This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Dross, R. T.
Right arrow Articles by Sanders, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Dross, R. T.
Right arrow Articles by Sanders, M. M.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, July 2002, p. 2145-2154, Vol. 46, No. 7
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.7.2145-2154.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Molecular Characterization of Recombinant Pneumocystis carinii Topoisomerase I: Differential Interactions with Human Topoisomerase I Poisons and Pentamidine

Rukiyah T. Van Dross,{dagger} and Marilyn M. Sanders*

Department of Pharmacology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854

Received 23 January 2002/ Returned for modification 7 March 2002/ Accepted 10 April 2002


arrow
ABSTRACT
 
The Pneumocystis carinii topoisomerase I-encoding gene has been cloned and sequenced, and the expressed enzyme interactions with several classes of topoisomerase I poisons have been characterized. The P. carinii topoisomerase I protein contains 763 amino acids and has a molecular mass of ca. 90 kDa. The expressed enzyme relaxes supercoiled DNA to completion and has no Mg2+ requirement. Cleavage assays reveal that both the human and P. carinii enzymes form covalent complexes in the presence of camptothecin, Hoechst 33342, and the terbenzimidazole QS-II-48. As with the human enzyme, no cleavage is stimulated in the presence of 4',6'-diamidino-2-phenylindole (DAPI) or berenil. A yeast cytotoxicity assay shows that P. carinii topoisomerase I is also a cytotoxic target for the mixed intercalative plus minor-groove binding drug nogalamycin. In contrast to the human enzyme, P. carinii topoisomerase I is resistant to both nitidine and potent protoberberine human topoisomerase I poisons. The differences in the sensitivities of P. carinii and human topoisomerase I to various topoisomerase I poisons support the use of the fungal enzyme as a molecular target for drug development. Additionally, we have characterized the interaction of pentamidine with P. carinii topoisomerase I. We show, by catalytic inhibition, cleavage, and yeast cytotoxicity assays, that pentamidine does not target topoisomerase I.


arrow
INTRODUCTION
 
Pneumocystis carinii pneumonia (PCP) is an opportunistic infection common in immune compromised individuals (35, 48). The incidence of this infection has decreased dramatically in individuals infected with human immunodeficiency virus due to the use of highly active antiretroviral therapy. However, in human immunodeficiency virus-infected individuals and cancer patients with CD4 cell counts lower than 200/µl, long-term prophylaxis with the standard PCP drug combination sulfamethoxazole-trimethoprim (co-trimoxazole) is recommended (2). Continued use of co-trimoxazole in the treatment of Plasmodium falciparum, Escherichia coli, and Streptococcus pneumoniae infections is associated with the generation of point mutations in the dihydropteroate synthase gene, which confers resistance to sulfonamides. Such resistance has been seen in P. carinii-infected individuals (31, 36, 37, 42). Therefore, novel antipneumocystis agents must be developed to address these concerns.

Topoisomerases from a variety of organisms have been effective targets for cytotoxic drug development. These nuclear enzymes modulate the topology of DNA during processes such as transcription, replication, and recombination. Type I topoisomerases cleave a single DNA strand and allow "controlled rotation" of the strand to relieve torsional stress one linking number at a time (9, 30, 56). The type II enzymes cleave both DNA strands and change the linking number by two by passing intact, double-stranded DNA through the cut (reviewed in references 10 and 14). In the presence of certain drugs, topoisomerases are converted into cytotoxic molecules. Camptothecin (CPT) reversibly traps cleaved DNA-topoisomerase I intermediates, and upon collision with the replication machinery, irreversible double-stranded breaks in DNA are generated (30, 32, 33). This culminates in G2 cell cycle arrest and subsequent cell death (6, 66). Topoisomerase II targeting agents include anticancer drugs such as doxorubicin and etoposide (10, 14, 54), the quinolone antibiotics (44), and antitrypanosomal drugs (51). These agents convert their respective type II topoisomerases into cytotoxic molecules in a cell cycle-independent manner. The utility of antitopoisomerase agents against bacteria and cancer has suggested examination of topoisomerases for their potential use to poison pathogenic fungi (13, 17, 18, 23, 24, 52).

The interaction of potential topoisomerase poisons with P. carinii has been investigated (reviewed in reference 48). A series of bisbenzimidazole and pentamidine analogs were shown to preferentially inhibit a partially purified preparation of P. carinii topoisomerase I in comparison with the human enzyme (17, 18). Correlations between cytotoxicity and the DNA binding strength of the bisbenzimidazole and pentamidine derivatives in rat models of PCP have also been seen (64, 65). Other studies show that CPT, amsacrine, and etoposide are toxic to P. carinii in culture (13, 15). However, there are no studies that show drug effects on topoisomerase cleavage activity (which correlates with in vivo cytotoxicity) since large quantities of the enzyme were not available.

In this study, we cloned the topoisomerase I cDNA from P. carinii and characterized its cleavage activity with known topoisomerase I poisons with various structures. We found that P. carinii topoisomerase I stimulates DNA cleavage in the presence of some potent topoisomerase I poisons but is unaffected by others. In addition, we have demonstrated that P. carinii topoisomerase I is not the cellular target of pentamidine.


arrow
MATERIALS AND METHODS
 
Materials. CPT and coralyne were obtained from L. F. Liu (this institution), and QS-II-48 (59) was obtained from E. LaVoie (Rutgers University). All of the other drugs used in this study were purchased from Sigma Chemical Company. The drugs were dissolved in dimethyl sulfoxide and stored at -20°C. P. carinii (type I) genomic DNA from infected rats was obtained from M. J. Leibowitz (this institution), and purified human topoisomerase I was obtained from L. Liu. The JN2-134 strain of Saccharomyces cerevisiae (MATa rad52::LEU2 trp1 ade2-1 his7 ura3-52 ise1 top1-1) (45) and the plasmids YCpGAL1-Sctop1Y727F (39), YCpGAL1-ScTOP1 (38), and YCpGAL1-hTOP1 (7) were provided by Mary Ann Bjornsti (St. Jude Children's Research Hospital).

