AAC
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jia, N.
Right arrow Articles by Bard, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jia, N.
Right arrow Articles by Bard, M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, April 2002, p. 947-957, Vol. 46, No. 4
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.4.947-957.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Candida albicans Sterol C-14 Reductase, Encoded by the ERG24 Gene, as a Potential Antifungal Target Site

N. Jia,1 B. Arthington-Skaggs,2 W. Lee,2 C. A. Pierson,1 N. D. Lees,1* J. Eckstein,3 R. Barbuch,3 and M. Bard1

Department of Biology, Indiana University Purdue University Indianapolis, Indianapolis, Indiana 46202-5132,1 Mycotic Diseases Branch, Centers for Disease Control and Prevention, Atlanta, Georgia 30333 ,2 Department of Drug Disposition, Eli Lilly & Co., Lilly Corporate Center, Indianapolis, Indiana 462853

Received 7 September 2001/ Returned for modification 16 November 2001/ Accepted 24 December 2001


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The incidence of fungal infections has increased dramatically, which has necessitated additional and prolonged use of the available antifungal agents. Increased resistance to the commonly used antifungal agents, primarily the azoles, has been reported, thus necessitating the discovery and development of compounds that would be effective against the major human fungal pathogens. The sterol biosynthetic pathway has proved to be a fertile area for antifungal development, and steps which might provide good targets for novel antifungal development remain. The sterol C-14 reductase, encoded by the ERG24 gene, could be an effective target for drug development since the morpholine antifungals, inhibitors of Erg24p, have been successful in agricultural applications. The ERG24 gene of Candida albicans has been isolated by complementation of a Saccharomyces cerevisiae erg24 mutant. Both copies of the C. albicans ERG24 gene have been disrupted by using short homologous regions of the ERG24 gene flanking a selectable marker. Unlike S. cerevisiae, the C. albicans ERG24 gene was not required for growth, but erg24 mutants showed several altered phenotypes. They were demonstrated to be slowly growing, with doubling times at least twice that of the wild type. They were also shown to be significantly more sensitive to an allylamine antifungal and to selected cellular inhibitors including cycloheximide, cerulenin, fluphenazine, and brefeldin A. The erg24 mutants were also slightly resistant to the azoles. Most importantly, erg24 mutants were shown to be significantly less pathogenic in a mouse model system and failed to produce germ tubes upon incubation in human serum. On the basis of these characteristics, inhibitors of Erg24p would be effective against C. albicans.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Over the past decade a number of factors have contributed to the growing incidence of fungal infections. Advanced, invasive surgical techniques and induced immunosuppression resulting from transplantation protocols and chemotherapies, coupled with disease conditions associated with human immunodeficiency virus infection, have all played major roles (13). This increase in infection rates has necessitated additional and prolonged treatments with the available arsenal of antifungal drugs. This, in turn, has led to the emergence of drug-resistant strains of pathogenic fungi.

The two most commonly used classes of antifungal drugs are the polyenes and the azoles. The former act by binding to ergosterol, the fungal membrane sterol, which induces the formation of channels through which essential cellular components leak out, thereby causing cell death (7). The polyenes are restricted in their application due to their limited solubilities and toxic side effects (27). The azoles are fungistatic compounds which are effective by virtue of their ability to inhibit the C-14 lanosterol demethylase in the ergosterol biosynthetic pathway. Inhibition of this enzyme by azoles results in the accumulation of C-14 methyl sterols, which do not permit normal membrane function (31).

The growing problem with resistance to the azole class of antifungal agents, the drugs most commonly used to treat human infections, has been noted in a variety of pathogenic fungi including Candida albicans, a common human pathogen (6). Resistance has been the result of several types of mutations which lead to altered forms of the demethylase that have reduced affinities for azoles (19, 36) and overexpression of the demethylase gene (ERG11) (35) as well as genes for drug efflux pumps (9, 28). The threat of the loss of efficacy of the azoles has prompted concerted efforts to discover new drugs that might block fungal growth at different metabolic sites (33). Additional steps in ergosterol biosynthesis may be effective targets to be explored in this search.

The reaction catalyzed by the sterol C-14 reductase may be a good target for an antifungal suitable for use by humans. This enzyme, encoded by the ERG24 gene, is inhibited by the morpholine class of antifungals, which has proved effective against fungal pathogens of plants (2). A second enzyme in the pathway, the C-8 sterol isomerase, encoded by the ERG2 gene, is also subject to inhibition by the morpholines. The ERG24 gene of Saccharomyces cerevisiae has been cloned and characterized (21-23) and has been found to be essential for growth under normal conditions. The erg24 phenotype can be suppressed by mutations in FEN1 and SUR4 (5, 22, 30). These mutations did not alter the sterols produced by the erg24 mutant but permitted conditions that would allow growth with ignosterol, the primary sterol intermediate that accumulates in erg24 mutants. FEN1 and SUR4 were subsequently found to be identical to ELO2 and ELO3, respectively (26), genes involved in fatty acid elongation and sphingolipid synthesis. More recently, erg24 mutants have been shown to be rescued under certain conditions (10), including supplementation with calcium or magnesium (11).

In order to determine whether Erg24p would be a suitable drug target in C. albicans, the erg24 phenotype would have to be characterized. We report here on the isolation of the C. albicans ERG24 gene and the sequential disruption of both alleles. The resulting phenotype in terms of growth properties, drug sensitivity, and pathogenicity indicate that an Erg24p inhibitor could be an effective antifungal compound.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Strains, plasmids, and libraries. S. cerevisiae strain AP2 (MATa ade2-101 his3-{Delta}200 leu2-{Delta}1 lys2-801 trp1-{Delta}63 ura3-52 erg24::LEU2) (21) was used to isolate the C. albicans ERG24 gene following complementation with a C. albicans genomic library. S. cerevisiae strain YPH499, obtained from the American Type Culture Collection, is the ERG24 wild type for AP2. C. albicans strain BWP17 (ura3{Delta}::{lambda}imm434/ura3{Delta}::{lambda}imm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG) was obtained from A. Mitchell (37). C. albicans strain SC5314, used as a wild type for calcium rescue studies, was obtained from W. Fonzi (12). C. albicans strain DAY185 was a gift from A. Mitchell. This strain was derived from BWP17 and has been restored to prototrophy at the HIS1, URA3, and ARG4 loci (A. Mitchell, personal communication) to serve as a control for the mouse survival studies with C. albicans erg24 mutants. Escherichia coli strain DH5{alpha} was used to amplify plasmid DNA. Plasmids pGEM-URA3, pGEM-HIS1, and pRS-ARG4 were obtained from A. Mitchell (37); and plasmid pAB-SK-ARG4 was obtained from N. Ishii (15). Plasmid pRS316 was obtained from P. Heiter (29), and plasmid pDBI52 was obtained from C. Kumamoto (8). C. albicans genomic library 655 was obtained from S. Scherer.

