Previous Article | Next Article ![]()
Antimicrobial Agents and Chemotherapy, July 2002, p. 2145-2154, Vol. 46, No. 7
0066-4804/02/$04.00+0 DOI: 10.1128/AAC.46.7.2145-2154.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
and Marilyn M. Sanders*
Department of Pharmacology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854
Received 23 January 2002/ Returned for modification 7 March 2002/ Accepted 10 April 2002
|
|
|---|
|
|
|---|
Topoisomerases from a variety of organisms have been effective targets for cytotoxic drug development. These nuclear enzymes modulate the topology of DNA during processes such as transcription, replication, and recombination. Type I topoisomerases cleave a single DNA strand and allow "controlled rotation" of the strand to relieve torsional stress one linking number at a time (9, 30, 56). The type II enzymes cleave both DNA strands and change the linking number by two by passing intact, double-stranded DNA through the cut (reviewed in references 10 and 14). In the presence of certain drugs, topoisomerases are converted into cytotoxic molecules. Camptothecin (CPT) reversibly traps cleaved DNA-topoisomerase I intermediates, and upon collision with the replication machinery, irreversible double-stranded breaks in DNA are generated (30, 32, 33). This culminates in G2 cell cycle arrest and subsequent cell death (6, 66). Topoisomerase II targeting agents include anticancer drugs such as doxorubicin and etoposide (10, 14, 54), the quinolone antibiotics (44), and antitrypanosomal drugs (51). These agents convert their respective type II topoisomerases into cytotoxic molecules in a cell cycle-independent manner. The utility of antitopoisomerase agents against bacteria and cancer has suggested examination of topoisomerases for their potential use to poison pathogenic fungi (13, 17, 18, 23, 24, 52).
The interaction of potential topoisomerase poisons with P. carinii has been investigated (reviewed in reference 48). A series of bisbenzimidazole and pentamidine analogs were shown to preferentially inhibit a partially purified preparation of P. carinii topoisomerase I in comparison with the human enzyme (17, 18). Correlations between cytotoxicity and the DNA binding strength of the bisbenzimidazole and pentamidine derivatives in rat models of PCP have also been seen (64, 65). Other studies show that CPT, amsacrine, and etoposide are toxic to P. carinii in culture (13, 15). However, there are no studies that show drug effects on topoisomerase cleavage activity (which correlates with in vivo cytotoxicity) since large quantities of the enzyme were not available.
In this study, we cloned the topoisomerase I cDNA from P. carinii and characterized its cleavage activity with known topoisomerase I poisons with various structures. We found that P. carinii topoisomerase I stimulates DNA cleavage in the presence of some potent topoisomerase I poisons but is unaffected by others. In addition, we have demonstrated that P. carinii topoisomerase I is not the cellular target of pentamidine.
|
|
|---|
P. carinii topoisomerase I gene cloning. The topoisomerase I-encoding gene of P. carinii was cloned by screening a rat cDNA library acquired from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. Fragments of the gene were first obtained by PCR of genomic type I P. carinii DNA samples. A 135-bp fragment was generated by using the degenerate primers 5'TIA [5'GT(AT)TT(CT)CGTAC(AGC)TA(CT)AA(CT)GC3'] and 3'TIB [5'TGATG(AG)TTACA(GT)A(AG)(AG)AT(GT)GC3']. Reaction mixtures contained genomic DNA, 10 nmol of each deoxynucleoside triphosphate, 0.75 to 1 µg of each primer, Taq DNA polymerase buffer (20 mM Tris-HCl [pH 8.4], 50 mM KCl, 1.5 mM MgCl2), and 2.5 U of Taq polymerase (Gibco BRL, Gaithersburg, Md.). PCR was carried out on a Stratagene RoboCycler 40 for 1 min at 92°C, 30 s at 47°C, and 1 min at 68°C for 34 cycles with an additional cycle of 1 min at 92°C, 30 s at 47°C, and 5 min at 68°C. The PCR product was purified and subcloned into a T-tailed (3), EcoRV-cut Bluescript plasmid (Stratagene, La Jolla, Calif.). The 135-bp product was sequenced manually with the Sequenase Version 2.0 DNA Sequencing kit (Amersham, Arlington Heights, Ill.) and labeled to create a probe with which to identify larger P. carinii TOP1 PCR gene fragments by hybridization. Amplification with the primers 3'T1B (above) and 5'T1E [5'GA(AG)GA(GT)GA(AG)GA(AT)TA(CT)AA(AG)TGGTGG3'] yielded an approximately 1.5-kbp fragment under the conditions described above, with the exception of a 2-min elongation for the first 34 cycles. The gene fragment was then purified with GlassMax (Gibco BRL) and sequenced on a LICOR4000 automated sequencer. The 1.5-kbp fragment was labeled with [32P]dATP by the Multiprime DNA Labeling System (Amersham, Piscataway, N.J.) and used to screen the P. carinii cDNA library. Approximately 250,000 plaques were screened, yielding nine positive colonies. In the tertiary screen, three isolates from each of the nine plaques were chosen. Isolate 8Z contained the 5' terminus of the cDNA, while 9Y contained the 3' terminus sequence (Fig. 1B). Nucleotide sequences from two or three independent isolates, each sequenced twice in both directions, were aligned by the Pileup program of the Genetics Computer Group program package (27) to determine the final sequence. Intron sequences were determined from genomic DNA amplified by PCR with nondegenerate primers designed on the basis of the nucleotide sequences of cDNA isolates 8Z and 9Y. All primers were synthesized on an Applied Biosystems 392 oligonucleotide DNA-RNA synthesizer.