P. carinii topoisomerase I gene cloning. The topoisomerase I-encoding gene of P. carinii was cloned by screening a rat cDNA library acquired from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. Fragments of the gene were first obtained by PCR of genomic type I P. carinii DNA samples. A 135-bp fragment was generated by using the degenerate primers 5'TIA [5'GT(AT)TT(CT)CGTAC(AGC)TA(CT)AA(CT)GC3'] and 3'TIB [5'TGATG(AG)TTACA(GT)A(AG)(AG)AT(GT)GC3']. Reaction mixtures contained genomic DNA, 10 nmol of each deoxynucleoside triphosphate, 0.75 to 1 µg of each primer, Taq DNA polymerase buffer (20 mM Tris-HCl [pH 8.4], 50 mM KCl, 1.5 mM MgCl2), and 2.5 U of Taq polymerase (Gibco BRL, Gaithersburg, Md.). PCR was carried out on a Stratagene RoboCycler 40 for 1 min at 92°C, 30 s at 47°C, and 1 min at 68°C for 34 cycles with an additional cycle of 1 min at 92°C, 30 s at 47°C, and 5 min at 68°C. The PCR product was purified and subcloned into a T-tailed (3), EcoRV-cut Bluescript plasmid (Stratagene, La Jolla, Calif.). The 135-bp product was sequenced manually with the Sequenase Version 2.0 DNA Sequencing kit (Amersham, Arlington Heights, Ill.) and labeled to create a probe with which to identify larger P. carinii TOP1 PCR gene fragments by hybridization. Amplification with the primers 3'T1B (above) and 5'T1E [5'GA(AG)GA(GT)GA(AG)GA(AT)TA(CT)AA(AG)TGGTGG3'] yielded an approximately 1.5-kbp fragment under the conditions described above, with the exception of a 2-min elongation for the first 34 cycles. The gene fragment was then purified with GlassMax (Gibco BRL) and sequenced on a LICOR4000 automated sequencer. The 1.5-kbp fragment was labeled with [32P]dATP by the Multiprime DNA Labeling System (Amersham, Piscataway, N.J.) and used to screen the P. carinii cDNA library. Approximately 250,000 plaques were screened, yielding nine positive colonies. In the tertiary screen, three isolates from each of the nine plaques were chosen. Isolate 8Z contained the 5' terminus of the cDNA, while 9Y contained the 3' terminus sequence (Fig. 1B). Nucleotide sequences from two or three independent isolates, each sequenced twice in both directions, were aligned by the Pileup program of the Genetics Computer Group program package (27) to determine the final sequence. Intron sequences were determined from genomic DNA amplified by PCR with nondegenerate primers designed on the basis of the nucleotide sequences of cDNA isolates 8Z and 9Y. All primers were synthesized on an Applied Biosystems 392 oligonucleotide DNA-RNA synthesizer.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 1. Restriction map and structural features of P. carinii topoisomerase I (topo I). The P. carinii TOP1 cDNA sequence is represented by the box. Common restriction sites are noted above the box, as is the NspI site used to fuse the two cDNA fragments together. (A) The length of each intron, beginning at bp 653, is indicated below the open box. (B) Thin lines indicate fragments from two different cDNA isolates used to obtain the final coding sequence construct inserted into the expression vector. The 9Y cDNA fragment also contains a ca. 1.4-kbp 3' untranslated trailer sequence. (C) Dashed lines represent genomic cDNA screening probes generated by PCR (not drawn to scale).

P. carinii topoisomerase I cDNA expression. Inserts from isolates 8Z and 9Y were excised from the lambda gt10 library as pBluescript plasmids with the Rapid Excision Kit (RE704 helper phage; Stratagene). Each insert was then amplified in Escherichia coli strain DH5{alpha}F' and purified. Insert 8Z was digested with NspI and SmaI and purified. Insert 9Y was purified from the plasmid following digestion with NspI and KpnI. The cDNA fragments were ligated at the NspI site with T4 DNA ligase. The TOP1 cDNA was then amplified with Vent polymerase (New England Biolabs, Beverly, Mass.) with a 5' primer (5'ACTGGGATCCATGAATAAGAAGAAAATATAAAGAC 3') containing the 5' end of the P. carinii coding sequence and a BamHI site in frame with the translation start site in the vector. The 3' primer used contained the 3' end of the coding sequence. The resulting PCR fragment was purified, digested with BamHI, and ligated to a BamHI/EcoRI-digested pET11a plasmid (58). The ligation mixture was then digested with mung bean nuclease (New England Biolabs) and blunt end ligated with T4 DNA ligase, followed by transformation into DH5{alpha}F' by electroporation. Sequenced isolates were transformed into E. coli strain BL21(DE3) and expressed by isopropyl-ß-D-thiogalactopyranoside (IPTG) induction, and the topoisomerase I enzymes were purified as described previously (26). Briefly, BL21(DE3) cells harboring the P. carinii topoisomerase I cDNA in pET11a were harvested by centrifugation at 1,500 x g for 5 min. The cells were lysed by sonication in the presence of 3 ml of buffer I (5 mM KPO4 [pH 7.0], 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 1 mM ß-mercaptoethanol, 1 mM dithiothreitol [DTT], 4 mM EDTA, 10% glycerol, 1 M NaCl). The cell suspension was diluted to 30 ml in buffer I, and nucleic acid was precipitated by the slow addition of polyethylene glycol 8000 to 6% (wt/vol). The cleared lysate was applied directly to a Bio-Gel HTP (Bio-Rad Laboratories, Richmond, Calif.) column. The column was developed with a linear gradient of 20 mM to 0.7 M KPO4, pH 7.0 (17). The fractions containing activity were then pooled and dialyzed against 30 mM KPO4-50% glycerol (vol/vol)-0.5 mM EDTA-1 mM DTT, pH 7.0.

Relaxation assays. Relaxation assays were performed as described previously (40). Briefly, each reaction mixture contained 150 ng of supercoiled YEpG DNA and purified P. carinii topoisomerase I diluted as indicated. The reactions were carried out in B cocktail buffer (40 mM Tris-HCl [pH 7.8], 100 mM KCl, 10 mM MgCl2, 0.5 mM DTT, 0.5 mM EDTA, 30 mg of bovine serum albumin per ml) at 37°C for 15 min. Reactions were terminated by the addition of 5 µl of prewarmed stop solution (0.16 M EDTA, 6% sodium dodecyl sulfate) and 4 µl of loading dye. Samples were then loaded onto a 1% agarose gel in 0.5x TPE (90 mM Tris-phosphate, 2 mM EDTA, pH 8.0) running buffer and electrophoresed for 16 h. Catalytic inhibition assays were carried out as noted above, except that the drug was added to the DNA first and then the enzyme was added.

P. carinii topoisomerase I activity assay. The enzymatic activity of topoisomerase I purified from rat P. carinii isolates has been characterized previously (17). The optimal reaction conditions for the P. carinii topoisomerase I cloned here were similarly determined by relaxation assays. This enzyme preparation contained approximately 100 U of activity per µg of protein (1 U is defined as the amount of enzyme that relaxes 50% of 0.15 µg of supercoiled DNA in 15 min). Similar to other eukaryotic topoisomerases, the P. carinii enzyme is active at high dilutions (see Fig. 4, lanes 5 to 7). A 1:1,000 dilution of the fungal enzyme in the presence of Mg2+ contains significant relaxation activity. In the absence of Mg2+, P. carinii topoisomerase I activity is decreased approximately 10-fold. All experiments with the fungal enzyme were carried out in the absence of Mg2+. Activity was assayed at 25, 27, 30, and 37°C. The enzyme displayed optimal activity at 37°C (data not shown).



View larger version (75K):
[in this window]
[in a new window]
 
FIG. 4. Relaxation activity of P. carinii topoisomerase I. Supercoiled YEpG plasmid DNA was incubated with purified recombinant human (lanes 2 to 4) or P. carinii (lanes 5 to 10) topoisomerase I. Reactions were carried out in 10-fold serial dilutions of both enzymes in the presence (lanes 1 to 7) or absence of MgCl2 (lanes 8 to 10). Arrows above the lanes indicate the direction of dilution. Lane 1 contained control supercoiled DNA with no enzyme. Reaction products were analyzed on a 1% agarose gel and visualized with ethidium bromide. The positions of the supercoiled (SC) and relaxed (R) DNAs are indicated to the left.

Topoisomerase I cleavage assays. DNA topoisomerase cleavage assays were performed as previously described (33). YEpG DNA was linearized with BamHI and filled in with [32P]dATP by using Klenow polymerase (Gibco BRL). The reaction mixture included B cocktail buffer, 20 ng of labeled YEpG, the indicated concentration of each drug, and P. carinii or human topoisomerase I. The optimal cleavage activity of P. carinii topoisomerase I was ascertained in assays containing increasing enzyme concentrations in the presence of CPT (2.8 µM). Samples were incubated at 27°C for 15 min, and reactions were terminated by the addition of proteinase K (Gibco BRL) and sodium dodecyl sulfate. Each reaction mixture was then loaded directly or under denaturing conditions onto a 1% agarose gel for electrophoresis for 16 h. The gel was dried and exposed to Fuji XAR X-ray film (Fisher).

