Previous Article | Next Article 
Antimicrobial Agents and Chemotherapy, January 2003, p. 196-203, Vol. 47, No. 1
0066-4804/03/$08.00+0 DOI: 10.1128/AAC.47.1.196-203.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Comparative Molecular Analysis of Community- or Hospital-Acquired Methicillin-Resistant Staphylococcus aureus
P. D. Fey,1,2* B. Saïd-Salim,3 M. E. Rupp,1 S. H. Hinrichs,2 D. J. Boxrud,4 C. C. Davis,5 B. N. Kreiswirth,3 and P. M. Schlievert6
Department of Internal Medicine,1
the Nebraska Public Health Laboratory, Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, Nebraska,2
Acute Disease Epidemiology Section and the Division of Public Health Laboratories, Minnesota Public Health Laboratory,4
Department of Microbiology, University of Minnesota Medical School, Minneapolis, Minnesota,6
FemCare Microbiology Product Safety and Regulatory Affairs, The Procter & Gamble Company, Cincinnati, Ohio,5
Public Health Research Institute, Newark, New Jersey3
Received 22 July 2002/
Returned for modification 2 September 2002/
Accepted 21 October 2002

ABSTRACT
Community-acquired methicillin-resistant
Staphylococcus aureus (CA-MRSA) is a growing public health concern that has been associated
with pediatric fatalities. It is hypothesized that the evolution
of CA-MRSA is a recent event due to the acquisition of
mec DNA
by previously methicillin-susceptible strains that circulated
in the community. This study investigated the genetic relatedness
between CA-MRSA, hospital-associated MRSA (HA-MRSA), and nonmenstrual
toxic shock syndrome (nmTSS) isolates. Thirty-one of 32 CA-MRSA
isolates were highly related as determined by pulsed-field gel
electrophoresis and
spa typing yet were distinguishable from
32 HA-MRSA strains. The 31 related CA-MRSA isolates produced
either staphylococcal enterotoxin B (
n = 5) or C (
n = 26), and
none made TSS toxin 1. All CA-MRSA isolates tested contained
a type IV staphylococcal cassette chromosome
mec (SCC
mec) element.
In comparison, none of the HA-MRSA isolates (
n = 32) expressed
the three superantigens. Antibiotic susceptibility patterns
were different between the CA-MRSA and HA-MRSA isolates; CA-MRSA
was typically resistant only to ß-lactam antibiotics.
Six of twenty-one nmTSS isolates were indistinguishable or highly
related to the CA-MRSA isolates. MnCop, an nmTSS isolate obtained
in Alabama in 1986, was highly related to the CA-MRSA isolates
except that it did not contain an SCC
mec element. These data
suggest that CA-MRSA strains may represent a new acquisition
of SCC
mec DNA in a previously susceptible genetic background
that was capable of causing nmTSS. CA-MRSA poses a serious health
risk not only because it is resistant to the antibiotics of
choice for community-acquired staphylococcal infections but
also because of its ability to cause nmTSS via superantigen
production.

INTRODUCTION
Staphylococcus aureus is a versatile human pathogen causing
infections ranging from relatively mild involvement of skin
and soft tissue to life- threatening sepsis, pneumonia, and
toxic shock syndrome (TSS). The organism causes illness through
production of numerous cell surface and secreted virulence factors,
and disease is facilitated by its propensity to develop resistance
to multiple antibiotics (
8,
39). Infections in the community
and hospital settings are common.
Among the secreted virulence factors of S. aureus are the superantigen toxins (SAgs), which include TSS toxin 1 (TSST-1) and staphylococcal enterotoxin (SE) serotypes A to Q (SEA to SEQ), excluding F (11, 22). These toxins cause TSS and related illnesses through their capacity to induce massive cytokine release both from macrophages and T cells (18, 22). Despite high variability in primary amino acid sequences, the SAgs are related in three-dimensional structures (18, 21, 22).