![]() View larger version (35K): [in a new window] |
FIG. 1. Restriction map and structural features of P. carinii topoisomerase I (topo I). The P. carinii TOP1 cDNA sequence is represented by the box. Common restriction sites are noted above the box, as is the NspI site used to fuse the two cDNA fragments together. (A) The length of each intron, beginning at bp 653, is indicated below the open box. (B) Thin lines indicate fragments from two different cDNA isolates used to obtain the final coding sequence construct inserted into the expression vector. The 9Y cDNA fragment also contains a ca. 1.4-kbp 3' untranslated trailer sequence. (C) Dashed lines represent genomic cDNA screening probes generated by PCR (not drawn to scale).
|
F' and purified. Insert 8Z was digested with NspI and SmaI and purified. Insert 9Y was purified from the plasmid following digestion with NspI and KpnI. The cDNA fragments were ligated at the NspI site with T4 DNA ligase. The TOP1 cDNA was then amplified with Vent polymerase (New England Biolabs, Beverly, Mass.) with a 5' primer (5'ACTGGGATCCATGAATAAGAAGAAAATATAAAGAC 3') containing the 5' end of the P. carinii coding sequence and a BamHI site in frame with the translation start site in the vector. The 3' primer used contained the 3' end of the coding sequence. The resulting PCR fragment was purified, digested with BamHI, and ligated to a BamHI/EcoRI-digested pET11a plasmid (58). The ligation mixture was then digested with mung bean nuclease (New England Biolabs) and blunt end ligated with T4 DNA ligase, followed by transformation into DH5
F' by electroporation. Sequenced isolates were transformed into E. coli strain BL21(DE3) and expressed by isopropyl-ß-D-thiogalactopyranoside (IPTG) induction, and the topoisomerase I enzymes were purified as described previously (26). Briefly, BL21(DE3) cells harboring the P. carinii topoisomerase I cDNA in pET11a were harvested by centrifugation at 1,500 x g for 5 min. The cells were lysed by sonication in the presence of 3 ml of buffer I (5 mM KPO4 [pH 7.0], 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 1 mM ß-mercaptoethanol, 1 mM dithiothreitol [DTT], 4 mM EDTA, 10% glycerol, 1 M NaCl). The cell suspension was diluted to 30 ml in buffer I, and nucleic acid was precipitated by the slow addition of polyethylene glycol 8000 to 6% (wt/vol). The cleared lysate was applied directly to a Bio-Gel HTP (Bio-Rad Laboratories, Richmond, Calif.) column. The column was developed with a linear gradient of 20 mM to 0.7 M KPO4, pH 7.0 (17). The fractions containing activity were then pooled and dialyzed against 30 mM KPO4-50% glycerol (vol/vol)-0.5 mM EDTA-1 mM DTT, pH 7.0. Relaxation assays. Relaxation assays were performed as described previously (40). Briefly, each reaction mixture contained 150 ng of supercoiled YEpG DNA and purified P. carinii topoisomerase I diluted as indicated. The reactions were carried out in B cocktail buffer (40 mM Tris-HCl [pH 7.8], 100 mM KCl, 10 mM MgCl2, 0.5 mM DTT, 0.5 mM EDTA, 30 mg of bovine serum albumin per ml) at 37°C for 15 min. Reactions were terminated by the addition of 5 µl of prewarmed stop solution (0.16 M EDTA, 6% sodium dodecyl sulfate) and 4 µl of loading dye. Samples were then loaded onto a 1% agarose gel in 0.5x TPE (90 mM Tris-phosphate, 2 mM EDTA, pH 8.0) running buffer and electrophoresed for 16 h. Catalytic inhibition assays were carried out as noted above, except that the drug was added to the DNA first and then the enzyme was added.