Yeast cytotoxicity assay. Yeast cytotoxicity assays were performed as described previously (26, 39). To express the P. carinii cDNA in yeast, the yeast TOP1 gene was excised from the single-copy vector YCpGAL1-ScTOP1 and replaced with the topoisomerase cDNA from P. carinii as follows. A BamHI site was appended to the 5' end and an XbaI site was appended to the 3' end of the coding sequence of the P. carinii TOP1 cDNA (8Z/9Y ligation product) by PCR and purified. YCpGAL1-ScTOP1 was cut with BamHI/XbaI and purified. The PCR fragment and digested vector were then joined by using T4 DNA ligase, amplified in DH5{alpha}F', and sequenced. Several isolates were transformed into yeast strain JN2-134 by the rapid LiCl yeast transformation protocol (28) (data not shown). Active P. carinii topoisomerase I isolates were identified by the display of cytotoxicity on plates containing galactose and 0.05 or 0.5 µM CPT. YCpGAL1-ScTOP1, YCpGAL1-Sctop1Y727F, and YCpGAL1-hTOP1 were also transformed into JN2-134, and each, including yeast harboring YCpGAL1-PcTOP1, was grown to an optical density at 600 nm of 1.0. Serial fivefold dilutions of the cells were made on complete minimal plates minus uracil and containing galactose and drugs as indicated.

Nucleotide sequence accession number. The nucleotide sequence of the P. carinii DNA topoisomerase I gene has been deposited in the GenBank database and assigned accession number AF061533.


arrow
RESULTS
 
P. carinii topoisomerase I cloning and structural characterization. The TOP1 gene from P. carinii was cloned in order to obtain sufficient amounts of the protein for enzyme and drug sensitivity characterization. Initially, we obtained a 135-bp fragment of the TOP1 gene from a P. carinii genomic DNA sample with degenerate primers 5'TIA and 3'T1B, which were described previously (68) (Fig. 1C). The fragment was purified, sequenced, and used to identify larger genomic PCR products. Another degenerate primer, 5'T1E, was paired with 3'T1B to obtain a ca. 1.5-kb fragment of TOP1 (Fig. 1C). This fragment was labeled and used to screen the P. carinii cDNA library.

Figure 1 is a representation of the structural features of the P. carinii TOP1 cDNA. Isolates 8Z and 9Y code for the amino- and carboxy-terminal halves, respectively, of the topoisomerase I protein. Isolate 9Y also includes a ca. 1.4-kbp 3' noncoding sequence (Fig. 1B). The nucleotide sequence of isolate 8Z ends 3 bp upstream of an ATG codon. We were unable to isolate cDNAs containing the sequence 5' of this point and are thus not certain whether this ATG represents the actual translation start site or an internal methionine codon close to the N terminus of the protein. Consideration of amino acid or nucleotide sequence homology with TOP1 genes from other organisms is not helpful, as there is no sequence homology among the 5' ends of these genes. Furthermore, it is well known that N-terminal truncation of the enzyme does not affect its activity in vitro (1, 16). That said, the following observations support the supposition that the construct does represent the complete cDNA. First, the sequence predicts a protein similar in amino acid length to other eukaryotic topoisomerase I enzymes (Table 1). Second, the activity of the P. carinii construct in yeast cytotoxicity assays described in the next section (see Fig. 3) indicates the presence of a functional nuclear localization sequence located in the N-terminal region (55).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Comparison of amino acid sequence similarities between fungal topoisomerase I enzymes and between fungal and human topoisomerase I enzymesa



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3. P. carinii (P. car.) topoisomerase I is poisoned by CPT. Yeast strain JN2-134 lacking endogenous TOP1 was transformed with plasmid YCpGAL1 bearing the human or P. carinii TOP1 cDNA. Cells were grown to an optical density at 600 nm of 1.0 and serially diluted (fivefold) onto complete minimal medium plates minus uracil plus galactose and the indicated concentration of CPT. The control plate contained no drug. The human TOP1 transformant is on the top row, and P. carinii is on the bottom row of each plate.

Figure 2 displays the sequence of the coding region of the P. carinii TOP1 cDNA. The protein coding region is 2,292 bp in length, from the proposed ATG start to the TAA stop. It codes for a 763-amino-acid sequence with a calculated molecular mass of 90 kDa. Among the fungal enzyme structures characterized, the entire predicted amino acid sequence of P. carinii topoisomerase I is most similar to that of the Schizosaccharomyces pombe enzyme (54%) and least similar to that of the Candida albicans enzyme (48%) (Table 1). The predicted amino acid sequence of P. carinii topoisomerase I is 38% similar to that of the human enzyme (Table 1).



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 2. P. carinii TOP1 cDNA sequence. The cDNA coding sequence was determined by sequencing several cDNA library isolates twice in both directions. The sequences from the various fragments were aligned and displayed by using the Genetics Computer Group program package (27). Numbers to the right of the sequence represent the positions of the adjacent nucleotides or amino acids relative to thepresumed starting ATG or methionine, respectively. Underlined nucleotides locate degenerate PCR primers initially used for generation of the PCR probes from the genomic DNA template. The asterisk indicates the TAA stop codon, and the double underlining identifies the proposed enzyme active site tyrosine. The ATG at position 1 is identified as a likely translation start site on the basis of the protein's predicted molecular weight, as well as the presence of an enzymatically active gene product in in vivo and in vitro expression systems. This nucleotide sequence has been submitted to the GenBank database and issued accession number AFO61533.

The intervening sequences were determined by comparing the cDNA sequence to PCR products generated from genomic DNA. Unfortunately, depletion of the genomic DNA sample prevented us from obtaining the intervening sequences at the 5' end of the gene. We were, however, able to identify seven introns with lengths of 61, 45, 50, 46, 48, 43, and 44 bp, whose locations are shown in Fig. 1A. The position of each intron was confirmed by inspection of breaks in the reading frame and by the presence of a sequence similar to the conserved 5'[GTA(A/T)(C/G)(A/T)] and 3'[TAG] splice site sequences typical of fungal genes (19, 22).

P. carinii topoisomerase I is sensitive to potent human topoisomerase I poisons. In the presence of the prototypic topoisomerase poison CPT, the lifetime of the transient covalent calf thymus or human topoisomerase I DNA intermediate is significantly prolonged (47). Upon collision of this complex with the replication machinery, the enzyme becomes a cytotoxic molecule in vivo (33, 34). To determine whether P. carinii topoisomerase I can be similarly affected in vivo, a yeast cytotoxicity assay was utilized (26, 39). The P. carinii TOP1 cDNA was introduced into the single-copy yeast plasmid YCpGAL1 as described in Materials and Methods and expressed in the JN2-134 strain of S. cerevisiae (7, 45). The JN2-134 strain lacks a functional genomic copy of the topoisomerase I gene; thus, the only topoisomerase I activity expressed is from the gene carried by the plasmid. Figure 3 shows the results of the plating of serial fivefold dilutions of JN2-134 cells harboring YCpGAL1-hTOP1 and YCpGAL1-PcTOP1 (rows 1 and 2, respectively) on plates containing CPT. On the control plate, both strains grew at all of the dilutions used. At low CPT concentrations (0.05 µM), all of the dilutions of cells expressing the human TOP1 cDNA were killed while most of the dilutions of cells expressing the P. carinii enzyme grew. At a high CPT concentration (0.5 µM), both the cells expressing the human enzyme and those expressing the P. carinii enzyme were killed. Since cells carrying the YCpGAL1 plasmid with no topoisomerase insert survive in the presence and in the absence of CPT (45) and since topoisomerase I poisons only kill cells having a functional topoisomerase I enzyme (7), this experiment shows that (i) P. carinii topoisomerase I is a cytotoxic target for CPT in yeast, (ii) the expressed P. carinii topoisomerase I enzyme is functional, and (iii) the P. carinii enzyme displays decreased in vivo sensitivity to CPT compared with the human enzyme.