Another attribute of S. aureus, which complicates treatment, is resistance to multiple antibiotics (39). Nearly all isolates today in the United States are resistant to penicillin through production of ß-lactamases. In recent years, more than 50% of hospital-associated (HA) S. aureus isolates were resistant to all ß-lactam antibiotics (including methicillin and oxacillin) through the production of an altered penicillin binding protein, PBP2a (31). HA methicillin-resistant S. aureus (HA-MRSA) isolates are also typically resistant to multiple, non-ß-lactam antibiotics (8, 39). In addition, the first report of vanA-mediated vancomycin-resistant S. aureus was recently published (6).
Recently, the appearance of community-acquired MRSA (CA-MRSA) strains has been described (5, 14, 15, 24). In contrast to HA-MRSA, these strains are commonly susceptible to the majority of other non-ß-lactam antistaphylococcal antibiotics and have a common pulsed-field gel electrophoresis (PFGE) pattern. Baba and colleagues have recently sequenced the entire genome of one CA-MRSA isolate (strain MW2; called C99-459 in the present study) obtained from North Dakota in 1998 (1, 5). The sequence analysis identified a type IVa staphylococcal cassette chromosome mec (SCCmec) element and 19 virulence genes, including SEC and SEH and panton-valentine leukocidin. The type IV SCCmec element is much smaller than both SCCmec types II and III and similar in size to the archaic SCCmec type I. In contrast to the archaic SCCmec type, which harbors an altered ccrB1 gene, the recombinases are wild type in the type IV SCCmec, possibly explaining its apparent movement. SCCmec type IV has been found in at least four different genomic backgrounds, suggesting the ease at which it may transfer compared to types I, II, and III (1, 20, 29).
In December 1998, the Nebraska Health and Human Services System was notified regarding an apparent increase in laboratory-confirmed CA-MRSA infections in a rural Nebraska county containing a community of Native Americans. This study was undertaken to compare a group of CA-MRSA with respect to their clonal relatedness and SAg production to HA-MRSA and to S. aureus strains from nonmenstrual TSS (nmTSS) patients from 1986 to the present.

MATERIALS AND METHODS
Strain collection.
The strains used in the study are listed in Tables
1 to 3. One
hospital serves as the major health care provider to the Native
American residents, and one laboratory provided routine microbiologic
testing for the hospital. Thirty-two CA-MRSA isolates from individual
patients were obtained for further study (Table
1). All CA-MRSA
isolates collected were isolated in 1998. CA-MRSA was defined
as those MRSA isolates identified by the laboratory as collected
from outpatients. In addition, 32 HA-MRSA isolates from individual
patients were collected at random (two or three per month) from
the University of Nebraska Medical Center (UNMC), Omaha, during
1998 (Table
2). This represents 40% of the total MRSA isolates
collected at UNMC in 1998. These isolates were collected from
patients whose infections occurred at least 3 days after they
were admitted into the hospital. UNMC is distinct from the hospital
that serves the Native American residents, which is in a rural
area approximately 100 miles from Omaha. An additional 21
S. aureus isolates collected throughout the United States from
nmTSS cases, most of which produced either SEB or SEC, were
compared with the aforementioned isolates (Table
3). Eighteen
of these 21 isolates contained SCC
mec. Both
S. aureus COL and
NCTC8325 were used as reference strains (Table
3).
Microbiologic and molecular methods.
Antimicrobial susceptibility testing was performed using disk
diffusion methodology according to NCCLS methodology (
25). Resistance
to oxacillin was confirmed by amplifying a 1,026-bp
mecA fragment
using the following primers: forward, 5' GGGTACAAGATGATACC 3';
and reverse, 5' GGTGCGTTAATATTGCC 3'. Primers and conditions
used to amplify
seb,
sec, and
seh have been previously described
(
23). The primers (designed from the
S. aureus MW2 genomic sequence
[
1]) used to amplify a 1,554-bp region from
lukS-PV and
lukF-PV were as follows: forward, 5' GGCCTTTCCAATACAATATTGG 3'; and
reverse, 5' CCCAATCAACTTCATAAATTG 3'. A 183-bp portion of a
truncated
seo was amplified by using the following primers:
forward, 5' GTATGATTCGGAAACTGGAG 3'; and reverse, 5' CTTGTTAAACAAATAGATATC
3' (
1). PFGE was performed according to previously described
methods (
2). PFGE patterns were analyzed using Bionumerics software
(Applied Maths, Kortrijk, Belgium) with a 1% molecular weight
position tolerance.