Media and growth. E. coli cultures were grown on Luria broth containing 10 g of tryptone per liter, 5 g of yeast extract per liter, and 10 g of NaCl per liter. Solid Luria broth medium was made by adding agar (Difco) at 20 g/liter. Ampicillin at 60 µg/ml was added after autoclaving for plasmid selection. Cultures were grown at 37°C.

S. cerevisiae and C. albicans were grown on complete synthetic medium (CSM) or YPAD, an enriched medium. CSM contained 0.17% yeast nitrogen base without amino acids (Difco), 0.5% ammonium sulfate, 2% D-glucose, and a mixture of amino acids plus adenine and uracil (Qbiogene, Carlsbad, Calif.). CSM lacking specific nutrients was used for selection. YPAD comprised 1% Bacto Yeast Extract, 2% Bacto Peptone, and 2% D-glucose. Adenine at 360 mg/liter was added to the media used for C. albicans to ensure optimal growth, and uridine at 80 mg/liter was added to the media used for C. albicans ura3 strains. Ergosterol, when used, was added to autoclaved and cooled media at 20 µg/ml to rescue erg24 mutants in S. cerevisiae. S. cerevisiae cultures were grown at 30°C, and C. albicans cultures were grown at 30 or 37°C. For anaerobic growth, brewer's jars or the GasPak system (BBL Microbiology Systems, Cockeysville, Md.) was used. C. albicans for inoculation in the animal model was prepared by growth on Sabouraud dextrose agar (BBL Microbiology Systems) at 35°C. For virulence assays, C. albicans strains were grown on Sabauraud dextrose agar plates (0.5% casein pancreatic digest, 0.5% animal tissue peptic digest, 2% dextrose, 1.7% agar). To characterize the ability to make germ tubes, wild-type strains and erg24 mutants were pregrown overnight in YPAD and inoculated into 10% human serum (Irvine Scientific, Santa Ana, Calif.) at 105 cells/ml. Germ tube formation was assessed at 3 and 12 h postinoculation.

Transformations. E. coli DH5{alpha} cells were transformed by standard transformation protocols (1).

For transformation of S. cerevisiae, the high-efficiency lithium acetate (LiAc) transformation method from the Gottsching Laboratory (http://www.umanitoba.ca/faculties/medicine/-units/biochem/gietz/Trafo.html) was used. The cells were grown overnight in 50 ml of YPAD. A total of 0.5 ml of the culture was transferred into fresh 50 ml of YPAD and allowed to grow for two or three cell divisions. The cells were then spun down at 4,000 rpm at room temperature, washed twice with 10 ml of sterile water and once with 1x TE (Tris-EDTA)-1x LiAc solution, and resuspended in 1x TE-1x LiAc solution to give a cell concentration of 2 x 109 cells/ml. Next, the cell solution was incubated at 30°C for 15 min and 50 µl of the cell solution was transferred to a microcentrifuge tube. A total of 10 µl of carrier DNA (10 µg/µl) (herring testis carrier DNA; Clontech Laboratories, Palo Alto, Calif.), 1 µg of the transforming DNA, and 300 µl of 40% polyethylene glycol (PEG) 3350-1x TE-1x LiAc solution were added to the tube; and the contents were mixed by vortexing. After incubation at 30°C for 30 min, the cells were heat shocked at 42°C for 20 min. Finally, the cells were spun down by centrifugation, resuspended in sterile water, and plated out onto selective medium. The plates were incubated at 30°C for 3 days under the appropriate aerobic or anaerobic conditions.

The C. albicans transformation procedure was provided by A. Mitchell (personal communication). A single C. albicans colony was selected and then inoculated into a 250-ml flask containing 50 ml of YPAD plus uridine and was grown at 30°C overnight. A total of 0.5 ml of the culture was transferred into 50 ml of YPAD plus uridine and incubated at 30°C for 4 to 7 h (four generations). The cells were centrifuged at 4,000 rpm (IEC Model CL) for 5 min, washed in 10 ml of sterile water, and pelleted at 4,000 rpm for 5 min. The cells were then resuspended in 0.5 ml of 1x TE-1x LiAc solution. One hundred microliters of this yeast cell suspension was transferred into a new microcentrifuge tube containing 5 µl of transforming DNA (at least 2 µg) and 10 µl of carrier DNA (10 µg/µl). After incubation of the tube at room temperature for 30 min, 700 µl of 40% polyethylene glycol 3350-1x TE-1x LiAc solution was added to the tube, the contents were gently mixed, and the mixture was incubated overnight at room temperature. The next morning, the cell solution was heat shocked at 42°C for 60 min and centrifuged for 30 s. Finally, the cell pellet was resuspended in sterile water and then plated onto selective medium.

DNA sequencing. DNA sequencing was performed at the Biochemistry Biotechnology Facility in the Indiana University School of Medicine. Once initial sequence data were obtained with primers T3 and T7, new primers were designed to facilitate acquisition of additional DNA sequence data. All new primers for sequencing were purchased through Sigma-Genosys, Ltd. (The Woodlands, Tex.).

PCR. PCRs were carried out on a Perkin-Elmer GeneAmp2400 thermocycler with the following parameters: 94°C for 3 min for the first denaturation of the DNA template, followed by 30 to 40 cycles with three identical steps: 94°C for 45 s, 55°C (5°C below the primer annealing temperature) for 30 to 60 s for the primers to anneal to the denatured DNA, and 72°C for elongation (for 2.5 to 3.5 min, depending on the length of the expected DNA product), followed by 72°C for 10 to 15 min to complete all possible reactions. To avoid mispriming, a touchdown PCR was applied. Initially, the annealing temperature was maintained at the same temperature as the primer's denaturing temperature for two cycles and was gradually dropped 1 to 2°C per cycle for an additional two cycles until a temperature 5°C below the primer's melting temperature was reached. The PCR was then run for another 25 to 35 cycles at an optimal annealing temperature.