The enzyme activity of P. carinii topoisomerase I has been characterized previously with the purified protein isolated from P. carinii-infected rats (17). Here, the activity of P. carinii topoisomerase I was characterized by using the enzyme expressed from the pET11a plasmid in E. coli. The relaxation activity is compared with that of the human enzyme in Fig. 4. The P. carinii enzyme relaxes DNA to completion, again demonstrating that the enzyme is functionally similar to the human enzyme. In addition, P. carinii topoisomerase I relaxes supercoiled DNA to completion in the absence of Mg 2+ (Fig. 4), a property shared by all eukaryotic topoisomerase I enzymes.

Existing data show that there is a correlation among topoisomerase I, drug-induced DNA cleavage stimulation, and in vivo cytotoxicity (50). Therefore, the activity of P carinii topoisomerase I in a cleavage assay was determined. The cleavage patterns generated from P. carinii and human topoisomerase I in the presence of increasing concentrations of CPT or the bisbenzimidazole Hoechst 33342 (Ho33342) were compared. Consistent with the in vivo cytotoxicity data, P. carinii topoisomerase I displays less extensive cleavage in the presence of CPT than the human enzyme (Fig. 5). The cleavage stimulated by the fungal enzyme in the presence of CPT is approximately 10-fold less than that generated by human topoisomerase I, although equivalent units of activity were utilized. The decreased sensitivity of fungal topoisomerase I to CPT has been seen previously (7, 23, 26, 29, 45). These data suggest that although P. carinii and human topoisomerase I are functionally similar, sufficient differences in enzyme activity exist that the fungal enzyme can be utilized as a novel target for antifungal drug development.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 5. Comparison of P. carinii and human topoisomerase I (Topo I) cleavage patterns in the presence of CPT and Ho33342 (HO). Cleavage assays were carried out with human or P. carinii topoisomerase I as described in Materials and Methods. Reaction mixtures contained end-labeled, linearized YEpG plasmid DNA and the indicated drug concentrations. The no-enzyme control (DNA) and background cleavage (DNA + Topo I) controls were in lanes 1, 2, and 9, respectively. Samples were alkali denatured or loaded directly (rightmost four lanes) onto a 1% agarose gel and visualized following autoradiography of the dried gel. The micromolar concentrations of CPT and Ho33342 are shown above the lanes.

In the presence of Ho33342, the major fragments produced by both enzymes are the same but the extent of cleavage with the human enzyme is again greater. In addition, Ho33342-stimulated cleavage is inhibited at a high concentration (1.7 µM) with P. carinii topoisomerase I. This has been observed previously (12, 62) and is thought to be due to inhibition of enzyme binding to DNA secondary to occlusion of the DNA binding sites by the drug. Again, the cleavage stimulated by P. carinii in the presence of Ho33342 is approximately 10-fold less than the cleavage generated by the human enzyme, demonstrating a difference in drug sensitivity. The rightmost lanes of the gel (Fig. 5) show that the cleavage pattern generated was not the result of nuclease-mediated double-stranded cleavage, as no cleavage was observed when the gel was loaded under nondenaturing conditions.

Differential response of P. carinii topoisomerase I to potent human topoisomerase I poisons. Inhibition of P. carinii topoisomerase I catalytic activity by known topoisomerase I poisons has been reported previously (17). However, since cleavage stimulation correlates best with in vivo cytotoxicity (50), characterization of cleavage activity is necessary. Cleavage stimulation by a variety of structural classes of human topoisomerase I poisons is shown in Fig. 6. CPT was used as a positive control for P. carinii cleavage activity. Like cleavage by the human enzyme, cleavage by P. carinii topoisomerase I was not stimulated by the strong minor-groove binder berenil (1 to 10 µM; data not shown) or DAPI (Fig. 6). These data indicate that minor-groove binding is not the sole determinant of the enhanced cleavage activity of P. carinii topoisomerase I. The fungal enzyme was also insensitive to distamycin A, which moderately stimulates human topoisomerase I cleavage at the concentrations tested (12). DNA cleavage by the P. carinii enzyme was not stimulated in the presence of the potent human topoisomerase I poison nitidine. Coralyne, also a potent human topoisomerase I poison, produces a weak cleavage pattern at 2.5 µM. We showed in Fig. 5 that the bisbenzimidazole Ho33342 produced a strong cleavage pattern, similar to the experience with Aspergillus nidulans topoisomerase I (29). Similarly, the terbenzimidazole QS-II-48 (59), which greatly stimulated A. nidulans topoisomerase I cleavage (29), also stimulated P. carinii topoisomerase I-mediated cleavage. Thus, the formation of the P. carinii topoisomerase I-cleavable complex is enhanced by CPT and representative terbenzimidazoles and bisbenzimidazoles (Ho33342). In addition, like that mediated by Ho33342, QS-II-48- and coralyne-mediated cleavage was inhibited at higher drug concentrations.



View larger version (92K):
[in this window]
[in a new window]
 
FIG. 6. P. carinii topoisomerase I (Topo I) is resistant to several potent human topoisomerase I poisons. Cleavage assays were carried out as described in Materials and Methods and in the legend to Fig. 5 in the presence of CPT, coralyne (COR), DAPI, distamycin A (DIST), nitidine (NIT), and QS/II/48 at the indicated micromolar concentrations. The CPT lanes were used as a positive control. The no-enzyme (DNA) and background cleavage (DNA + Topo I) controls were in lanes 1 and 2, respectively.

Yeast cytotoxicity assays were performed to determine whether other classes of drugs are able to poison P. carinii topoisomerase I. Menogaril is a DNA intercalator with potent topoisomerase II poisoning activity. Nogalamycin differs in structure from menogaril only by the addition of a nogalose sugar but has potent topoisomerase I cleavage-stimulating activity (53). A mixed mode of binding, with both DNA intercalation and minor-groove binding is displayed by nogalamycin. In the yeast cytotoxicity assay, menogaril showed little poisoning activity compared with that of the control (Fig. 7). At 1 µM, nogalamycin also displayed little cytotoxicity. However, 10 µM nogalamycin was highly toxic to both the fungal and human enzymes in the yeast assay. Since the two compounds differ primarily in their modes of binding, the P. carinii topoisomerase I-cleavable complex may be stabilized preferentially by a mixed, as opposed to an intercalative, DNA binding mode. More specifically, the minor-groove binding component may optimize its interaction with P. carinii topoisomerase I, as demonstrated with the human enzyme (53).



View larger version (107K):
[in this window]
[in a new window]
 
FIG. 7. P. carinii topoisomerase I-mediated cytotoxicity with a mixed-mode DNA binding molecule. Yeast cytotoxicity assays were performed as described in Materials and Methods and the legend to Fig. 3. Plates contained the indicated concentrations of menogaril and nogalamycin, with the human enzyme expressed on the top row and the P. carinii enzyme on the bottom of each panel. The control plate contained galactose and no drug.

P. carinii topoisomerase I is not the target of pentamidine. Pentamidine has been used to treat PCP for many years. The cytotoxic target of this drug is unknown. It is known, however, that pentamidine binds tightly to the minor groove of A+T-rich DNA (20). Because a number of minor-groove binding agents are topoisomerase I poisons (11, 12, 69), it has been suggested that topoisomerase I is the molecular target of pentamidine. At concentrations ranging from 0 to 400 µM, pentamidine does not inhibit the P. carinii topoisomerase I-mediated relaxation of supercoiled DNA (Fig. 8; data not shown for the 0 to 100 µM concentration range). Pentamidine, at concentrations of 0.28 to 28 µM, also did not affect the cleavage activity of P. carinii topoisomerase I (Fig. 9). Compared with the CPT positive control, pentamidine did not stimulate cleavage by either the human or the P. carinii enzyme. No significant cleavage above the background can be seen in the presence of P. carinii topoisomerase I, but normal levels of background cleavage in the presence of the human enzyme appear to be inhibited by pentamidine. Thus, we may conclude that P. carinii topoisomerase I is not the molecular target of pentamidine and that the cytotoxicity experienced by patients treated with pentamidine is not likely to be due to poisoning of human topoisomerase I by the drug.