P. carinii topoisomerase I activity assay. The enzymatic activity of topoisomerase I purified from rat P. carinii isolates has been characterized previously (17). The optimal reaction conditions for the P. carinii topoisomerase I cloned here were similarly determined by relaxation assays. This enzyme preparation contained approximately 100 U of activity per µg of protein (1 U is defined as the amount of enzyme that relaxes 50% of 0.15 µg of supercoiled DNA in 15 min). Similar to other eukaryotic topoisomerases, the P. carinii enzyme is active at high dilutions (see Fig. 4, lanes 5 to 7). A 1:1,000 dilution of the fungal enzyme in the presence of Mg2+ contains significant relaxation activity. In the absence of Mg2+, P. carinii topoisomerase I activity is decreased approximately 10-fold. All experiments with the fungal enzyme were carried out in the absence of Mg2+. Activity was assayed at 25, 27, 30, and 37°C. The enzyme displayed optimal activity at 37°C (data not shown).
![]() View larger version (75K): [in a new window] |
FIG. 4. Relaxation activity of P. carinii topoisomerase I. Supercoiled YEpG plasmid DNA was incubated with purified recombinant human (lanes 2 to 4) or P. carinii (lanes 5 to 10) topoisomerase I. Reactions were carried out in 10-fold serial dilutions of both enzymes in the presence (lanes 1 to 7) or absence of MgCl2 (lanes 8 to 10). Arrows above the lanes indicate the direction of dilution. Lane 1 contained control supercoiled DNA with no enzyme. Reaction products were analyzed on a 1% agarose gel and visualized with ethidium bromide. The positions of the supercoiled (SC) and relaxed (R) DNAs are indicated to the left.
|
Yeast cytotoxicity assay.
Yeast cytotoxicity assays were performed as described previously (26, 39). To express the P. carinii cDNA in yeast, the yeast TOP1 gene was excised from the single-copy vector YCpGAL1-ScTOP1 and replaced with the topoisomerase cDNA from P. carinii as follows. A BamHI site was appended to the 5' end and an XbaI site was appended to the 3' end of the coding sequence of the P. carinii TOP1 cDNA (8Z/9Y ligation product) by PCR and purified. YCpGAL1-ScTOP1 was cut with BamHI/XbaI and purified. The PCR fragment and digested vector were then joined by using T4 DNA ligase, amplified in DH5
F', and sequenced. Several isolates were transformed into yeast strain JN2-134 by the rapid LiCl yeast transformation protocol (28) (data not shown). Active P. carinii topoisomerase I isolates were identified by the display of cytotoxicity on plates containing galactose and 0.05 or 0.5 µM CPT. YCpGAL1-ScTOP1, YCpGAL1-Sctop1Y727F, and YCpGAL1-hTOP1 were also transformed into JN2-134, and each, including yeast harboring YCpGAL1-PcTOP1, was grown to an optical density at 600 nm of 1.0. Serial fivefold dilutions of the cells were made on complete minimal plates minus uracil and containing galactose and drugs as indicated.
Nucleotide sequence accession number. The nucleotide sequence of the P. carinii DNA topoisomerase I gene has been deposited in the GenBank database and assigned accession number AF061533.
|
|
|---|
Figure 1 is a representation of the structural features of the P. carinii TOP1 cDNA. Isolates 8Z and 9Y code for the amino- and carboxy-terminal halves, respectively, of the topoisomerase I protein. Isolate 9Y also includes a ca. 1.4-kbp 3' noncoding sequence (Fig. 1B). The nucleotide sequence of isolate 8Z ends 3 bp upstream of an ATG codon. We were unable to isolate cDNAs containing the sequence 5' of this point and are thus not certain whether this ATG represents the actual translation start site or an internal methionine codon close to the N terminus of the protein. Consideration of amino acid or nucleotide sequence homology with TOP1 genes from other organisms is not helpful, as there is no sequence homology among the 5' ends of these genes. Furthermore, it is well known that N-terminal truncation of the enzyme does not affect its activity in vitro (1, 16). That said, the following observations support the supposition that the construct does represent the complete cDNA. First, the sequence predicts a protein similar in amino acid length to other eukaryotic topoisomerase I enzymes (Table 1). Second, the activity of the P. carinii construct in yeast cytotoxicity assays described in the next section (see Fig. 3) indicates the presence of a functional nuclear localization sequence located in the N-terminal region (55).
