition of SCCmec Types According to Typing Pattern Determined by Multienzyme Multiplex PCR-Amplified Fragment Length Polymorphism Analysis of Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol. 43: 6042-6047 [Abstract] [Full Text]  
  • Rihn, J. A., Michaels, M. G., Harner, C. D. (2005). Community-Acquired Methicillin-Resistant Staphylococcus aureus: An Emerging Problem in the Athletic Population. Am J Sports Med 33: 1924-1929 [Abstract] [Full Text]  
  • Roesch, A., Linde, H.-J., Landthaler, M., Vogt, T. (2005). Elimination of a Community-Acquired Methicillin-Resistant Staphylococcus aureus Infection in a Nurse With Atopic Dermatitis. Arch Dermatol 141: 1520-1522 [Full Text]  
  • McAleese, F., Murphy, E., Babinchak, T., Singh, G., Said-Salim, B., Kreiswirth, B., Dunman, P., O'Connell, J., Projan, S. J., Bradford, P. A. (2005). Use of Ribotyping To Retrospectively Identify Methicillin-Resistant Staphylococcus aureus Isolates from Phase 3 Clinical Trials for Tigecycline That Are Genotypically Related to Community-Associated Isolates. Antimicrob. Agents Chemother. 49: 4521-4529 [Abstract] [Full Text]  
  • Zhang, K., McClure, J.-A., Elsayed, S., Louie, T., Conly, J. M. (2005). Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol. 43: 5026-5033 [Abstract] [Full Text]  
  • de Sousa, M. A., Conceicao, T., Simas, C., de Lencastre, H. (2005). Comparison of Genetic Backgrounds of Methicillin-Resistant and -Susceptible Staphylococcus aureus Isolates from Portuguese Hospitals and the Community. J. Clin. Microbiol. 43: 5150-5157 [Abstract] [Full Text]  
  • Qi, W., Ender, M., O'Brien, F., Imhof, A., Ruef, C., McCallum, N., Berger-Bachi, B. (2005). Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus in Zurich, Switzerland (2003): Prevalence of Type IV SCCmec and a New SCCmec Element Associated with Isolates from Intravenous Drug Users. J. Clin. Microbiol. 43: 5164-5170 [Abstract] [Full Text]  
  • Kwon, N. H., Park, K. T., Moon, J. S., Jung, W. K., Kim, S. H., Kim, J. M., Hong, S. K., Koo, H. C., Joo, Y. S., Park, Y. H. (2005). Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea. J Antimicrob Chemother 56: 624-632 [Abstract] [Full Text]  
  • Berglund, C., Molling, P., Sjoberg, L., Soderquist, B. (2005). Multilocus Sequence Typing of Methicillin-Resistant Staphylococcus aureus from an Area of Low Endemicity by Real-Time PCR. J. Clin. Microbiol. 43: 4448-4454 [Abstract] [Full Text]  
  • Boyle-Vavra, S., Ereshefsky, B., Wang, C.-C., Daum, R. S. (2005). Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV. J. Clin. Microbiol. 43: 4719-4730 [Abstract] [Full Text]  
  • Kowalski, T. J., Berbari, E. F., Osmon, D. R. (2005). Epidemiology, Treatment, and Prevention of Community-Acquired Methicillin-Resistant Staphylococcus aureus Infections. Mayo Clin Proc. 80: 1201-1208 [Abstract]  
  • Donnio, P.-Y., Oliveira, D. C., Faria, N. A., Wilhelm, N., Le Coustumier, A., de Lencastre, H. (2005). Partial Excision of the Chromosomal Cassette Containing the Methicillin Resistance Determinant Results in Methicillin-Susceptible Staphylococcus aureus. J. Clin. Microbiol. 43: 4191-4193 [Abstract] [Full Text]  
  • Hisata, K., Kuwahara-Arai, K., Yamanoto, M., Ito, T., Nakatomi, Y., Cui, L., Baba, T., Terasawa, M., Sotozono, C., Kinoshita, S., Yamashiro, Y., Hiramatsu, K. (2005). Dissemination of Methicillin-Resistant Staphylococci among Healthy Japanese Children. J. Clin. Microbiol. 43: 3364-3372 [Abstract] [Full Text]  