Two kinds of thermostable DNA polymerases were used. Taq DNA polymerase in Buffer B (Promega, Madison, Wis.) was mainly used to screen genetic constructions or genetic insertions. The reaction buffer contained 10x buffer without MgCl2 (50 mM KCl, 10 mM Tris-HCl [pH 9.0], 1% Triton X-100) plus 1.5 to 2.0 mM MgCl2 and 1.25 U of polymerase. A second polymerase, Expand High Fidelity Taq polymerase (2.6 U per reaction mixture; Roche, Indianapolis, Ind.) was used to amplify selectable marker genes. The 10x buffer with 15 mM MgCl2 (20 mM Tris-HCl [pH 7.5] 100 mM KCl, 1 mM dithiothreitol, 0.1 mM EDTA, 0.5% [vol/vol] Tween 20, 0.5% [vol/vol] Nonidet P-40, 50% [vol/vol] glycerol) was used.

The following primers were used in this study (the boldface represents plasmid sequences): for preparation of ERG24 disruption cassettes, primers NJ-ERG24-5cl (TGAAATCGTCAAAATTGAATCCAGTCACAACCCATAAGGAGTTCAATGGTATTTCTGGGGGTTTTCCCAGTCACGACGTT) and NJ-ERG24-3cl (TAATATACATAAGGAATTATTTTATAAGGAACTAGCTTTTCGTACTTTTCCCAATCCTCGTGTGGAATTGTGAGCGGATA); for confirmation of ERG24 disruptions, primers NJ-ERG24-5ck (CTTTTTATCCGTCGTACCC) and NJ-ERG24-3ck (CGGTATTTGGTCAGGAATC); and for confirmation of ARG4 integration at ADE2, primers NJ-ADE2-5ck2 (CTTATTCTCATCACACACGCAT) and NJ-pMAL-3' (CATAGCAATCATGGAATACGG).

Sterol analysis. Sterols were isolated as described previously (24) and analyzed by gas chromatography (GC). A Hewlett-Packard HP5890 series II chromatograph equipped with the Hewlett-Packard CHEMSTATION software package was used to analyze the sterol contents. The capillary column (DB-1) was 15 m by 0.25 mm by 0.25 µm (film thickness) (J&W Scientific, Folsom, Calif.) and was programmed from 195 to 280°C (1 min at 195°C and then an increase at 20°C/min to 240°C, followed by an increase at 2°C/min until the final temperature of 280°C was reached). The linear velocity was 30 cm/s, nitrogen was the carrier gas, and all injections were run in the splitless mode.

GC-mass spectrometry analyses of sterols were done with a Thermoquest Trace 2000 gas chromatograph interfaced to a Thermoquest Voyager mass spectrometer. The GC separations were done on a fused silica column (DB-5MS; 20 m by 0.18 mm by 0.18 µm [film thickness]; J&W Scientific). The injector temperature was 190°C. The oven temperature was programmed to remain at 100°C for 1 min, followed by a temperature increase of 6.0°C/min to a final temperature of 300°C. The final temperature was held for 25 min. Helium was the carrier gas, the linear velocity was 50 cm/s, and all injections were run in the splitless mode. The mass spectrometer was in the electron impact ionization mode at an electron energy of 70 eV, the ion source temperature was 150°C, and scanning was done from 40 to 850 atomic mass units at 0.6-s intervals.

Growth analysis. Doubling times for yeast cultures were determined with a Klett-Summerson photoelectric colorimeter. Cells were inoculated into nephelometer flasks containing 20 ml of medium and were incubated in a Lab-Line shaker at 200 rpm and 30 or 37°C. The cell density was measured every 1 to 2 h until the growth reached the stationary phase. Density-versus-time plots were made on semilogarithmic paper to determine the doubling time of each strain.

Drug susceptibility testing. Each strain to be tested was inoculated into 50 ml of liquid medium and incubated in a shaker overnight at 30°C. The cell concentration was determined with a hemacytometer and was then diluted to give a series of cell concentrations of 2 x 107, 2 x 106, 2 x 105, and 2 x 104 cells/ml. A total of 5 µl of each concentration was added to solid YAPD to give a series of spots (spot plate assay) containing 105 to 102 cells. To determine the drug concentration that would inhibit all growth for 48 h, the plates were prepared with various drug concentrations. The plates were prepared with YPAD media with the drug to be tested. The spot plate assay was then conducted with the cell concentrations listed above. The MICs were those concentrations at which no growth on plates with the highest inoculum was observed after 48 h of incubation. Clotrimazole, brefeldin A, cerulenin, cycloheximide, nystatin, and fluphenazine were obtained from Sigma (St. Louis, Mo.). Fenpropimorph and tridemorph were obtained from Crescent Chemical Co. (Hauppage, N.Y.), and ketoconazole was obtained from ICN Pharmaceuticals Inc. (Costa Mesa, Calif.). Terbinafine was a gift from I. Hapala (Slovak Academy of Science). Stock solutions of terbinafine, tridemorph, brefeldin A, and cerulenin were prepared in ethanol. Clotrimazole, ketoconazole, and fenpropimorph stocks were prepared in dimethyl sulfoxide. Fluphenazine and cycloheximide solutions were prepared in distilled H2O, while nystatin suspensions were prepared in N,N-dimethylformamide.

Animal model. Healthy female ND4 mice (age, 4 to 6 weeks; weight, approximately 25 g each; Harlan Sprague-Dawley, Indianapolis, Ind.) were used. Upon arrival at the animal facility, the mice were separated into groups of 10 mice each and were allowed to rest for 1 week before experimentation to reduce stress and behavior disturbances among the animals. Mice were given food and water ad libitum. Freshly grown cells were suspended in sterile saline, and the inoculum was adjusted to the desired density on the basis of hemacytometric cell counts. The viability of each inoculum was determined by plating dilutions onto Sabouraud dextrose agar plates, incubating at 35°C for 48 h, and counting the resulting colonies. To determine any differences in pathogenicity between erg24 strains and the isogenic wild-type strains, survival following systemic infection with each strain was determined. To produce infection, each mouse in randomly selected groups of 10 mice each was intravenously injected (via the lateral tail vein) with 106 CFU of either strain. In a second set of experiments, the inoculum for erg24 mice was increased fivefold to 5 x 106 CFU/mouse and the inoculum for wild-type mice remained the same (1 x 106 CFU/mouse). Survival was monitored for 21 days, and the mice were killed if signs of morbidity were observed. In these cases, death was recorded as occurring on the following day. Experiments were repeated twice, and similar results were obtained. The data presented here are those from one representative experiment. All animal care procedures were supervised and approved by the Animal Welfare Committee, Centers for Disease Control and Prevention.