|
View this table: [in a new window] |
TABLE 1. Comparison of amino acid sequence similarities between fungal topoisomerase I enzymes and between fungal and human topoisomerase I enzymesa
|
![]() View larger version (55K): [in a new window] |
FIG. 3. P. carinii (P. car.) topoisomerase I is poisoned by CPT. Yeast strain JN2-134 lacking endogenous TOP1 was transformed with plasmid YCpGAL1 bearing the human or P. carinii TOP1 cDNA. Cells were grown to an optical density at 600 nm of 1.0 and serially diluted (fivefold) onto complete minimal medium plates minus uracil plus galactose and the indicated concentration of CPT. The control plate contained no drug. The human TOP1 transformant is on the top row, and P. carinii is on the bottom row of each plate.
|
![]() View larger version (48K): [in a new window] |
FIG. 2. P. carinii TOP1 cDNA sequence. The cDNA coding sequence was determined by sequencing several cDNA library isolates twice in both directions. The sequences from the various fragments were aligned and displayed by using the Genetics Computer Group program package (27). Numbers to the right of the sequence represent the positions of the adjacent nucleotides or amino acids relative to thepresumed starting ATG or methionine, respectively. Underlined nucleotides locate degenerate PCR primers initially used for generation of the PCR probes from the genomic DNA template. The asterisk indicates the TAA stop codon, and the double underlining identifies the proposed enzyme active site tyrosine. The ATG at position 1 is identified as a likely translation start site on the basis of the protein's predicted molecular weight, as well as the presence of an enzymatically active gene product in in vivo and in vitro expression systems. This nucleotide sequence has been submitted to the GenBank database and issued accession number AFO61533.
|
P. carinii topoisomerase I is sensitive to potent human topoisomerase I poisons. In the presence of the prototypic topoisomerase poison CPT, the lifetime of the transient covalent calf thymus or human topoisomerase I DNA intermediate is significantly prolonged (47). Upon collision of this complex with the replication machinery, the enzyme becomes a cytotoxic molecule in vivo (33, 34). To determine whether P. carinii topoisomerase I can be similarly affected in vivo, a yeast cytotoxicity assay was utilized (26, 39). The P. carinii TOP1 cDNA was introduced into the single-copy yeast plasmid YCpGAL1 as described in Materials and Methods and expressed in the JN2-134 strain of S. cerevisiae (7, 45). The JN2-134 strain lacks a functional genomic copy of the topoisomerase I gene; thus, the only topoisomerase I activity expressed is from the gene carried by the plasmid. Figure 3 shows the results of the plating of serial fivefold dilutions of JN2-134 cells harboring YCpGAL1-hTOP1 and YCpGAL1-PcTOP1 (rows 1 and 2, respectively) on plates containing CPT. On the control plate, both strains grew at all of the dilutions used. At low CPT concentrations (0.05 µM), all of the dilutions of cells expressing the human TOP1 cDNA were killed while most of the dilutions of cells expressing the P. carinii enzyme grew. At a high CPT concentration (0.5 µM), both the cells expressing the human enzyme and those expressing the P. carinii enzyme were killed. Since cells carrying the YCpGAL1 plasmid with no topoisomerase insert survive in the presence and in the absence of CPT (45) and since topoisomerase I poisons only kill cells having a functional topoisomerase I enzyme (7), this experiment shows that (i) P. carinii topoisomerase I is a cytotoxic target for CPT in yeast, (ii) the expressed P. carinii topoisomerase I enzyme is functional, and (iii) the P. carinii enzyme displays decreased in vivo sensitivity to CPT compared with the human enzyme.