  • Trindade, P. d. A., Pacheco, R. L., Costa, S. F., Rossi, F., Barone, A. A., Mamizuka, E. M., Levin, A. S. (2005). Prevalence of SCCmec Type IV in Nosocomial Bloodstream Isolates of Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol. 43: 3435-3437 [Abstract] [Full Text]  
  • O'Brien, F. G., Lim, T. T., Winnett, D. C., Coombs, G. W., Pearson, J. C., Delgado, A., Langevin, M. J., Cantore, S. A., Gonzalez, L., Gustafson, J. E. (2005). Survey of Methicillin-Resistant Staphylococcus aureus Strains from Two Hospitals in El Paso, Texas. J. Clin. Microbiol. 43: 2969-2972 [Abstract] [Full Text]  
  • Giannoudis, P. V., Parker, J., Wilcox, M. H. (2005). Methicillin-resistant Staphylococcus aureus in trauma and orthopaedic practice. J Bone Joint Surg Br 87-B: 749-754 [Full Text]  
  • Shore, A., Rossney, A. S., Keane, C. T., Enright, M. C., Coleman, D. C. (2005). Seven Novel Variants of the Staphylococcal Chromosomal Cassette mec in Methicillin-Resistant Staphylococcus aureus Isolates from Ireland. Antimicrob. Agents Chemother. 49: 2070-2083 [Abstract] [Full Text]  
  • Weese, J. S. (2005). Methicillin-Resistant Staphylococcus aureus: An Emerging Pathogen in Small Animals. Journal of the American Animal Hospital Association 41: 150-157 [Abstract] [Full Text]  
  • Shukla, S. K. (2005). Community-Associated Methicillin-Resistant Staphylococcus aureus and Its Emerging Virulence. Clin Med Res 3: 57-60 [Full Text]  
  • Miller, L. G., Perdreau-Remington, F., Rieg, G., Mehdi, S., Perlroth, J., Bayer, A. S., Tang, A. W., Phung, T. O., Spellberg, B. (2005). Necrotizing Fasciitis Caused by Community-Associated Methicillin-Resistant Staphylococcus aureus in Los Angeles. NEJM 352: 1445-1453 [Abstract] [Full Text]  
  • Juuti, K., Ibrahem, S., Virolainen-Julkunen, A., Vuopio-Varkila, J., Kuusela, P. (2005). The pls Gene Found in Methicillin-Resistant Staphylococcus aureus Strains Is Common in Clinical Isolates of Staphylococcus sciuri. J. Clin. Microbiol. 43: 1415-1419 [Abstract] [Full Text]  
  • (2005). Guidelines for the Management of Adults with Hospital-acquired, Ventilator-associated, and Healthcare-associated Pneumonia. Am. J. Respir. Crit. Care Med. 171: 388-416 [Full Text]  
  • Gomes, A. R., Vinga, S., Zavolan, M., de Lencastre, H. (2005). Analysis of the Genetic Variability of Virulence-Related Loci in Epidemic Clones of Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 49: 366-379 [Abstract] [Full Text]  
  • Lu, P.-L., Chin, L.-C., Peng, C.-F., Chiang, Y.-H., Chen, T.-P., Ma, L., Siu, L. K (2005). Risk Factors and Molecular Analysis of Community Methicillin-Resistant Staphylococcus aureus Carriage. J. Clin. Microbiol. 43: 132-139 [Abstract] [Full Text]  
  • Ko, K. S., Lee, J.-Y., Suh, J. Y., Oh, W. S., Peck, K. R., Lee, N. Y., Song, J.-H. (2005). Distribution of Major Genotypes among Methicillin-Resistant Staphylococcus aureus Clones in Asian Countries. J. Clin. Microbiol. 43: 421-426 [Abstract] [Full Text]  
  • Perez-Roth, E., Lorenzo-Diaz, F., Batista, N., Moreno, A., Mendez-Alvarez, S. (2004). Tracking Methicillin-Resistant Staphylococcus aureus Clones during a 5-Year Period (1998 to 2002) in a Spanish Hospital. J. Clin. Microbiol. 42: 4649-4656 [Abstract] [Full Text]  
  • Ito, T., Ma, X. X., Takeuchi, F., Okuma, K., Yuzawa, H., Hiramatsu, K. (2004). Novel Type V Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome Recombinase, ccrC. Antimicrob. Agents Chemother. 48: 2637-2651 [Abstract] [Full Text]  