spa typing and SCC
mec typing were performed
using the protocols described previously by Shopsin et al. (
37)
and Oliveira et al. (
27), respectively. Southern blotting was
performed using standard methods (
34). Primers used to amplify
gyrA are previously described (
13).
mecA and
gyrA DNA probes
were prepared using digoxigenin-labeled dideoxy-UTP (Roche,
Indianapolis, Ind.) and the primers listed above. TSST-1, SEB,
and SEC production was assessed by a double-immunodiffusion
assay (
35). All isolates were verified as being positive or
negative for
seb or
sec by PCR using primers described by Monday
et al. (
23).

RESULTS
Antimicrobial resistance and SAg typing of MRSA.
Table
1 shows the antimicrobial susceptibility pattern for the
32 CA-MRSA isolates (identified with the REF prefix). Twenty-six
of 32 isolates (81%) were resistant only to penicillin and oxacillin
(methicillin). Methicillin resistance was confirmed by PCR in
all isolates. Four of 32 isolates (13%) were resistant to erythromycin,
while two isolates (6%) were resistant to clindamycin. An additional
two isolates were resistant to ciprofloxacin (6%). No isolates
were defined as multiresistant (resistant to more than three
non-ß-lactam antibiotics). In addition, nearly all
isolates were obtained from skin and soft tissue infections.
Twenty-four percent of the nmTSS
S. aureus isolates were multiresistant;
86% contained SCC
mec. In contrast, 28 of 32 (87.5%) HA-MRSA
isolates were multiresistant and 56% were isolated from either
blood or sputum.
SAg typing demonstrated that 31 of 32 CA-MRSA isolates produced either SEB or SEC (Table 1). Five isolates (15%) produced SEB, while 26 (81%) produced SEC. No isolates produced TSST-1. In contrast, no MRSA isolates from UNMC produced SEB, SEC, or TSST-1. Sixteen of 21 nmTSS isolates made either SEB or SEC; none made TSST-1.
PFGE.
PFGE analysis demonstrated that 31 of 32 MRSA isolates from the Native American community were highly related to one another yet were divergent from the MRSA isolates collected at UNMC (Fig. 1). The one CA-MRSA isolate (REF548) that was divergent by PFGE was the same isolate that did not produce SEB, SEC, or TSST-1. Figure 2 shows a representative CA-MRSA isolate from each PFGE group (A1 to A8) shown in Fig. 1. Twenty-one nmTSS S. aureus isolates were also compared by PFGE with the CA-MRSA isolates; 18 of these isolates were MRSA (Table 1). S. aureus COL and NCTC8325 were used as PFGE controls. Six of these nmTSS isolates were highly related to CA-MRSA, one of which (MnCop) is a methicillin-susceptible S. aureus isolate, as it does not contain mecA. Four of six isolates (C99-193, C99-529, C99-459, and C98-370) were involved with pediatric fatalities in Minnesota and North Dakota (5); of the additional two isolates, which were obtained from nmTSS patients in Minnesota (MnKn) and Alabama (MnCop) (32), one resulted in death.
spa typing and SCCmec typing.
spa typing was performed on 22 isolates, including 17 isolates
that represent seven of eight PFGE groups identified among the
Native American population. There was strong concordance between
the PFGE groupings and the groupings based on the variable number
tandem repeat arrays in the protein A gene. DNA sequence results
revealed that all isolates tested had one of five highly related
repeat arrays (
spa types 131, 227, 194, 35, and 175 [Fig.
1]).