The enzyme activity of P. carinii topoisomerase I has been characterized previously with the purified protein isolated from P. carinii-infected rats (17). Here, the activity of P. carinii topoisomerase I was characterized by using the enzyme expressed from the pET11a plasmid in E. coli. The relaxation activity is compared with that of the human enzyme in Fig. 4. The P. carinii enzyme relaxes DNA to completion, again demonstrating that the enzyme is functionally similar to the human enzyme. In addition, P. carinii topoisomerase I relaxes supercoiled DNA to completion in the absence of Mg 2+ (Fig. 4), a property shared by all eukaryotic topoisomerase I enzymes.
Existing data show that there is a correlation among topoisomerase I, drug-induced DNA cleavage stimulation, and in vivo cytotoxicity (50). Therefore, the activity of P carinii topoisomerase I in a cleavage assay was determined. The cleavage patterns generated from P. carinii and human topoisomerase I in the presence of increasing concentrations of CPT or the bisbenzimidazole Hoechst 33342 (Ho33342) were compared. Consistent with the in vivo cytotoxicity data, P. carinii topoisomerase I displays less extensive cleavage in the presence of CPT than the human enzyme (Fig. 5). The cleavage stimulated by the fungal enzyme in the presence of CPT is approximately 10-fold less than that generated by human topoisomerase I, although equivalent units of activity were utilized. The decreased sensitivity of fungal topoisomerase I to CPT has been seen previously (7, 23, 26, 29, 45). These data suggest that although P. carinii and human topoisomerase I are functionally similar, sufficient differences in enzyme activity exist that the fungal enzyme can be utilized as a novel target for antifungal drug development.
![]() View larger version (67K): [in a new window] |
FIG. 5. Comparison of P. carinii and human topoisomerase I (Topo I) cleavage patterns in the presence of CPT and Ho33342 (HO). Cleavage assays were carried out with human or P. carinii topoisomerase I as described in Materials and Methods. Reaction mixtures contained end-labeled, linearized YEpG plasmid DNA and the indicated drug concentrations. The no-enzyme control (DNA) and background cleavage (DNA + Topo I) controls were in lanes 1, 2, and 9, respectively. Samples were alkali denatured or loaded directly (rightmost four lanes) onto a 1% agarose gel and visualized following autoradiography of the dried gel. The micromolar concentrations of CPT and Ho33342 are shown above the lanes.
|
Differential response of P. carinii topoisomerase I to potent human topoisomerase I poisons. Inhibition of P. carinii topoisomerase I catalytic activity by known topoisomerase I poisons has been reported previously (17). However, since cleavage stimulation correlates best with in vivo cytotoxicity (50), characterization of cleavage activity is necessary. Cleavage stimulation by a variety of structural classes of human topoisomerase I poisons is shown in Fig. 6. CPT was used as a positive control for P. carinii cleavage activity. Like cleavage by the human enzyme, cleavage by P. carinii topoisomerase I was not stimulated by the strong minor-groove binder berenil (1 to 10 µM; data not shown) or DAPI (Fig. 6). These data indicate that minor-groove binding is not the sole determinant of the enhanced cleavage activity of P. carinii topoisomerase I. The fungal enzyme was also insensitive to distamycin A, which moderately stimulates human topoisomerase I cleavage at the concentrations tested (12). DNA cleavage by the P. carinii enzyme was not stimulated in the presence of the potent human topoisomerase I poison nitidine. Coralyne, also a potent human topoisomerase I poison, produces a weak cleavage pattern at 2.5 µM. We showed in Fig. 5 that the bisbenzimidazole Ho33342 produced a strong cleavage pattern, similar to the experience with Aspergillus nidulans topoisomerase I (29). Similarly, the terbenzimidazole QS-II-48 (59), which greatly stimulated A. nidulans topoisomerase I cleavage (29), also stimulated P. carinii topoisomerase I-mediated cleavage. Thus, the formation of the P. carinii topoisomerase I-cleavable complex is enhanced by CPT and representative terbenzimidazoles and bisbenzimidazoles (Ho33342). In addition, like that mediated by Ho33342, QS-II-48- and coralyne-mediated cleavage was inhibited at higher drug concentrations.