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 8. Pentamidine does not inhibit the catalytic activity of P. carinii topoisomerase I. Relaxation assays were carried out as described in Materials and Methods and the legend to Fig. 4. Control lanes 1 and 2 contained DNA and DNA with 0.4 mM pentamidine (PTD), respectively. Lanes 3 to 12 contained the indicated millimolar concentrations of pentamidine and P. carinii or human topoisomerase I, as marked. The positions of relaxed (R) and supercoiled (SC) DNAs are indicated to the left.



View larger version (92K):
[in this window]
[in a new window]
 
FIG. 9. Pentamidine does not stimulate topoisomerase I (Topo I)-mediated DNA cleavage. Cleavage assays were carried out as described in Materials and Methods and the legend to Fig. 5. Control lanes 1 and 2 contained DNA and DNA plus P. carinii topoisomerase I, respectively. Lanes 3 to 5 were positive controls containing DNA, P. carinii topoisomerase I, and CPT. Lanes 6 to 11 contained P. carinii or human (h) topoisomerase I, as marked, with the indicated micromolar concentrations of pentamidine (PENT).

Finally, we have characterized the activity of pentamidine in the yeast cytotoxicity assay. Yeast strains harboring the YCpGAL1-Sctop1Y727F, YCpGAL1-hTOP1, and YCpGAL1-PcTOP1 plasmids (Fig. 10, rows 1 to 3, respectively) were plated onto pentamidine-containing plates as described in Materials and Methods. Pentamidine was cytotoxic to all of the yeast transformants, including YCpGAL1-Sctop1Y727F, which contained catalytically inactive topoisomerase I. These data, combined with data obtained from the cleavage and relaxation assays, confirm that in yeast cells, neither human nor P. carinii topoisomerase I is the cytotoxic target of pentamidine.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 10. Pentamidine does not specifically target P. carinii topoisomerase I in a yeast cytotoxicity assay. The cytotoxicity assay was carried out as described in Materials and Methods and the legend to Fig. 3. Fivefold dilutions of the yeast strain containing plasmids YCpGAL1-Sctop1Y727F (top row), YCpGAL1-hTOP1 (middle row), and YCpGAL1-PcTOP1 (bottom row), respectively, were spotted onto complete minimal plates minus uracil and plus galactose and the indicated concentrations of pentamidine. The control plate contained galactose and no drug.


arrow
DISCUSSION
 
Developing resistance to a variety of sulfa-containing drugs has prompted the search for new antimicrobial agents with unique molecular targets. P. carinii is classified as a fungus on the basis of rRNA and other sequence homologies (57); however, the organism cannot be grown in long-term culture and its full life cycle is not known. Thus, careful characterization of specific drug targets in this organism requires cloning and expression of the target gene. Topoisomerases have been identified as potential targets for antifungal drug development on the basis of the utility of topoisomerase poisons in anticancer and antibacterial chemotherapy (44, 52, 54). Since these enzymes are present in all eukaryotic cell types, selective inhibition of the fungal topoisomerase by the drug is a required condition for utility as an antifungal agent. Preliminary observations with several classes of agents suggest that it may be possible to meet this condition (18, 23, 24, 29, 39, 45). However, understanding the specific properties of various fungal topoisomerases is required before serious drug development targeting these systems can be productive.

We have cloned and sequenced the P. carinii topoisomerase I cDNA and more than half of the structural gene and report the expression of the protein in E. coli and yeast. The gene for P. carinii topoisomerase I codes for a 763-amino-acid protein. Among the currently known fungal topoisomerase I amino acid sequences, the P. carinii topoisomerase I sequence is most similar to that of S. pombe topoisomerase I and least similar to that of C. albicans (Table 1). The similarity of the P. carinii and other fungal topoisomerase I sequences to the human enzyme is some 10 to 15% lower than their similarity to other fungal sequences, but the domain structure (49, 55) typical of the human enzyme is well preserved. A pileup of the fungal sequences compared with the human sequences shows first that the sequences of the catalytically important core and C-terminal domains are highly conserved among the fungi but are less similar to the human sequence. Second, the fungi have linker domains that are some 70 amino acids longer than the human linker domains and much more closely related to those of other fungi than to those of humans (data not shown).

We believe that the topoisomerase I gene product characterized here is the major or only one in the organism for the following reasons. First, a cDNA library (~250,000 colonies were screened) was the source of the nine isolates used to determine the sequence of P. carinii topoisomerase I. This suggests that we have characterized the main transcript present in the P. carinii mRNA preparation but does not rule out the presence of minor transcripts from another gene. Second, the PCR approach taken with the genomic DNA should have identified other homologous related genes if they were present either as heterogeneously sized PCR products or as heterogeneities in the sequences of the products. The first two fragments of the genomic DNA isolated by PCR were from domains of the TOP1 gene that are quite homologous (but not totally identical) in other organisms. Third, the data presented by Dykstra et al. (17, 18) show that topoisomerase I was isolated as a single peak of activity, suggesting that it was the major, if not the only, species present.

Purification of the expressed P. carinii topoisomerase I protein has allowed the characterization of drug effects previously not possible with the limited quantity of the enzyme obtained from rat model infection systems. The prototype topoisomerase I poison CPT does induce considerable cleavage of linear DNA in the presence of P. carinii topoisomerase I (Fig. 5). It has previously been shown to cause toxicity to P. carinii in culture (13, 15, 21), and our data demonstrate that topoisomerase I is the target of CPT cytotoxicity in yeast expressing the P. carinii enzyme (Fig. 3). The P. carinii topoisomerase I enzyme is apparently similar to the S. cerevisiae, A. nidulans, and C. albicans enzymes in that all of the fungal enzymes that have been characterized are 5- to 10-fold less sensitive to CPT than is human topoisomerase I, both in purified enzyme preparations and in the yeast cytotoxicity assay (Fig. 3 and 5) (7, 23, 26, 29, 45).

Both the bisbenzimidazole Ho33342 and the terbenzimidazole QS-II-48 are potent human topoisomerase I poisons (12, 59, 69). Both also strongly stimulate DNA cleavage by P. carinii topoisomerase I (Fig. 5 and 6). This is similar to findings with the A. nidulans enzyme (29), where these 2,5'-linked benzimidazole derivatives were substantially more active in stimulating DNA cleavage than they were with the human enzyme. Another topoisomerase I poison shown to target P. carinii topoisomerase I in the yeast cytotoxicity assay is nogalamycin (Fig. 7). In contrast to the strong P. carinii topoisomerase I-poisoning activity obtained with the benzimidazoles and nogalamycin, no poisoning was seen with coralyne or nitidine (Fig. 6), both of which are potent human topoisomerase I poisons (26, 46). Coralyne (and other protoberberines) are also inactive against both the A. nidulans and S. cerevisiae topoisomerase I enzymes (26, 29). The specificity and activity characteristics of these various drug classes in poisoning P. carinii topoisomerase I are generally consistent with previously reported findings on fungal topoisomerase I enzymes compared with the human enzyme (23, 24, 29), namely, that significant drug specificity differences do exist.