Statistical analysis. To determine any significant differences in the rates of survival of animals infected with the erg24 strain versus the isogenic wild-type strain, Student's t test was performed.

Nucleotide sequence accession numbers. The GenBank accession numbers for the ERG24 sequences from S. cerevisiae and Arabidopsis thaliana are M99419 and AF263244, respectively.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Isolation and characterization of C. albicans ERG24 gene. The C. albicans ERG24 gene was isolated by complementation of an S. cerevisiae erg24 mutant (AP2) with C. albicans genomic library 655. After initial selection of transformants on CSM without uracil and with ergosterol (5,000 colonies), 15 colonies resulted from replica plating on CSM without uracil, with ergosterol. GC analysis of the sterol contents of five of the colonies indicated a wild-type sterol profile, with ergosterol present as the major sterol. Figure 1 shows the sterol profile of AP2 grown with CaCl2 supplementation, which permits growth of the S. cereviseae erg24 strain, with ignosterol as the primary sterol (11), and also shows the sterol profile of one of the AP2 mutants successfully transformed with the C. albicans ERG24 gene.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 1. Sterol profiles of an S. cerevisiae erg24 (S.c.erg24) mutant and an S. cereveisiae erg24 mutant containing the C. albicans ERG24 gene in plasmid pIU2001 (S.c.erg24/pIU2001). Peak A, squalene; peak B, ergosta-5,8,14,22-tetraenol; peak C, ignosterol; peak D, lanosterol; peak E, ergosterol.

 
A plasmid conferring the wild-type sterol profile in a complemented strain was extracted and amplified in E. coli. Restriction fragments of the extracted plasmid (pIU2001) were subcloned into yeast vector pRS316 and tested for erg24 complementation by using AP2. The smallest complementing insert of 2.2 kb (pIU2005) was used for sequencing with primers T3 and T7. A 235-bp sequence obtained with primer T3 and a matching 467-bp sequence from the Stanford C. albicans DNA database were used to identify the entire ERG24 gene in the 7x contig C. albicans nonannotated DNA database. The ERG24 sequence comprised 1,347 bp encoding a 448-amino-acid polypeptide. The predicted amino acid sequence, shown in Fig. 2, is 58.2 and 37% identical to the predicted sequences of the ERG24 gene products from S. cerevisiae and A. thaliana, respectively (17, 21-23).



View larger version (117K):
[in this window]
[in a new window]
  		FIG. 2. Alignment of the amino acid sequences of the ERG24 genes from C. albicans, S. cerevisiae, and A. thaliana. Shaded areas indicate regions of sequence identity.

 
Calcium rescue of S. cerevisiae erg24 mutants. The original isolation and characterization of erg24 mutants of S. cerevisiae indicated that the ERG24 gene was essential for growth (21-23). However, recent reports (10, 11) have described other conditions, including calcium supplementation, that allow erg24 mutant growth. Verifying this finding with our erg24 strain and defining the parameters required for this rescue on solid medium would be of potential benefit in allowing the growth of C. albicans erg24 mutants if this gene is essential for growth in this organism. Since C. albicans cannot take up exogenous sterol under any conditions, calcium rescue would be a convenient tool.

Figure 3 shows the growth of AP2 (erg24) and its wild type, YPH499, on CSM and YPAD supplemented with various levels of CaCl2. The wild type showed uniform growth across all calcium concentrations, with a decrease in colony size at 400 mM. AP2 showed very little growth at concentrations up to 100 mM, good growth at 200 mM, and diminishing growth at higher concentrations.



View larger version (97K):
[in this window]
[in a new window]
  		FIG. 3. Growth of S. cerevisiae wild type (YPH499) and an erg24 (AP2) mutant on various concentrations of CaCl2. Plates with YPH499 were grown for 4 days, and plates with AP2 were grown for 10 days.

 
Disruption of the C. albicans ERG24 gene. The procedure for the disruption of the two C. albicans alleles of the ERG24 gene used short homologous regions of the ERG24 gene flanking a selectable marker (37). PCR primers which contained 60 bp of the sequence of the ERG24 gene and a short plasmid sequence that amplifies a C. albicans selectable maker were prepared. For the first allele, the primers amplified the URA3 marker on pGEM-URA3. The PCR products were then used to transform strain BWP17 and transformants were selected on CSM-uracil. Two URA+ transformants were selected for PCR analysis to confirm disruption of one copy of the ERG24 gene. PCR primers were constructed to amplify a 1.7-kb fragment that resulted from the wild-type ERG24 sequence and a 2.1-kb fragment in the URA3-disrupted ERG24 allele. Figure 4 shows the 1.7-kb fragment in the wild-type strain (lane BWP17) and both fragments in NJ25 (lane NJ25), a heterozygous strain of ERG24.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 4. PCR confirmation of the disruption of both copies of the ERG24 gene of C. albicans. Lane BWP17, 1.7-kb fragment from the wild-type ERG24 alleles of BWP17; lane NJ25, 1.7- and 2.1-kb fragments of the wild-type allele and the URA3-disrupted ERG24 allele of NJ25; lane NJ51, 2.1- and 4.2-kb fragments of the URA3- and HIS1-disrupted ERG24 alleles of NJ51.

 
A similar procedure was used to disrupt the second copy of the ERG24 gene. In this case the HIS1 marker from pGEM-HIS1 provided the disrupting selectable marker. The PCR products were then used to transform NJ25 with selection on CSM-histidine-uracil plus 200 mM CaCl2. Five colonies were selected from among the 367 colonies present, and each colony was confirmed by PCR to contain disruptions in both copies of the ERG24 gene. In this case the primers would be expected to amplify the 2.1-kb fragment already identified in NJ25 and a 4.2-kb fragment that resulted from the HIS1 disruption. All five isolates contained both the 2.1- and 4.2-kb fragments, indicating that both copies were disrupted in each isolate. Lane NJ51 of Fig. 4 shows both fragments in one of the isolates, isolate NJ51.