![]() View larger version (92K): [in a new window] |
FIG. 6. P. carinii topoisomerase I (Topo I) is resistant to several potent human topoisomerase I poisons. Cleavage assays were carried out as described in Materials and Methods and in the legend to Fig. 5 in the presence of CPT, coralyne (COR), DAPI, distamycin A (DIST), nitidine (NIT), and QS/II/48 at the indicated micromolar concentrations. The CPT lanes were used as a positive control. The no-enzyme (DNA) and background cleavage (DNA + Topo I) controls were in lanes 1 and 2, respectively.
|
![]() View larger version (107K): [in a new window] |
FIG. 7. P. carinii topoisomerase I-mediated cytotoxicity with a mixed-mode DNA binding molecule. Yeast cytotoxicity assays were performed as described in Materials and Methods and the legend to Fig. 3. Plates contained the indicated concentrations of menogaril and nogalamycin, with the human enzyme expressed on the top row and the P. carinii enzyme on the bottom of each panel. The control plate contained galactose and no drug.
|
![]() View larger version (56K): [in a new window] |
FIG. 8. Pentamidine does not inhibit the catalytic activity of P. carinii topoisomerase I. Relaxation assays were carried out as described in Materials and Methods and the legend to Fig. 4. Control lanes 1 and 2 contained DNA and DNA with 0.4 mM pentamidine (PTD), respectively. Lanes 3 to 12 contained the indicated millimolar concentrations of pentamidine and P. carinii or human topoisomerase I, as marked. The positions of relaxed (R) and supercoiled (SC) DNAs are indicated to the left.
|
![]() View larger version (92K): [in a new window] |
FIG. 9. Pentamidine does not stimulate topoisomerase I (Topo I)-mediated DNA cleavage. Cleavage assays were carried out as described in Materials and Methods and the legend to Fig. 5. Control lanes 1 and 2 contained DNA and DNA plus P. carinii topoisomerase I, respectively. Lanes 3 to 5 were positive controls containing DNA, P. carinii topoisomerase I, and CPT. Lanes 6 to 11 contained P. carinii or human (h) topoisomerase I, as marked, with the indicated micromolar concentrations of pentamidine (PENT).
|
![]() View larger version (55K): [in a new window] |
FIG. 10. Pentamidine does not specifically target P. carinii topoisomerase I in a yeast cytotoxicity assay. The cytotoxicity assay was carried out as described in Materials and Methods and the legend to Fig. 3. Fivefold dilutions of the yeast strain containing plasmids YCpGAL1-Sctop1Y727F (top row), YCpGAL1-hTOP1 (middle row), and YCpGAL1-PcTOP1 (bottom row), respectively, were spotted onto complete minimal plates minus uracil and plus galactose and the indicated concentrations of pentamidine. The control plate contained galactose and no drug.
|
|
|
|---|
We have cloned and sequenced the P. carinii topoisomerase I cDNA and more than half of the structural gene and report the expression of the protein in E. coli and yeast. The gene for P. carinii topoisomerase I codes for a 763-amino-acid protein. Among the currently known fungal topoisomerase I amino acid sequences, the P. carinii topoisomerase I sequence is most similar to that of S. pombe topoisomerase I and least similar to that of C. albicans (Table 1). The similarity of the P. carinii and other fungal topoisomerase I sequences to the human enzyme is some 10 to 15% lower than their similarity to other fungal sequences, but the domain structure (49, 55) typical of the human enzyme is well preserved. A pileup of the fungal sequences compared with the human sequences shows first that the sequences of the catalytically important core and C-terminal domains are highly conserved among the fungi but are less similar to the human sequence. Second, the fungi have linker domains that are some 70 amino acids longer than the human linker domains and much more closely related to those of other fungi than to those of humans (data not shown).
We believe that the topoisomerase I gene product characterized here is the major or only one in the organism for the following reasons. First, a cDNA library (
250,000 colonies were screened) was the source of the nine isolates used to determine the sequence of P. carinii topoisomerase I. This suggests that we have characterized the main transcript present in the P. carinii mRNA preparation but does not rule out the presence of minor transcripts from another gene. Second, the PCR approach taken with the genomic DNA should have identified other homologous related genes if they were present either as heterogeneously sized PCR products or as heterogeneities in the sequences of the products. The first two fragments of the genomic DNA isolated by PCR were from domains of the TOP1 gene that are quite homologous (but not totally identical) in other organisms. Third, the data presented by Dykstra et al. (17, 18) show that topoisomerase I was isolated as a single peak of activity, suggesting that it was the major, if not the only, species present.