With the exception of CPT derivatives and the several anti-Candida drugs characterized by Fostel and coworkers, the topoisomerase I poisons discussed above are cationic drugs that bind in the minor groove of DNA (12, 46, 69). The correlation between minor-groove binding and topoisomerase I poisoning activity has been noted with terbenzimidazoles (69) and other drug classes (11, 12, 59), although it is clear that strong minor-groove binding behavior is not the sole determinant for topoisomerase I poisoning activity, as several well-known minor-groove binding agents, including berenil and netropsin, show little or no activity as topoisomerase I poisons (reviewed in reference 46). A number of additional classes of biscationic DNA binding compounds have been synthesized and found to demonstrate cytotoxicity against P. carinii in rat models of PCP. These include substituted bisbenzimidazoles linked 2,2' through alkyl groups (65), various derivatives of pentamidine (25, 64), diarylfurans (8), and carbazoles (60). It has been suggested, on the basis of their cytotoxicity for P. carinii and their minor-groove binding properties (4, 20), that some or all of these compounds act by poisoning or inhibiting topoisomerase I or II. Reports of inhibition of calf thymus topoisomerase activity for 2,2'-alkyl-linked bisbenzimidazoles and diarylfurans (8, 17) have seemed to support these speculations. However, direct inhibition (poisoning) of P. carinii topoisomerase activity has not been demonstrated for 2,2'-alkyl-linked bisbenzimidazoles, diarylfurans, or pentamidine-related derivatives.

The unanswered questions regarding the cytotoxic mechanism(s) of pentamidine led us to investigate whether this clinically used anti-P. carinii drug is a topoisomerase I poison. Our results have excluded topoisomerase I as a possible molecular target of pentamidine. Pentamidine neither inhibits the catalytic activity of P. carinii (or human) topoisomerase I (Fig. 8) nor enhances the cleavage of linear DNA (Fig. 9). Additionally, pentamidine was toxic to yeast strains containing no functional topoisomerase I (Fig. 10), indicating that another cytotoxic target exists. One suggested cytotoxic target of pentamidine and several other biscationic minor-groove binding drugs is topoisomerase II (5, 8, 18). In addition, pentamidine has been suggested to block the splicing of group I introns in P. carinii, C. albicans, and S. cerevisiae cells (41, 43).


arrow
ACKNOWLEDGMENTS
 
We are indebted to Regina Felder for assistance with DNA sequencing in the Robert Wood Johnson Medical School DNA Synthesis and Sequencing Laboratory, to Hong Yan Wu for making the oligonucleotides, and to Chiang Yu for advice on the purification of P. carinii topoisomerase I.

Rukiyah Van Dross was supported by a grant from the Minority Advancement Program of Rutgers University and a training grant from the National Institutes of Health (IR25 GM55145).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pharmacology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, 675 Hoes Ln., Piscataway, NJ 08854. Phone: (732) 235-4593. Fax: (732) 235-4073. E-mail: msanders{at}umdnj.edu. Back

{dagger} Present address: Department of Pathology, University of Kansas Medical Center, Kansas City, KS 66160. Back