With one exception, isolates within the same PFGE group had
identical
spa types. The three
spa types identified in the A3
PFGE group had related repeat arrays (227, 131, and 194) in
support of their genetic relatedness. The
spa typing also confirmed
the genetic relatedness between a geographically distinct isolate,
MnEy, with a PFGE pattern similar to those of the CA-MRSA isolates
(Table
1). It was found that MnEY had
spa type 131, which is
identical to 9 of 17 CA-MRSA isolates tested. And finally, the
spa typing also revealed that strains U674, MnMo, NCTC8325,
and COL (types 2, 3, 59, and 1, respectively) are genetically
distinct from CA-MRSA.
SCCmec typing was performed on 11 isolates to confirm the existence of a type IV mec element in each CA-MRSA isolate as previously reported for C99-459 (MW2) (1) (Fig. 1). Eleven isolates, representing five of the eight PFGE A groups, were typed. All isolates found within PFGE group A had a type IV SCCmec element as predicted. MnEy also had a type IV SCCmec element confirming its relationship to the CA-MRSA from Nebraska, whereas MnMo, which also had a PFGE pattern, but not spa type, highly related to that of CA-MRSA contained a type II SCCmec element.
Genetic relationship between MnCop and C99-459.
The relationship between MnCop and C99-459 was further studied. MnCop was highly related to CA-MRSA as assessed by PFGE, spa typing, and production of SEC; however, this isolate did not contain mecA by PCR and was phenotypically susceptible to oxacillin. As the genome of C99-459 has recently been sequenced (1), it was determined whether other virulence genes found in C99-459 were also found in MnCop. C99-459 is known to contain genes that encode the bicomponent toxin panton-valentine leukocidin as well as SEH and a truncated seo gene. Interestingly, both seh and the truncated version of seo were found just downstream of the SCCmec insertion point (1). PCR was performed using primers specific for each toxin, which demonstrated that all three genes, including the truncated seo, were found in MnCop (data not shown).
As the only detectable PFGE difference between MnCop and C99-459 was a two-band change (Fig. 3A), it was hypothesized that the band shift between the two strains was the insertion of SCCmec DNA in C99-459. Southern hybridization demonstrated that a mecA probe hybridized to an approximately 190-kb band in C99-459 (Fig. 3B). Since mecA is linked to gyrA on the same SmaI fragment (13, 17), a similar blot was probed with gyrA. This demonstrated that gyrA hybridized to the SmaI G fragment of NCTC8325 (175 kb) and a band of similar size in MnCop (Fig. 3B). gyrA also hybridized to the same band that mecA hybridized to in C99-459, as predicted (Fig. 3C). Therefore, gyrA, a gene linked to mecA on the same SmaI fragment, hybridized to both the DNA bands, which made C99-459 and MnCop distinguishable by PFGE. Furthermore, the difference in size between the gyrA-positive bands in both MnCop and C99-459 is consistent with the addition of an SCCmec element in C99-459.

DISCUSSION
Since the initial reports of CA-MRSA appeared in the literature,
it has not been clear whether the strains in question were nosocomial
strains that had "escaped" the hospital environment or whether
these strains represented a new acquisition of SCC
mec DNA. Studies
have shown that patients who have acquired CA-MRSA infections
do not have typical MRSA risk factors, such as recent hospitalization,
kidney dialysis, residence in a long-term health care facility,
or intravenous drug use. Although it is clear that in many cases
recent hospitalization is a major risk factor for MRSA found
in the community (
7), studies have clearly shown that patients
in the northern Great Plains of the United States are acquiring
MRSA in the community without attributable risk factors (
5,
14,
15,
24).