  • Wannet, W. J. B., Spalburg, E., Heck, M. E. O. C., Pluister, G. N., Willems, R. J. L., de Neeling, A. J. (2004). Widespread Dissemination in The Netherlands of the Epidemic Berlin Methicillin-Resistant Staphylococcus aureus Clone with Low-Level Resistance to Oxacillin. J. Clin. Microbiol. 42: 3077-3082 [Abstract] [Full Text]  
  • O'Brien, F. G., Lim, T. T., Chong, F. N., Coombs, G. W., Enright, M. C., Robinson, D. A., Monk, A., Said-Salim, B., Kreiswirth, B. N., Grubb, W. B. (2004). Diversity among Community Isolates of Methicillin-Resistant Staphylococcus aureus in Australia. J. Clin. Microbiol. 42: 3185-3190 [Abstract] [Full Text]  
  • Francois, P., Renzi, G., Pittet, D., Bento, M., Lew, D., Harbarth, S., Vaudaux, P., Schrenzel, J. (2004). A Novel Multiplex Real-Time PCR Assay for Rapid Typing of Major Staphylococcal Cassette Chromosome mec Elements. J. Clin. Microbiol. 42: 3309-3312 [Abstract] [Full Text]  
  • Holden, M. T. G., Feil, E. J., Lindsay, J. A., Peacock, S. J., Day, N. P. J., Enright, M. C., Foster, T. J., Moore, C. E., Hurst, L., Atkin, R., Barron, A., Bason, N., Bentley, S. D., Chillingworth, C., Chillingworth, T., Churcher, C., Clark, L., Corton, C., Cronin, A., Doggett, J., Dowd, L., Feltwell, T., Hance, Z., Harris, B., Hauser, H., Holroyd, S., Jagels, K., James, K. D., Lennard, N., Line, A., Mayes, R., Moule, S., Mungall, K., Ormond, D., Quail, M. A., Rabbinowitsch, E., Rutherford, K., Sanders, M., Sharp, S., Simmonds, M., Stevens, K., Whitehead, S., Barrell, B. G., Spratt, B. G., Parkhill, J. (2004). Complete genomes of two clinical Staphylococcus aureus strains: Evidence for the rapid evolution of virulence and drug resistance. Proc. Natl. Acad. Sci. USA 101: 9786-9791 [Abstract] [Full Text]  
  • Mongkolrattanothai, K., Boyle, S., Murphy, T. V., Daum, R. S. (2004). Novel Non-mecA-Containing Staphylococcal Chromosomal Cassette Composite Island Containing pbp4 and tagF Genes in a Commensal Staphylococcal Species: a Possible Reservoir for Antibiotic Resistance Islands in Staphylococcus aureus. Antimicrob. Agents Chemother. 48: 1823-1836 [Abstract] [Full Text]  
  • Huletsky, A., Giroux, R., Rossbach, V., Gagnon, M., Vaillancourt, M., Bernier, M., Gagnon, F., Truchon, K., Bastien, M., Picard, F. J., van Belkum, A., Ouellette, M., Roy, P. H., Bergeron, M. G. (2004). New Real-Time PCR Assay for Rapid Detection of Methicillin- Resistant Staphylococcus aureus Directly from Specimens Containing a Mixture of Staphylococci. J. Clin. Microbiol. 42: 1875-1884 [Abstract] [Full Text]  
  • Huygens, F., Stephens, A. J., Nimmo, G. R., Giffard, P. M. (2004). mecA Locus Diversity in Methicillin-Resistant Staphylococcus aureus Isolates in Brisbane, Australia, and the Development of a Novel Diagnostic Procedure for the Western Samoan Phage Pattern Clone. J. Clin. Microbiol. 42: 1947-1955 [Abstract] [Full Text]  
  • Diep, B. A., Sensabaugh, G. F., Somboona, N. S., Carleton, H. A., Perdreau-Remington, F. (2004). Widespread Skin and Soft-Tissue Infections Due to Two Methicillin-Resistant Staphylococcus aureus Strains Harboring the Genes for Panton-Valentine Leucocidin. J. Clin. Microbiol. 42: 2080-2084 [Abstract] [Full Text]  
  • Dominguez, T. J. (2004). It's Not a Spider Bite, It's Community-Acquired Methicillin-Resistant Staphylococcus aureus. J Am Board Fam Med 17: 220-226 [Full Text]  