Sterol analysis of C. albicans strains with disrupted ERG24 genes. Further confirmation of the successful disruption of the C. albicans ERG24 gene emerges from sterol analysis of the disrupted strains. Figure 5 shows the sterol profiles of the wild-type strain, the heterozygous ERG24/erg24 strain (NJ25), and the erg24 strain (NJ51). The heterozygote had a profile very similar to that of the wild type, with ergosterol (peak B) as the predominant sterol. It also contained a small peak of ergosta-5,8,14,22-tetraenol (peak C) not seen in the wild-type strain. The homozygous erg24 strain, NJ51, produced a profile in which ignosterol (ergosta-8,14-dienol; peak E) is a major sterol but is accompanied by larger amounts of a new sterol, ergosta-8,14,22-trienol (peak F). This sterol is not found in erg24 mutants of S. cerevisiae (Fig. 1). In addition, the squalene contents of the C. albicans erg24 mutants were much lower than those noted in S. cerevisiae mutants and were the same as those seen in the wild-type strains of both organisms.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 5. Sterol profiles of the wild type, the ERG24 heterozygote (NJ25), and the erg24 homozygote (NJ51) of C. albicans. Peak A, squalene; peak B, ergosterol; peak C, ergosta-5,8,14,22-tetraenol; peak D, lanosterol; peak E, ignosterol; peak F, ergosta-8,14,22-trienol.

 
Creation of a prototrophic erg24 strain of C. albicans. A critical characteristic of a potential antifungal that would block the function of Erg24p is the pathogenic capability of the resulting strain with the erg24 phenotype. In order to investigate this feature in an animal model, an erg24 strain devoid of nutritional markers was used since the host organism would not be expected to provide sufficient levels of the missing nutrients to support growth. Strain NJ51 requires arginine, and the ARG+ phenotype must be restored. The ARG4 gene was excised from plasmid pAB-SK-ARG with BamHI as a 2.3-kb fragment. The ARG4 BamHI fragment was ligated to pDBI52, an integrating plasmid, after deletion of the URA3 gene. The resulting plasmid, pNJ02, was linearized at the AvaI site, which is located in the ADE2 gene, and was used to transform strain NJ51. After appropriate selection, two of the three resulting colonies were confirmed by PCR to have the ARG4 gene inserted at one of the ADE2 loci. Primers were selected to amplify a 4.9-kb fragment at the ADE2 locus containing the ARG4 gene. Both isolates contained this fragment (data not shown).

Characteristics of erg24 mutants of C. albicans. Surprisingly, transfer of the confirmed erg24 mutants of C. albicans to media without CaCl2 resulted in growth, although the rate of growth was reduced compared to that of the wild type. Growth rates, expressed as doubling times, were determined for the wild-type and erg24 strains. As shown in Table 1 the doubling times are approximately twofold higher for the erg24 mutants than for the wild type on both CSM and YAPD at 30 and 37°C.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Growth of wild-type and erg24 strains of C. albicans with various media and temperature conditions

 
The lack of a calcium requirement for growth indicates that the ERG24 gene of C. albicans is not essential. It was of interest, however, to see if calcium had some effect on the growth of erg24 mutants since it was able to restore growth to erg24 mutants of S. cerevisiae. Figure 6 shows the effects of calcium on the growth of C. albicans erg24 mutants on both medium types and in the presence of several concentrations of CaCl2. Growth of the mutants actually showed greater inhibition with increased concentrations of CaCl2 than did growth of the wild type. Thus, calcium has no ameliorating or enhancing effects on the growth of C. albicans erg24 mutants.



View larger version (99K):
[in this window]
[in a new window]
  		FIG. 6. Growth of C. albicans wild type (SC5314) and an erg24 (NJ55) mutant on various concentrations of CaCl2. The plates were incubated for 4 days.

 
Drug susceptibilities of C. albicans erg24 mutants. The susceptibilities of C. albicans erg24 mutants to a battery of antifungal compounds and cellular inhibitors were determined. The antifungal drugs used included terbinafine, an allylamine-inhibiting squalene epoxidase (16); fluconazole, clotrimazole, ketoconazole, and itraconazole, azoles that inhibit Erg11p (31); fenpropimorph and tridemorph, morpholines that inhibit Erg24p and Erg2p (2); and nystatin, a polyene antifungal that binds to ergosterol in membranes, causing cell leakage (7). The cellular inhibitors included cycloheximide, a common protein synthesis inhibitor; cerulenin, a fatty acid synthase inhibitor (25); fluphenazine, a calmodulin antagonist (14); and brefeldin A (32), a compound which interferes with the function of the Golgi apparatus. Figure 7 shows the growth patterns of the wild type, the ERG24 heterozygote, and three independently derived erg24 mutants (NJ50, NJ51, and NJ55 containing various selectable markers) at four cell concentrations plated on media containing the compounds described above. The strains producing ergosterol (BWP17 and NJ25) were most sensitive to nystatin. The erg24 mutants, however, were more resistant to the morpholine fenpropimorph than to tridemorph, another morpholine. In the spot plate assay the erg24 mutants were uniformly resistant to the azoles and were more sensitive than the wild type to cycloheximide, fluphenazine, cerulenin, and brefeldin A. In another representation of drug susceptibility, shown in Table 2, the concentrations of these drugs necessary to completely prevent growth on plates for 48 h are shown. In the spot plate assay, at higher concentrations the azoles were about equally effective (fluconazole and ketoconazole) or slightly less effective (itraconazole and clotrimazole) against the erg24 mutants than against the wild type. The concentrations of the cellular inhibitors required to suppress growth were at least 10-fold lower for the erg24 mutant than for the wild type.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 7. Growth responses of C. albicans wild type (BWP17), the ERG24 heterozygote (NJ25), and three erg24 homozygotes (NJ50, NJ51, and NJ55) in the presence of sterol biosynthesis inhibitors and metabolic inhibitors.

 

View this table:
[in this window]
[in a new window]
  		TABLE 2. Inhibitory concentrations of cell inhibitors and antifungal compounds for wild-type (ERG24) and erg24 strains of C. albicans

 
Survival studies. The results of survival studies for mice infected with the erg24 or the wild-type strain at equal and different inoculum sizes are reported in Fig. 8A and B, respectively. The absence of the ERG24 gene product resulted in the reduced pathogenicity of the mutant strain compared to that of the isogenic wild-type strain (DAY185), as demonstrated by the reduced mortality rate observed for mice infected with the mutant (0% mortality at day 5 postinfection) compared to that for the mice infected with the wild type (100% mortality at day 5 postinfection) (Fig. 8A). By day 21, 90% of the animals infected with the erg24 strain survived (data not shown). The same trend was observed in a second experiment in which the erg24 inoculum was increased fivefold relative to that of the wild-type strain. By day 5 postinfection, 60% of the animals infected with the erg24 strain survived, whereas 0% of the animals infected with the wild-type strain survived (Fig. 8B). Both results support the conclusion that inhibition or absence of Erg 24p activity compromises the pathogenicity of the mutant strain.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 8. Survival of mice infected with the wild-type strain and an erg24 strain of C. albicans. (A) An inoculum of 106 CFU/mouse was used for each strain. {blacktriangleup}, erg24 strain; {blacksquare}, wild-type strain. (B) An inoculum of 5 x 106 CFU/mouse was used for erg24, and an inoculum of 1 x 106 CFU/mouse was used for the wild type. {blacksquare}, erg24 strain; {blacksquare}, wild-type strain. Ten mice were used in each group, and the results are from one representative experiment. By the use of pooled results from two independent experiments conducted with each strain, Student's t test indicated a significant difference in survival at days 3, 4, and 5 postinfection for both experiments (P > 0.05).