PFGE analysis of the MRSA strains from the Native American community demonstrated that 32 of 33 were highly related to one another, suggesting clonal expansion in this population. These isolates were also highly related or indistinguishable from strains that caused deaths in Minnesota, North Dakota, and Alabama. The CA-MRSA strains from the Native American community were also indistinguishable from or highly related to CA-MRSA strains discussed in two recent papers by Naimi et al. and Groom et al. (data not shown) (14, 24). The spa typing results on representative isolates confirmed the genetic relatedness indicated by the PFGE patterns and more importantly provided an objective "subtype" to directly compare these strains to other MRSA and methicillin-susceptible S. aureus populations. As an example, MnCop, a methicillin-susceptible isolate that was isolated from a patient who clearly had nmTSS in Alabama in 1986 (32), had a spa type related to both the Minnesota-North Dakota (5) cluster of cases and to the CA-MRSA isolates presented in this study. PFGE and toxin typing using sec, seh, seo, and lukS-PV/lukF-PV suggests that MnCop is highly related to C99-459 or MW2. Southern hybridization using mecA and gyrA strongly suggests that the only detectable difference between C99-459 and MnCop as assessed by PFGE is the insertion of SCCmec DNA within C99-459. This suggests that MnCop may represent a progenitor CA-MRSA strain before it had acquired SCCmec. It is interesting that the spa type of MnCop, type 35, was also found in pansusceptible S. aureus isolated in Denmark in 1966 to 1968, suggesting that this strain may have been circulating worldwide for some time (29).
The CA-MRSA isolated in this study was divergent from the HA-MRSA isolated at UNMC using PFGE, spa, and SAg typing. HA-MRSA isolates from the hospital that serves the Native American community were not available for analysis, and the prevalence of MRSA in this hospital was apparently quite low. Therefore, the CA-MRSA was compared to HA-MRSA isolated from the closest tertiary-care center (UNMC). The HA-MRSA isolated at UNMC had a spa type 2, which is a very common spa type in the United States (B. Kreiswirth, unpublished observations).
Five of the 32 strains studied from the Native American community expressed SEB, while 27 expressed SEC. Both SEC and SEB are typically found encoded on pathogenicity islands (19, 26, 33). In some cases, such as C99-529 (SEB producer) and C99-459 (SEC producer), the PFGE patterns are indistinguishable (PFGE group A3). In other cases, strains that produced SEB grouped together or alone (PFGE groups A4, A6, and A7). Baba et al. reported that SEC is encoded on a pathogenicity island called
Sa3 along with ear and sel2 in strain C99-459 (1). DNA sequence analysis demonstrated that the sec gene found in C99-459 is a variant, which was named sec4 (1). Further work is being performed to determine whether CA-MRSA isolates that produce SEB instead of SEC contain
Sa3 or a variant thereof.
Genetic analysis combining ribotyping, multilocus sequence typing, spa typing, and SCCmec typing has suggested that SCCmec has inserted into only five methicillin-susceptible genomic backgrounds worldwide (10, 16, 28, 29). It is now becoming quite clear that CA-MRSA found in the northern Great Plains of the United States represents a new genetic lineage of MRSA with a different SCCmec element (type IV). The genetic background represented by CA-MRSA represents the sixth genetic background that is known to contain SCCmec DNA. Due to the small size of the type IV SCCmec DNA, more genetic backgrounds may be soon discovered that harbor this SCCmec element.
The observations in this study have great clinical significance. Because of its high level (50 to 100 µg/ml in culture fluids) of SEB and SEC production, CA-MRSA may cause nmTSS (9, 36). SEB and SEC, together with TSST-1, cause nearly all of TSS cases (3, 11, 22). Since only 3 to 5 µg of streptococcal pyrogenic exotoxin A is sufficient to induce TSS in humans (3, 11, 22) and since SEB and SEC are in the same subfamily of SAgs as streptococcal pyrogenic exotoxin A (3, 11, 12, 22, 30, 38), SEB and SEC are likely to have the same potency in humans. Clinicians associate CA staphylococcal disease with an antibiotic-susceptible phenotype and routinely prescribe penicillinase-stable penicillins or first-generation cephalosporins as antibiotics of choice. Therefore, some CA-MRSA patients may receive inappropriate treatment. Finally, our study and others indicate that CA-MRSA isolates, as opposed to HA-MRSA, remain susceptible to other antistaphylococcal agents, such as macrolides, trimethoprim-sulfamethoxazole, and fluoroquinolones (5, 14, 15, 24).