  • Donnio, P.-Y., Preney, L., Gautier-Lerestif, A.-L., Avril, J.-L., Lafforgue, N. (2004). Changes in staphylococcal cassette chromosome type and antibiotic resistance profile in methicillin-resistant Staphylococcus aureus isolates from a French hospital over an 11 year period. J Antimicrob Chemother 53: 808-813 [Abstract] [Full Text]  
  • Hanssen, A.-M., Kjeldsen, G., Sollid, J. U. E. (2004). Local Variants of Staphylococcal Cassette Chromosome mec in Sporadic Methicillin-Resistant Staphylococcus aureus and Methicillin-Resistant Coagulase-Negative Staphylococci: Evidence of Horizontal Gene Transfer?. Antimicrob. Agents Chemother. 48: 285-296 [Abstract] [Full Text]  
  • Robinson, D. A., Enright, M. C. (2003). Evolutionary Models of the Emergence of Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47: 3926-3934 [Abstract] [Full Text]  
  • Wisplinghoff, H., Rosato, A. E., Enright, M. C., Noto, M., Craig, W., Archer, G. L. (2003). Related Clones Containing SCCmec Type IV Predominate among Clinically Significant Staphylococcus epidermidis Isolates. Antimicrob. Agents Chemother. 47: 3574-3579 [Abstract] [Full Text]  
  • Ip, M., Lyon, D. J., Chio, F., Enright, M. C., Cheng, A. F. (2003). Characterization of Isolates of Methicillin-Resistant Staphylococcus aureus from Hong Kong by Phage Typing, Pulsed-Field Gel Electrophoresis, and Fluorescent Amplified-Fragment Length Polymorphism Analysis. J. Clin. Microbiol. 41: 4980-4985 [Abstract] [Full Text]  
  • McDougal, L. K., Steward, C. D., Killgore, G. E., Chaitram, J. M., McAllister, S. K., Tenover, F. C. (2003). Pulsed-Field Gel Electrophoresis Typing of Oxacillin-Resistant Staphylococcus aureus Isolates from the United States: Establishing a National Database. J. Clin. Microbiol. 41: 5113-5120 [Abstract] [Full Text]  
  • Aires de Sousa, M., de Lencastre, H. (2003). Evolution of Sporadic Isolates of Methicillin-Resistant Staphylococcus aureus (MRSA) in Hospitals and Their Similarities to Isolates of Community-Acquired MRSA. J. Clin. Microbiol. 41: 3806-3815 [Abstract] [Full Text]  
  • Branger, C., Gardye, C., Galdbart, J.-O., Deschamps, C., Lambert, N. (2003). Genetic Relationship between Methicillin-Sensitive and Methicillin-Resistant Staphylococcus aureus Strains from France and from International Sources: Delineation of Genomic Groups. J. Clin. Microbiol. 41: 2946-2951 [Abstract] [Full Text]  
  • Katayama, Y., Takeuchi, F., Ito, T., Ma, X. X., Ui-Mizutani, Y., Kobayashi, I., Hiramatsu, K. (2003). Identification in Methicillin-Susceptible Staphylococcus hominis of an Active Primordial Mobile Genetic Element for the Staphylococcal Cassette Chromosome mec of Methicillin-Resistant Staphylococcus aureus. J. Bacteriol. 185: 2711-2722 [Abstract] [Full Text]  
  • Rohrer, S., Berger-Bachi, B. (2003). FemABX Peptidyl Transferases: a Link between Branched-Chain Cell Wall Peptide Formation and {beta}-Lactam Resistance in Gram-Positive Cocci. Antimicrob. Agents Chemother. 47: 837-846 [Full Text]  
  • Zhao, X., Eisner, W., Perl-Rosenthal, N., Kreiswirth, B., Drlica, K. (2003). Mutant Prevention Concentration of Garenoxacin (BMS-284756) for Ciprofloxacin-Susceptible or -Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47: 1023-1027 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, X. X.
Right arrow Articles by Hiramatsu, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, X. X.
Right arrow Articles by Hiramatsu, K.