 
Ability to form germ tubes. Ninety percent germ tube formation was observed for wild-type cells after 3 h in human serum, whereas for two independent erg24 mutants, no germ tube formation was observed after 3 or 12 h of incubation. For each cell type, a total of 400 to 500 cells were scanned.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The ERG24 gene in the yeast sterol biosynthetic pathway is a potential site for the discovery and application of new antifungal agents. The morpholine class of antifungals targets this step, but no formulations of this class of drugs are suitable for systemic use in humans. The fact that the morpholines have been successfully used to combat fungal infections in agricultural settings (2) and the fact that this reaction is essential for growth under most conditions in S. cerevisiae imply that this step in the pathway may be an important one for fungal growth or pathogenicity. The first test in determination of whether Erg24p is a good target is definition of the characteristics of a fungal pathogen that is devoid of the Erg24p function.

The C. albicans ERG24 gene has been isolated by complementation of an S. cerevisiae erg24 mutant with a C. albicans library. The sequence of this gene was determined by initial sequencing of the complementing DNA, which was then used to identify the entire sequence in the C. albicans nonannotated database. The predicted amino acid sequence of the C. albicans gene was found to be 58.2 and 37% identical to those of S. cerevisiae and A. thaliana, respectively.

Sequential disruption of the two alleles of the C. albicans ERG24 gene has been accomplished, and the erg24 mutant is capable of growth under normal aerobic conditions on standard defined and enriched media. In contrast, erg24 mutants of S. cerevisiae do not grow under standard conditions (21-23). In one study (22), two recessive mutations, fen1 and fen2, were found to permit growth with ignosterol in the presence of fenpropimorph. In a second report (30), a pair of mutations, fen1 (it is unclear whether the fen1 mutations were the same in both of the studies) and sur4, were shown to permit growth in erg24 mutants. Rather than allow alternate sterols to be synthesized and restore growth, these suppressor mutations permit the cell to grow with ignosterol, the major sterol accumulated by erg24 mutants. Subsequently, FEN1 and SUR4 have been shown to be identical to ELO2 and ELO3, respectively, genes involved in fatty acid elongation and sphingolipid synthesis (5, 26). Thus, alteration of other membrane lipids can modify the type of sterol that will satisfy membrane requirements and facilitate growth.

Recent reports have shown that erg24 mutants of S. cerevisiae are capable of growth only on defined media under aerobic conditions (10) and on enriched media supplemented with Ca2+ or Mg2+ (11). The investigators hypothesized that ergosterol was responsible for the proper function of Pmrlp, a calcium pump. The pump was postulated to move calcium from the cytosol to vesicles, where it may be required for protein transport. A lack of ergosterol would inactivate the pump, and calcium transport into vesicles would be possible only in the presence of exogenous calcium supplements. The results obtained in this study would argue against this hypothesis since erg24 mutants of C. albicans grow without calcium supplementation. Alternatively, ergosterol may not play a role in activating the Pmrlp pump in C. albicans.

In an examination of the sterol profiles generated by erg24 mutants of S. cerevisiae and C. albicans, one striking difference is observed. C. albicans accumulates a significant level of ergosta-8,14,22-trienol, a sterol that is absent from the S. cerevisiae mutant. This intermediate may be the element that allows growth under normal conditions for C. albicans erg24 mutants. This overall finding of different phenotypes for identical blocks in the pathways of S. cerevisiae and C. albicans is similar to that noted with the ERG11 gene, which encodes the lanosterol C-14 demethylase. In this case, the ERG11 gene has been shown to be essential for growth in S. cerevisiae but not in C. albicans (4). Thus, there are significant differences in sterol requirements for growth and in the way in which the ergosterol pathways adjust to blocked steps in these two organisms.

One of the major functions of sterol in membranes is to regulate permeability. Numerous reports have described ergosterol pathway mutants of S. cerevisiae with altered membrane permeability characteristics (3, 20, 34). A more recent study (18) with an erg6 (ERG6 encodes the sterol methyltransferase) mutant of C. albicans clearly showed that the erg6 strain was significantly more sensitive to cellular inhibitors and some antifungal drugs. This finding is consistent with the increased permeability resulting from sterol substitution in the membrane. For example, the wild type was more than 50 times more resistant than the erg6 mutant to brefeldin A and terbinafine; the wild type was more than 100 times more resistant than the erg6 mutant to the morpholines fenpropimorph and tridemorph. In the study described in this report an erg24 strain of C. albicans has been shown to be at least 10 times more susceptible than the wild type to the metabolic inhibitors cycloheximide, cerulenin, fluphenazine, and brefeldin A. The erg24 strain also showed a significantly increased level of susceptibility to an allylamine antifungal, terbinafine. Although the levels of susceptibility varied somewhat, the same pattern was noted in erg6 mutants of C. albicans (18).

The susceptibilities of the erg24 strains to morpholines did not change in the case of tridemorph, but resistance to fenpropimorph was seen. Morpholine resistance in Saccharomyces stems from overexpression of ERG24 (21) and mutations in FEN1 and SUR4. fen1 erg24 double mutants are therefore morpholine resistant due to the fen1 mutation and not the erg24 mutation. It should also be noted that while both Erg2p and Erg24p are targets of the morpholine antifungals, treatment of the wild-type strain with growth-inhibitory concentrations of both drugs resulted predominantly in an erg2 sterol profile, but higher fenpropimorph concentrations also resulted in the accumulation of ergosta-8,14 sterols, which are typically seen in erg24 mutants (data not shown). These results indicate that fenpropimorph targets the C-14 reductase to a greater extent than tridemorph and helps to explain why erg24 mutants are more resistant to this antifungal. In contrast, the C. albicans erg6 mutant showed significantly elevated levels of susceptibility to both morpholines (18). Both erg6 and erg24 mutants were resistant to nystatin, a polyene which binds to ergosterol. The reduced affinity of nystatin for sterol intermediates in the membranes accounts for this observation.