Purification of the expressed P. carinii topoisomerase I protein has allowed the characterization of drug effects previously not possible with the limited quantity of the enzyme obtained from rat model infection systems. The prototype topoisomerase I poison CPT does induce considerable cleavage of linear DNA in the presence of P. carinii topoisomerase I (Fig. 5). It has previously been shown to cause toxicity to P. carinii in culture (13, 15, 21), and our data demonstrate that topoisomerase I is the target of CPT cytotoxicity in yeast expressing the P. carinii enzyme (Fig. 3). The P. carinii topoisomerase I enzyme is apparently similar to the S. cerevisiae, A. nidulans, and C. albicans enzymes in that all of the fungal enzymes that have been characterized are 5- to 10-fold less sensitive to CPT than is human topoisomerase I, both in purified enzyme preparations and in the yeast cytotoxicity assay (Fig. 3 and 5) (7, 23, 26, 29, 45).
Both the bisbenzimidazole Ho33342 and the terbenzimidazole QS-II-48 are potent human topoisomerase I poisons (12, 59, 69). Both also strongly stimulate DNA cleavage by P. carinii topoisomerase I (Fig. 5 and 6). This is similar to findings with the A. nidulans enzyme (29), where these 2,5'-linked benzimidazole derivatives were substantially more active in stimulating DNA cleavage than they were with the human enzyme. Another topoisomerase I poison shown to target P. carinii topoisomerase I in the yeast cytotoxicity assay is nogalamycin (Fig. 7). In contrast to the strong P. carinii topoisomerase I-poisoning activity obtained with the benzimidazoles and nogalamycin, no poisoning was seen with coralyne or nitidine (Fig. 6), both of which are potent human topoisomerase I poisons (26, 46). Coralyne (and other protoberberines) are also inactive against both the A. nidulans and S. cerevisiae topoisomerase I enzymes (26, 29). The specificity and activity characteristics of these various drug classes in poisoning P. carinii topoisomerase I are generally consistent with previously reported findings on fungal topoisomerase I enzymes compared with the human enzyme (23, 24, 29), namely, that significant drug specificity differences do exist.
With the exception of CPT derivatives and the several anti-Candida drugs characterized by Fostel and coworkers, the topoisomerase I poisons discussed above are cationic drugs that bind in the minor groove of DNA (12, 46, 69). The correlation between minor-groove binding and topoisomerase I poisoning activity has been noted with terbenzimidazoles (69) and other drug classes (11, 12, 59), although it is clear that strong minor-groove binding behavior is not the sole determinant for topoisomerase I poisoning activity, as several well-known minor-groove binding agents, including berenil and netropsin, show little or no activity as topoisomerase I poisons (reviewed in reference 46). A number of additional classes of biscationic DNA binding compounds have been synthesized and found to demonstrate cytotoxicity against P. carinii in rat models of PCP. These include substituted bisbenzimidazoles linked 2,2' through alkyl groups (65), various derivatives of pentamidine (25, 64), diarylfurans (8), and carbazoles (60). It has been suggested, on the basis of their cytotoxicity for P. carinii and their minor-groove binding properties (4, 20), that some or all of these compounds act by poisoning or inhibiting topoisomerase I or II. Reports of inhibition of calf thymus topoisomerase activity for 2,2'-alkyl-linked bisbenzimidazoles and diarylfurans (8, 17) have seemed to support these speculations. However, direct inhibition (poisoning) of P. carinii topoisomerase activity has not been demonstrated for 2,2'-alkyl-linked bisbenzimidazoles, diarylfurans, or pentamidine-related derivatives.
The unanswered questions regarding the cytotoxic mechanism(s) of pentamidine led us to investigate whether this clinically used anti-P. carinii drug is a topoisomerase I poison. Our results have excluded topoisomerase I as a possible molecular target of pentamidine. Pentamidine neither inhibits the catalytic activity of P. carinii (or human) topoisomerase I (Fig. 8) nor enhances the cleavage of linear DNA (Fig. 9). Additionally, pentamidine was toxic to yeast strains containing no functional topoisomerase I (Fig. 10), indicating that another cytotoxic target exists. One suggested cytotoxic target of pentamidine and several other biscationic minor-groove binding drugs is topoisomerase II (5, 8, 18). In addition, pentamidine has been suggested to block the splicing of group I introns in P. carinii, C. albicans, and S. cerevisiae cells (41, 43).
Rukiyah Van Dross was supported by a grant from the Minority Advancement Program of Rutgers University and a training grant from the National Institutes of Health (IR25 GM55145).
Present address: Department of Pathology, University of Kansas Medical Center, Kansas City, KS 66160. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»