arrow
REFERENCES
 
    1
  1. Alsner, J., J. Q. Svejstrup, E. Kjeldsen, B. S. Sorensen, and O. Westergaard. 1992. Identification of an N-terminal domain of eukaryotic DNA topoisomerase I dispensable for catalytic activity but essential for in vivo function. J. Biol. Chem. 267:12408-12411.[Abstract/Free Full Text]
  2. 2
  3. Anonymous. 1997. 1997 USPHS/IDSA guidelines for the prevention of opportunistic infections in persons infected with the human immunodeficiency virus. Morb. Mortal. Wkly. Rep. 46:1-46.[Medline]
  4. 3
  5. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1994. Current protocols in molecular biology. John Wiley & Sons, Inc., Boston, Mass.
  6. 4
  7. Bell, C. A., M. Cory, T. A. Fairley, J. E. Hall, and R. R. Tidwell. 1991. Structure-activity relationships of pentamidine analogs against Giardia lamblia and correlation of antigiardial activity with DNA-binding affinity. Antimicrob. Agents Chemother. 35:1099-1107.[Abstract/Free Full Text]
  8. 5
  9. Bell, C. A., C. C. Dykstra, N. A. Naiman, M. Cory, T. A. Fairley, and R. R. Tidwell. 1993. Structure-activity studies of dicationically substituted bis-benzimidazoles against Giardia lamblia: correlation of antigiardial activity with DNA binding affinity and giardial topoisomerase II inhibition. Antimicrob. Agents Chemother. 37:2668-2673.[Abstract/Free Full Text]
  10. 6
  11. Bertrand, R., E. Solary, J. Jenkins, and Y. Pommier. 1993. Apoptosis and its modulation in human promyelocytic HL-60 cells treated with DNA topoisomerase I and II inhibitors. Exp. Cell Res. 207:388-397.[CrossRef][Medline]
  12. 7
  13. Bjornsti, M.-A., P. Benedetti, G. A. Viglianti, and J. C. Wang. 1989. Expression of human DNA topoisomerase I in yeast cells lacking yeast DNA topoisomerase I: restoration of sensitivity of the cells to the antitumor drug camptothecin. Cancer Res. 49:6318-6323.[Abstract/Free Full Text]
  14. 8
  15. Boykin, D. W., A. Kumar, J. Spychala, M. Zhou, R. J. Lombardy, W. D. Wilson, C. C. Dykstra, S. K. Jones, J. E. Hall, R. R. Tidwell, C. Laughton, C. M. Nunn, and S. Neidle. 1995. Dicationic diarylfurans as anti-Pneumocystis carinii agents. J. Med. Chem. 38:912-916.[CrossRef][Medline]
  16. 9
  17. Champoux, J. J. 1994. Mechanism of catalysis by eukaryotic DNA topoisomerase I. Adv. Pharmacol. 29A:71-82.[Medline]
  18. 10
  19. Chen, A. Y., and L. F. Liu. 1994. DNA topoisomerases: essential enzymes and lethal targets. Annu. Rev. Pharmacol. Toxicol. 34:191-218.[CrossRef][Medline]
  20. 11
  21. Chen, A. Y., C. Yu, A. Bodley, L. F. Peng, and L. F. Liu. A new mammalian DNA topoisomerase I poison Hoechst 33342: cytotoxicity and drug resistance in human cell cultures. Cancer Res. 53:1332-1337.
  22. 12
  23. Chen, A. Y., C. Yu, B. Gatto, and L. F. Liu. 1993. DNA minor groove-binding ligands: a different class of mammalian DNA topoisomerase I inhibitors. Proc. Natl. Acad. Sci. USA 90:8131-8135.[Abstract/Free Full Text]
  24. 13
  25. Cirioni, O., A. Giacometti, M. Quarta, and G. Scalise. 1997. In vitro activity of topoisomerase inhibitors against Pneumocystis carinii. J. Antimicrob. Chemother. 40:583-586.[Abstract/Free Full Text]
  26. 14
  27. Corbett, A. H., and N. Osheroff. 1993. When good enzymes go bad: conversion of topoisomerase II to a cellular toxin by antineoplastic drugs. Chem. Res. Toxicol. 6:585-597.[CrossRef][Medline]
  28. 15
  29. Cushion, M. T., F. Chen, and N. Kloepher. 1997. A cytotoxicity assay for evaluation of candidate anti-Pneumocystis carinii agents. Antimicrob. Agents Chemother. 41:379-384.[Abstract/Free Full Text]
  30. 16
  31. D'Arpa, P., P. S. Machlin, I. H. Ratrie, N. F. Rothfield, D. W. Cleveland, and W. C. Earnshaw. 1988. cDNA cloning of human DNA topoisomerase I: catalytic activity of a 67.7-kDa carboxyl-terminal fragment. Proc. Natl. Acad. Sci. USA 85:2543-2547.
  32. 17
  33. Dykstra, C. C., D. R. McClernon, L. P. Elwell, and R. R. Tidwell. 1994. Selective inhibition of topoisomerases from Pneumocystis carinii compared with that of topoisomerases from mammalian cells. Antimicrob. Agents Chemother. 38:1890-1898.[Abstract/Free Full Text]
  34. 18
  35. Dykstra, C. C., and R. R. Tidwell. 1991. Inhibition of topoisomerases from Pneumocystis carinii by aromatic dicationic molecules. J. Protozool. 38:78S-81S.[Medline]
  36. 19
  37. Edman, U., J. C. Edman, B. Lundgren, and D. V. Santi. 1989. Isolation of the Pneumocystis carinii thymidylate synthase gene. Proc. Nat. Acad. Sci. USA 86:6503-6507.[Abstract/Free Full Text]
  38. 20
  39. Edwards, K. J., T. C. Jenkins, and S. Neidle. 1992. Crystal structure of a pentamidine-oligonucleotide complex: implications for DNA-binding properties. Biochemistry 31:7104-7109.[CrossRef][Medline]
  40. 21
  41. Fishman, J. A., S. F. Queener, R. S. Roth, and M. S. Bartlett. 1993. Activity of topoisomerase inhibitors against Pneumocystis carinii in vitro and in an inoculated mouse model. Antimicrob. Agents Chemother. 37:1543-1546.[Abstract/Free Full Text]
  42. 22
  43. Fletcher, L. D., L. C. Berger, S. A. Peel, R. S. Baric, R. R. Tidwell, and C. C. Dykstra. 1993. Isolation of six Pneumocystis carinii genes utilizing codon bias. Gene 129:167-174.[CrossRef][Medline]
  44. 23
  45. Fostel, J., and D. Montgomery. 1995. Identification of the aminocatechol A-3253 as an in vitro poison of DNA topoisomerase I from Candida albicans. Antimicrob. Agents Chemother. 39:586-592.[Abstract/Free Full Text]
  46. 24
  47. Fostel, J., D. Montgomery, and P. Lartey. 1996. Comparison of responses of DNA topoisomerase I from Candida albicans and human cells to four new agents which stimulate topoisomerase-dependent DNA nicking. FEMS Microbiol. Lett. 138:105-111.[CrossRef][Medline]
  48. 25
  49. Fujii, N., Y. Yamashita, Y. Saitoh, and H. Nakano. 1993. Induction of mammalian DNA topoisomerase I-mediated DNA cleavage and DNA winding by bulgarein. J. Biol. Chem. 268:13160-13165.[Abstract/Free Full Text]
  50. 26
  51. Gatto, B., M. M Sanders, C. Yu, H-Y. Wu, D. Makhey, E. J. LaVoie, and L. F. Liu. 1996. Identification of topoisomerase I as the cytotoxic target of the protoberberine alkaloid coralyne. Cancer Res. 56:2795-2800.[Abstract/Free Full Text]
  52. 27
  53. Genetics Computer Group. 1994. Program manual for the Wisconsin Package. Genetics Computer Group, Madison, Wis.
  54. 28
  55. Gietz, R. D., and R. H. Schiestl. 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol. 5:255-269.
  56. 29
  57. Goldman, G. H., C. Yu, H.-Y. Wu, M. M. Sanders, E. J. LaVoie, and L. F. Liu. 1997. Differential poisoning of human and Aspergillus nidulans DNA topoisomerase I by bi- and terbenzimidazoles. Biochemistry 36:6488-6494.[CrossRef][Medline]
  58. 30
  59. Gupta, M., A. Fujimori, and Y. Pommier. 1995. Eukaryotic DNA topoisomerases I. Biochim. Biophys. Acta 1262:1-14.[Medline]
  60. 31
  61. Helweg-Larsen, J., T. L. Genfield, J. Eugen-Olsen, J. D. Lundgren, and B. Lundgren. 1999. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia. Lancet 354:1347-1351.[CrossRef][Medline]
  62. 32
  63. Holm, C., J. M. Covey, D. A. Kerrigan, and Y. Pommier. 1989. Differential requirement of DNA replication for the cytotoxicity of DNA topoisomerase I and II inhibitors in Chinese hamster DC3F cells. Cancer Res. 49:6365-6368.[Abstract/Free Full Text]
  64. 33
  65. Hsiang, Y. H., R. Hertzberg, S. Hecht, and L. F. Liu. 1985. Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260:14873-14878.[Abstract/Free Full Text]
  66. 34
  67. Hsiang, Y. H., L. F. Liu, M. E. Wall, M. C. Wani, S. Kirschenbaum, R. Silber, and M. Potmesil. 1989. DNA topoisomerase I-mediated DNA cleavage and cytotoxicity of camptothecin analogs. Cancer Res. 49:4385-4389.[Abstract/Free Full Text]
  68. 35
  69. Jacobson, M. A., and M. French. 1998. Altered natural history of AIDS-related opportunistic infections in the era of potent combination antiretroviral therapy. AIDS 12(Suppl. A):S157-S163.[Medline]
  70. 36
  71. Kazanjian, O., A. B. Locke, P. A. Hossler, B. R. Lane, M. S. Barlett, J. W. Smith, M. Cannon, and S. R. Meshnick. 1998. Dihydropteroate synthase mutations in Pneumocystis carinii associated with sulfa prophylaxis failures. AIDS 12:873-878.[CrossRef][Medline]
  72. 37
  73. Kazanjian, P., W. Armstrong, P. A. Hossler, W. Burman, J. Richardson, C. H. Lee, L. Crane, J. Katz, and S. R. Meshnick. 2000. Pneumocystis carinii mutations are associated with duration of sulfa or sulfone prophylaxis exposure in AIDS patients. J. Infect. Dis. 182:1192-1198.[CrossRef][Medline]
  74. 38
  75. Kim, R. A., and J. C. Wang. 1989. A subthreshold level of DNA topoisomerases leads to the excision of yeast rDNA as extrachromosomal rings. Cell 57:975-985.[CrossRef][Medline]
  76. 39
  77. Knab, A. M., J. Fertala and M.-A. Bjornsti. 1993. Mechanisms of camptothecin resistance in yeast DNA topoisomerase I mutants. J. Biol. Chem. 268:22322-22330.[Abstract/Free Full Text]
  78. 40
  79. Liu, L. F., and K. G. Miller. 1981. Eukaryotic DNA topoisomerases: two forms of type I DNA topoisomerases from HeLa cell nuclei. Proc. Natl. Acad. Sci. USA 78:3487-3491.[Abstract/Free Full Text]
  80. 41
  81. Liu, Y., R. R. Tidwell, and M. J. Leibowitz. 1994. Inhibition of in vitro splicing of a group I intron of Pneumocystis carinii. J. Eukaryot. Microbiol. 41:31-38.[Medline]
  82. 42
  83. Mei, Q., S. Gurunathan, H. Masur, and J. A. Kovacs. 1998. Failure of co-trimoxazole in Pneumocystis carinii infection and mutations in dihydropteroate synthase gene. Lancet 351:1631-1632.[Medline]
  84. 43
  85. Miletti, K. E., and M. J. Leibowitz. 2000. Pentamidine inhibition of group I intron splicing in Candida albicans correlates with growth inhibition. Antimicrob. Agents Chemother. 44:958-966.[Abstract/Free Full Text]
  86. 44
  87. Neu, H. C. 1994. Major advances in antibacterial quinolone therapy. Adv. Pharmacol. 29A:227-262.[Medline]
  88. 45
  89. Nitiss, J., and J. C. Wang. 1988. DNA topoisomerase-targeting antitumor drugs can be can be studied in yeast. Proc. Natl. Acad. Sci. USA 85:7501-7505.[Abstract/Free Full Text]
  90. 46
  91. Pilch, D. S., C. Yu, D. Makhey, E. J. LaVoie, A. R. Srinvasan, W. K. Olson, R. R. Sauers, K. J. Breslauer, N. E. Geacintov, and L. F. Liu. 1997. Minor groove-directed and intercalative ligand-DNA interactions in the poisoning of human DNA topoisomerase I by protoberberine analogs. Biochemistry 36:12542-12553.[CrossRef][Medline]
  92. 47
  93. Porter, S. E., and J. J. Champoux. 1998. The basis for camptothecin enhancement of DNA breakage by eukaryotic topoisomerase I. Nucleic Acids Res. 17:8521-8532.
  94. 48
  95. Queener, S. F. 1995. New Drug Developments for opportunistic infections in immunosuppressed patients: Pneumocystis carinii. J. Med. Chem. 38:4739-4759.[CrossRef][Medline]
  96. 49
  97. Redinbo, M. R., L. Stewart, P. Kuhn, J. J. Champoux, and W. G. Hol. 1998. Crystal structure of human topoisomerase I in covalent and noncovalent complexes with DNA. Science 279:1504-1513.[Abstract/Free Full Text]
  98. 50
  99. Rowe, T., G. Kupfer, and W. Ross. 1985. Inhibition of epipodophyllotoxin cytotoxicity by interference with topoisomerase-mediated DNA cleavage. Biochem. Pharmacol. 34:2483-2487.[CrossRef][Medline]
  100. 51
  101. Shapiro, T. A. 1994. Drugs affecting trypanosome topoisomerases. Adv. Pharmacol. 28B:187-200.
  102. 52
  103. Shen, L. L., J. Baranowski, J. Fostel, D. A. Montgomery, and P. A. Lartey. 1992. DNA topoisomerases from pathogenic fungi: targets for the discovery of antifungal drugs. Antimicrob. Agents Chemother. 36:2778-2784.[Abstract/Free Full Text]
  104. 53
  105. Sim, S.-P., B. Gatto, C. Yu, A. A. Liu, T.-K. Li, D. S. Pilch, E. J. LaVoie, and L. F. Liu. 1997. Poisoning of topoisomerases by menogaril and nogalamycin dictated by the minor groove-binding nogalose sugar. Biochemistry 36:13285-13291.[CrossRef][Medline]
  106. 54
  107. Sinha, B. K. 1995. Topoisomerase inhibitors: a review of their therapeutic potential in cancer. Drugs 49:11-19.[Medline]
  108. 55
  109. Stewart, L., G. C. Ireton, and J. J. Champoux. 1996. The domain organization of human topoisomerase I. J. Biol. Chem. 271:7602-7608.[Abstract/Free Full Text]
  110. 56
  111. Stewart, L., M. R. Redinbo, X. Qiu, W. G. Hol, and J. J. Champoux. 1998. A model for the mechanism of human topoisomerase I. Science 279:1534-1541.[Abstract/Free Full Text]
  112. 57
  113. Stringer, J. R. 1996. Pneumocystis carinii: what is it, exactly? Clin. Microbiol. Rev. 9:489-498.[Abstract/Free Full Text]
  114. 58
  115. Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89.[Medline]
  116. 59
  117. Sun, Q., B. Gatto, C. Yu, A. Liu, L. F. Liu, and E. J. LaVoie. 1995. Synthesis and evaluation of terbenzimidazoles as topoisomerase I inhibitors. J. Med. Chem. 38:3638-3644.[CrossRef][Medline]
  118. 60
  119. Tanious, F. A., D. Ding, D. A. Patrick, R. R. Tidwell, and W. D. Wilson. 1997. A new type of DNA minor-groove complex: carbazole dication-DNA interactions. Biochemistry 36:15315-15325.[CrossRef][Medline]
  120. 61
  121. Taylor, A., K. Giles, A. V. Sarthy, T. McGonigal, and J. Fostel. 1996. Identification of the gene encoding DNA topoisomerase I from Candida albicans. FEMS Microbiol. Lett. 138:113-121.[CrossRef][Medline]
  122. 62
  123. Tewey, K. M., T. C. Rowe, L. Yang, B. D. Halligan, and L. F. Liu. 1984. Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science 226:466-468.[Abstract/Free Full Text]
  124. 63
  125. Thrash, C., A. T. Bankier, B. G. Barrell, and R. Sternglanz. 1985. Cloning, characterization and sequence of the yeast DNA topoisomerase I gene. Proc. Natl. Acad. Sci. USA 82:4374-4378.[Abstract/Free Full Text]
  126. 64
  127. Tidwell, R. R., S. K. Jones, J. D. Geratz, K. A. Ohemeng, M. Cory, and J. E. Hall. 1990. Analogs of 1,5-bis(4-amidinophenoxy)pentane (pentamidine) in the treatment of experimental Pneumocystis carinii pneumonia. J. Med. Chem. 33:1252-1257.[CrossRef][Medline]
  128. 65
  129. Tidwell, R. R., S. K. Jones, N. A. Naiman, L. C. Berger, W. B. Brake, C. C. Dykstra, and J. E. Hall. 1993. Activity of cationically substituted bis-benzimidazoles against experimental Pneumocystis carinii pneumonia. Antimicrob. Agents Chemother. 37:1713-1716.[Abstract/Free Full Text]
  130. 66
  131. Tobey, R. A. 1972. A simple, rapid technique for determination of the effects of chemotherapeutic against on mammalian cell-cycle traverse. Cancer Res. 32:309-316.[Abstract/Free Full Text]
  132. 67
  133. Uemura, T., K. Morino, S. Uzana, K. Shiozaki, and M. Yanagida. 1987. Cloning and sequencing of Schizosaccharomyces pombe DNA topoisomerase I gene, and effect of gene disruption. Nucleic Acids Res. 15:9727-9739.[Abstract/Free Full Text]
  134. 68
  135. Van Dross, R. T., K. V. Rao, E. Eisenberg, and M. M. Sanders. 1997. Cloning and characterization of the Aspergillus nidulans DNA topoisomerase I gene. Gene 203:169-174.[CrossRef][Medline]
  136. 69
  137. Xu, Z., T.-K. Li, J. S. Kim, E. J. LaVoie, K. J. Breslauer, L. F. Liu, and D. S. Pilch. 1998. DNA minor groove binding-directed poisoning of human DNA topoisomerase I by terbenzimidazoles. Biochemistry 37:3558-3566.[CrossRef][Medline]