In conclusion, the prevalence of CA-MRSA in the United States is unknown, but this report and others indicate that it is likely increasing. Surveillance programs should be implemented by public health laboratories to determine the extent of CA-MRSA dissemination. Until the scope of this problem is better defined, clinicians should consider the use of non-ß-lactam antistaphylococcal antibiotics in the empirical treatment of CA-MRSA.

FOOTNOTES
* Corresponding author. Mailing address: University of Nebraska Medical Center Departments of Internal Medicine and Pathology and Microbiology, 985400 Nebraska Medical Center, Omaha, NE 68198-5400. Phone: (402) 559-2122. Fax: (402) 559-5581. E-mail:
pfey{at}unmc.edu.


REFERENCES
1 - Baba, T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi, Y. Nagai, N. Iwama, K. Asano, T. Naimi, H. Kuroda, L. Cui, K. Yamamoto, and K. Hiramatsu. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819-1827.[CrossRef][Medline]
2 - Bannerman, T. L., G. A. Hancock, F. C. Tenover, and J. M. Miller. 1995. Pulsed-field gel electrophoresis as a replacement for phage typing of Staphylococcus aureus. J. Clin. Microbiol. 33:551-555.[Abstract]
3 - Bohach, G. A., D. J. Fast, R. D. Nelson, and P. M. Schlievert. 1990. Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses. Crit. Rev. Microbiol. 17:251-272.[Medline]
4 - Bohach, G. A., and P. M. Schlievert. 1987. Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxin genes. Mol. Gen. Genet. 209:15-20.[CrossRef][Medline]
5 - Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureusMinnesota and North Dakota, 1997-1999. Morb. Mortal. Wkly. Rep. 48:707-710.
6 - Centers for Disease Control and Prevention. 2002. Staphylococcus aureus resistant to vancomycinUnited States, 2002. Morb. Mortal. Wkly. Rep. 51:565-567.[Medline]
7 - Chambers, H. F. 2001. The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis. 7:178-182.[Medline]
8 - Chambers, H. F. 1997. Parenteral antibiotics for the treatment of bacteremia and other serious staphylococcal infections, p. 583-601. In K. B. Crossley and G. L. Archer (ed.), The staphylococci in human disease. Churchill Livingstone, New York, N.Y.
9 - Crass, B. A., and M. S. Bergdoll. 1986. Involvement of staphylococcal enterotoxins in nonmenstrual toxic shock syndrome. J. Clin. Microbiol. 23:1138-1139.[Abstract/Free Full Text]
10 - Crisostomo, M. E., H. Westh, A. Tomasz, M. Chung, D. C. Oliveira, and H. de Lencastre. 2001. The evolution of methicillin resistance in Staphylococcus aureus: similarity of genetic backgrounds in historically early methicillin-susceptible and -resistant isolates and contemporary epidemic clones. Proc. Natl. Acad. Sci. USA 98:9865-9870.[Abstract/Free Full Text]
11 - Dinges, M. M., P. M. Orwin, and P. M. Schlievert. 2000. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 13:16-34.[Abstract/Free Full Text]
12 - Earhart, C. A., G. M. Vath, M. Roggiani, P. M. Schlievert, and D. H. Ohlendorf. 2000. Structure of streptococcal pyrogenic exotoxin A reveals a novel metal cluster. Protein Sci. 9:1847-1851.[Medline]
13 - Fey, P. D., M. W. Climo, and G. L. Archer. 1998. Determination of the chromosomal relationship between mecA and gyrA in methicillin-resisant coagulase-negative staphylococci. Antimicrob. Agents Chemother. 42:306-312.[Abstract/Free Full Text]
14 - Groom, A. V., D. H. Wolsey, T. S. Naimi, K. Smith, S. Johnson, D. Boxrud, K. A. Moore, and J. E. Cheek. 2001. Community-acquired methicillin-resistant Staphylococcus aureus in a rural American Indian community. JAMA 286:1201-1205.[Abstract/Free Full Text]
15 - Herold, B. C., L. C. Immergluck, and M. C. Maranan. 1998. Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279:593-598.[Abstract/Free Full Text]
16 - Hiramatsu, K. 1995. Molecular evolution of MRSA. Microbiol. Immunol. 39:531-543.[Medline]
17 - Iandolo, J. J., J. P. Bannantine, and G. C. Stewart. 1997. Genetic and physical map of the chromosome of Staphylococcus aureus, p. 39-53. In K. B. Crossley and G. L. Archer (ed.), The staphylococci in human disease. Churchill Livingstone, New York, N.Y.