The susceptibilities to the azoles vary with the particular azole used. The results presented in Fig. 7 show that the erg24 mutants are more resistant than the wild type to all four azoles. Determination of the concentrations necessary to completely inhibit growth for 48 h, however, indicates low levels of resistance to clotrimazole and itraconazole only. Resistance in this case can be attributed either to the differential permeability to azoles in the ERG24 and erg24 membrane environments or to interactions among the enzymes and substrates involved in two adjacent steps in the ergosterol pathway. For example, a block at the ERG24 step in the pathway (the erg24 phenotype) would result in an accumulation of ignosterol and related sterols with a double bond at C-14. This, in turn, might alter the ability of Erg11p to process more substrate, thus reducing the function of this enzyme and diminishing the sensitivity of this step to azole inhibition. In contrast to this finding, erg6 mutants of C. albicans were found to have the same levels of susceptibility to azoles as the wild type, although only clotrimazole and ketoconazole were tested (18). This was interpreted to reflect the fact that the sterol substitutions in the membrane did not alter the permeability characteristics in a way that had any impact on azole entry.

The most important and relevant characteristic of the erg24 phenotype is its pathogenicity. Strains with this phenotype have already been found to be slowly growing under several conditions. When equivalent inocula of the erg24 strain and the wild type are compared in a murine system, the erg24 strain is significantly less pathogenic. Even when the inoculum of the erg24 mutant strain was increased to five times that of the wild-type strain, the rates of survival of the erg24-infected animals were significantly greater than those of animals infected with the wild-type strain by day 3 postinfection and beyond. Although it is true that the doubling time of the erg24 strain is twice that of the isogenic wild-type strain, this phenotype alone cannot entirely account for the significant difference in survival rates observed in these studies. While further testing, including studies with longer time frames and immunocompromised-animal models, would be required to specifically define the pathogenic potential of the C. albicans erg24 mutant, it can at least be concluded that the mutant showed a greatly reduced pathogenicity compared to that of the wild-type strain.

The characteristics of the erg24 phenotype in C. albicans indicate that Erg24p has potential as a target for new antifungals. The erg24 phenotype has been shown to be susceptible to low concentrations of a variety of inhibitors and some antifungal compounds, most likely due to the increased membrane permeability resulting from altered membrane sterols. The erg24 strain is slowly growing, indicating that its ability to proliferate in the host and invade tissue would be compromised, allowing more time for an immune response and drug treatment to control an infection. Finally, and most importantly, the erg24 mutant has been shown to be far less able than the wild type of C. albicans to cause disease in the mouse model system, perhaps due to an inability to form hyphae.