Antimicrobial Agents and Chemotherapy, July 2002, p. 2145-2154, Vol. 46, No. 7
0066-4804/02/$04.00+0     DOI: 10.1128/AAC.46.7.2145-2154.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Mukherjee, P. K., Sheehan, D. J., Hitchcock, C. A., Ghannoum, M. A. (2005). Combination Treatment of Invasive Fungal Infections. Clin. Microbiol. Rev. 18: 163-194 [Abstract] [Full Text]  
  • Cushion, M. T., Walzer, P. D., Collins, M. S., Rebholz, S., Vanden Eynde, J. J., Mayence, A., Huang, T. L. (2004). Highly Active Anti-Pneumocystis carinii Compounds in a Library of Novel Piperazine-Linked Bisbenzamidines and Related Compounds. Antimicrob. Agents Chemother. 48: 4209-4216 [Abstract] [Full Text]  
  • Yakovleva, L., Handy, C. J., Sayer, J. M., Pirrung, M., Jerina, D. M., Shuman, S. (2004). Benzo[c]phenanthrene Adducts and Nogalamycin Inhibit DNA Transesterification by Vaccinia Topoisomerase. J. Biol. Chem. 279: 23335-23342 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Dross, R. T.
Right arrow Articles by Sanders, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Dross, R. T.
Right arrow Articles by Sanders, M. M.