18 - Kotzin, B. L., D. Y. Leung, J. Kappler, and P. Marrack. 1993. Superantigens and their potential role in human disease. Adv. Immunol. 54:99-166.[Medline]
19 - Lindsay, J. A., A. Ruzin, H. F. Ross, N. Kurepina, and R. P. Novick. 1998. The gene for toxic shock toxin is carried by a family of mobile pathogenicity islands in Staphylococcus aureus. Mol. Microbiol. 29:527-543.[CrossRef][Medline]
20 - Ma, X. X., T. Ito, C. Tiensasitorn, M. Jamklang, P. Chogtrakool, S. Boyle-Vavra, R. S. Daum, and K. Hiramatsu. 2002. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother. 46:1147-1152.[Abstract/Free Full Text]
21 - Marrack, P., and J. Kappler. 1990. The staphylococcal enterotoxins and their relatives. Science 248:705-711.[Abstract/Free Full Text]
22 - McCormick, J. M., J. M. Yarwood, and P. M. Schlievert. 2001. Toxic shock syndrome and bacterial superantigens: an update. Annu. Rev. Microbiol. 55:77-104.[CrossRef][Medline]
23 - Monday, S. R., and G. A. Bohach. 1999. Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J. Clin. Microbiol. 10:3411-3414.
24 - Naimi, T. S., K. H. LeDell, D. J. Boxrud, A. V. Groom, C. D. Steward, S. K. Johnson, J. M. Besser, C. O'Boyle, R. N. Danila, J. E. Cheek, M. T. Osterholm, K. A. Moore, and K. E. Smith. 2001. Epidemiology and clonality of community-acquired methicillin-resistant Staphylococcus aureus in Minnesota, 1996-1998. Clin. Infect. Dis. 33:990-996.[CrossRef][Medline]
25 - National Committee for Clinical Laboratory Standards. 2001. Performance standards for antimicrobial disk susceptibility tests. Approved standard M2-A7. National Committee for Clinical Laboratory Standards, Wayne, Pa.
26 - Novick, R. P., P. M. Schlievert, and A. Ruzin. 2001. Pathogenicity and resistance islands of staphylococci. Microbes Infect. 3:1-10.
27 - Oliveira, D. C., and H. de Lencastre. 2002. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 46:2155-2161.[Abstract/Free Full Text]
28 - Oliveira, D. C., A. Tomasz, and H. de Lencastre. 2001. The evolution of pandemic clones of methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and the associated mec elements. Microb. Drug Resist. 7:349-362.[CrossRef][Medline]
29 - Oliveira, D. C., A. Tomasz, and H. de Lencastre. 2002. Secrets of success of a human pathogen: molecular evolution of pandemic clones of methicillin-resistant Staphylococcus aureus. Lancet Infect. Dis. 2:180-189.[CrossRef][Medline]
30 - Papageorgiou, A. C., C. M. Collins, D. M. Gutman, J. B. Kline, S. M. O'Brien, H. S. Tranter, and K. R. Acharya. 1999. Structural basis for the recognition of superantigen streptococcal pyrogenic exotoxin A (SpeA1) by MHC class II molecules and T-cell receptors. EMBO J. 18:9-21.[CrossRef][Medline]
31 - Projan, S. J. 2000. Antibiotic resistance in the staphylococci, p. 463-470. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens. American Society for Microbiology, Washington, D.C.