   ACKNOWLEDGMENTS
 
This work was supported by a Burroughs Wellcome Fund Mycology Scholar Award to M.B.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, Indiana University Purdue University Indianapolis, 723 West Michigan St., Indianapolis, IN 46202-5132. Phone: (317) 274-0588. Fax: (317) 274-2846. E-mail: nlees{at}iupui.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ausubel, F., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1995. Short protocols in molecular biology, 3rd ed. John Wiley & Sons, Inc., New York, N.Y.
  2. Baloch, R. I., and E. I. Mercer. 1987. Inhibition of sterol 8-7 isomerase and14-reductase by fenpropimorph, tridemorph, and fenpropidin in cell-free enzyme systems from Saccharomyces cerevisiae. Phytochemistry 26:663-668.[CrossRef]
  3. Bard, M., N. D. Lees, L. A. Borrows, and F. W. Kleinhans. 1978. Differences in crystal violet dye uptake and cation-induced death among yeast sterol mutants. J. Bacteriol. 135:1146-1148.[Abstract/Free Full Text]
  4. Bard, M., N. D. Lees, T. Turi, D. Craft, L. Cofrin, R. Barbuch, C. Koegel, and J. C. Loper. 1993. Sterol synthesis and viability of erg11 (cytochrome P-450 lanosterol demethylase) mutations in Saccharomyces cerevisiae and Candida albicans. Lipids 28:963-967.[Medline]
  5. Baudry, K., E. Swain, A. Rahiers, M. Germann, A. Batta, S. Rondet, S. Mandala, K. Henry, G. S. Tint, T. Edlind, M. Kurtz, and J. T. Nickels. 2001. The effect of the erg26-1 mutation on the regulation of lipid metabolism in Saccharomyces cerevisiae. J. Biol. Chem. 16:12702-12711.
  6. Boschman, C. R., U. R. Bodnar, M. A. Tornatore, A. A. Obias, G. A. Noskin, K. Englund. M. A. Postelnick, T. Suriano, and L. R. Peterson. 1998. Thirteen-year evolution of azole resistant yeast isolates and prevalence of resistant strains carried by cancer patients at a large medical center. Antimicrob. Agents Chemother. 42:734-738.[Abstract/Free Full Text]
  7. Brajtburg, J., W. G. Powderley, G. S. Kobayashi, and G. Medoff. 1990. Amphotericin B: current understanding of mechanism of action. Antimicrob. Agents Chemother. 34:183-188.[Free Full Text]
  8. Brown, D. H., I. V. Slobodkin, and C. Kumamoto. 1996. Stable transformation and regulated expression of an inducible reporter construct in Candida albicans using restriction enzyme-mediated integration. Mol. Gen. Genet. 251:75-80.[Medline]
  9. Calabrese, D., J. Bille, and D. Sanglard. 2000. A novel multidrug efflux transporter gene of the major facilitator superfamily from Candida albicans (FLU1) conferring resistance to fluconazole. Microbiology 146:2743-2754.[Abstract/Free Full Text]
  10. Crowley, J. H., S. J. Smith, F. W. Leak, and L. W. Parks. 1996. Aerobic isolation of an ERG24 null mutant of Saccharomyces cerevisiae. J. Bacteriol. 178:2991-2993.[Abstract/Free Full Text]
  11. Crowley, J. H., S. Tove, and L. W. Parks. 1998. A calcium-dependent ergosterol mutant of Saccharomyces cerevisiae. Curr. Genet. 34:93-99.[CrossRef][Medline]
  12. Fonzi, W. A., and M. Y. Irwin. 1992. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract]
  13. Georgopapadakou, N. H., and T. J. Walsh. 1994. Human mycoses: drugs and targets for emerging pathogens. Science 264:371-373.[Free Full Text]
  14. Hait, W. N., J. F. Gesmonde, and J. S. Lazo. 1993. Effect of anti-calmodulin drugs on the growth and sensitivity of C6 rat glioma cells to bleomycin. Anticancer Res. 14:1711-1721.
  15. Ishii, N., M. Yamamoto, F. Yoshihara, M. Arisawa, and Y. Aoki. 1997. Biochemical and genetic characterization of Rbflp, a putative transcription factor of Candida albicans. Microbiology 143:429-435.[Abstract]
  16. Jandrositz, A., F. Turnowski, and G. Hogenauer. 1991. The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Gene 107:155-160.[CrossRef][Medline]
  17. Jang, J.-C., S. Fujioka, M. Tasaka, H. Seto, S. Takatsuto, A. Ishii, M. Aida, S. Yoshida, and J. Sheen. 2000. A critical role of sterols in embryonic patterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana. Genes Dev. 14:1485-1497.[Abstract/Free Full Text]
  18. Jensen-Perkages, K. L., M. A. Kennedy, N. D. Lees, R. Barbuch, C. Koegel, and M. Bard. 1998. Sequencing, disruption, and characterization of the Candida albicans sterol methyltransferase (ERG6) gene: drug susceptibility studies in erg6 mutants. Antimicrob. Agents Chemother. 42:1160-1167.[Abstract/Free Full Text]
  19. Kakeya, H., Y. Miyazaki, H. Miyazaki, K. Nyswaner, B. Grimberg, and J. E. Bennett. 2000. Genetic analysis of azole resistance in the Darlington strain of Candida albicans. Antimicrob. Agents Chemother. 44:2985-2990.[Abstract/Free Full Text]
  20. Kleinhans, F. W., N. D. Lees, M. Bard, R. A. Haak, and R. A. Woods. 1979. ESR determination of membrane permeability in a yeast sterol mutant. Chem. Phys. Lipids 23:143-154.[CrossRef][Medline]
  21. Lai, M. H., M. Bard, C. A. Pierson, J. F. Alexander, M. Goebl, G. T. Carter, and D. R. Kirsch. 1994. Identification of a gene family in the Saccharomyces cerevisiae ergosterol biosynthesis pathway. Gene 140:401-449.[CrossRef]
  22. Lorenz, R. T., and L. W. Parks. 1992. Cloning, sequencing and disruption of the gene encoding the C-14 sterol reductase in Saccharomyces cerevisiae. DNA Cell Biol. 11:685-692.[Medline]
  23. Marcireaux, D., D. Guyonnet, and F. Karst. 1992. Construction and growth properties of a yeast strain defective in sterol 14-reductase. Curr. Genet. 22:267-272.[CrossRef][Medline]
  24. Molzhan, S. W., and R. A. Woods. 1972. Polyene resistance and the isolation of sterol mutants in Saccharomyces cerevisiae. J. Gen. Microbiol. 72:339-348.[Medline]
  25. Morisaki, N., H. Funabashi, R. Shimazawa, J. Furukawa, A. Kawaguchi, S. Okuda, and S. Iwasaki. 1993. Effect of side-chain structure on inhibition of yeast fatty acid synthase by cerulenin analogues. Eur. J. Biochem. 211:111-115.[Medline]
  26. Oh, C.-S., D. A. Toke, S. Mandala, and C. E. Martin. 1997. ELO2 and ELO3, homologues of the Saccharomyces cerevisiae ELO1 gene, function in fatty acid elongation and are required for sphingolipid formation. J. Biol. Chem. 272:17376-17384.[Abstract/Free Full Text]
  27. Powderley, W. G., G. S. Kobayashi, G. P. Herzig, and G. Medoff. 1988. Amphotericin B-resistant yeast infection in severely immunocompromised patients. Am. J. Med. 84:826-832.[CrossRef][Medline]
  28. Sanglard, D., F. Ischer, M. Monod, and J. Bille. 1997. Cloning of Candida albicans genes conferring resistance to azole antifungal agents: characterization of CDR2, a new multidrug ABC transporter gene. Microbiology 143:405-416.[Abstract]
  29. Sikorski, R. S., and P. Heiter. 1989. A system of shuttle vectors and yeast host strains designated for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:18-27.
  30. Silve, S., P. Leplatois, A. Joss, P.-H. Dupuy, C. Lanua, M. Kaghad, C. Dhers, C. Picard, A. Rahier, M. Taton, G. Le Fur, D. Caput, P. Ferrara, and G. Loison. 1996. The immunosuppressant SR31747 blocks cell proliferation by inhibiting a steroid isomerase in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:3494-3505.
  31. Vanden Bossche, H., G. Willemssens, and P. Marichal. 1987. Anti-Candida drugs—the biochemical basis for their activity. Crit. Rev. Microbiol. 15:57-72.[Medline]
  32. Vogel, J. P., J. N. Lee, D. R. Kirsch, M. D. Rose, and E. S. Sztul. 1993. Brefeldin A causes a defect in secretion in Saccharomyces cerevisiae. J. Biol. Chem. 268:3040-3043.[Abstract/Free Full Text]
  33. Walsh, T. J., M.-A. Viviani, E. Arathoon, C. Chiou, M. Ghannoum, A. R. Groll, and F. C. Odds. 2000. New targets and delivery systems for antifungal therapy. Med. Mycol. 38:335-347.
  34. Welihinda, A. A., A. D. Beavis, and R. J. Trumbly. 1994. Mutations in the LIS1 (ERG6) gene confer increased sodium and lithium uptake in Saccharomyces cerevisiae. Biochim. Biophys. Acta 1194:107-117.
  35. White, T. C. 1997. Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus. Antimicrob. Agents Chemother. 41:1482-1487.[Abstract]
  36. White, T. C. 1997. The presence of an R467K amino acid substitution and loss of allelic variation correlates with an azole-resistant lanosterol 14-alpha-demethylase in Candida albicans. Antimicrob. Agents Chemother. 41:1488-1494.[Abstract]
  37. Wilson, R. B., D. Davis, and A. P. Mitchell. 1999. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868-1874.[Abstract/Free Full Text]

Antimicrobial Agents and Chemotherapy, April 2002, p. 947-957, Vol. 46, No. 4
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.4.947-957.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jia, N.
Right arrow Articles by Bard, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jia, N.
Right arrow Articles by Bard, M.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Clin. Vaccine Immunol. Clin. Microbiol. Rev.
J. Clin. Microbiol. ALL ASM JOURNALS