32 - Rizkallah, M. F., A. Tolaymat, J. S. Martinez, P. M. Schlievert, and E. M. Ayoub. 1989. Toxic shock syndrome caused by a strain of Staphylococcus aureus that produces enterotoxin C but not toxic shock syndrome toxin-1. Am. J. Dis. Child. 143:848-849.[Abstract/Free Full Text]
33 - Ruzin, A., J. Lindsay, and R. P. Novick. 2001. Molecular genetics of SaPI1a mobile pathogenicity island in Staphylococcus aureus. Mol. Microbiol. 41:365-377.[CrossRef][Medline]
34 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
35 - Schlievert, P. M. 1988. Immunochemical assays for toxic-shock syndrome toxin-1. Methods Enzymol. 165:339-344.[Medline]
36 - Schlievert, P. M. 1986. Staphylococcal enterotoxin B and toxic-shock syndrome toxin-1 are significantly associated with non-menstrual TSS. Lancet i:1149-1150.
37 - Shopsin, B., M. Gomez, S. O. Montgomery, D. H. Smith, M. Waddington, D. E. Dodge, D. A. Bost, M. Riehman, S. Naidich, and B. N. Kreiswirth. 1999. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 37:3556-3563.[Abstract/Free Full Text]
38 - Swaminathan, S., W. Furey, J. Pletcher, and M. Sax. 1992. Crystal structure of staphylococcal enterotoxin B, a superantigen. Nature 359:801-806.[CrossRef][Medline]
39 - Tenover, F. C., and R. P. Gaynes. 2000. The epidemiology of Staphylococcus infection, p. 414-421. In V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens. American Society for Microbiology, Washington, D.C.
Antimicrobial Agents and Chemotherapy, January 2003, p. 196-203, Vol. 47, No. 1
0066-4804/03/$08.00+0 DOI: 10.1128/AAC.47.1.196-203.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Vindel, A., Cuevas, O., Cercenado, E., Marcos, C., Bautista, V., Castellares, C., Trincado, P., Boquete, T., Perez-Vazquez, M., Marin, M., Bouza, E., and the Spanish Group for the Study of Staphylococ,
(2009). Methicillin-Resistant Staphylococcus aureus in Spain: Molecular Epidemiology and Utility of Different Typing Methods. J. Clin. Microbiol.
47: 1620-1627
[Abstract]
[Full Text]
-
Nakaminami, H., Noguchi, N., Ikeda, M., Hasui, M., Sato, M., Yamamoto, S., Yoshida, T., Asano, T., Senoue, M., Sasatsu, M.
(2008). Molecular epidemiology and antimicrobial susceptibilities of 273 exfoliative toxin-encoding-gene-positive Staphylococcus aureus isolates from patients with impetigo in Japan. J Med Microbiol
57: 1251-1258
[Abstract]
[Full Text]
-
Parsonnet, J., Goering, R. V., Hansmann, M. A., Jones, M. B., Ohtagaki, K., Davis, C. C., Totsuka, K.
(2008). Prevalence of Toxic Shock Syndrome Toxin 1 (TSST-1)-Producing Strains of Staphylococcus aureus and Antibody to TSST-1 among Healthy Japanese Women. J. Clin. Microbiol.
46: 2731-2738
[Abstract]
[Full Text]
-
Murthy, M. H., Olson, M. E., Wickert, R. W., Fey, P. D., Jalali, Z.
(2008). Daptomycin non-susceptible meticillin-resistant Staphylococcus aureus USA 300 isolate. J Med Microbiol
57: 1036-1038
[Abstract]
[Full Text]
-
Huang, Y.-C., Hwang, K.-P., Chen, P.-Y., Chen, C.-J., Lin, T.-Y.
(2007). Prevalence of Methicillin-Resistant Staphylococcus aureus Nasal Colonization among Taiwanese Children in 2005 and 2006. J. Clin. Microbiol.
45: 3992-3995
[Abstract]
[Full Text]
-
Schlievert, P. M.
(2007). Chitosan Malate Inhibits Growth and Exotoxin Production of Toxic Shock Syndrome-Inducing Staphylococcus aureus Strains and Group A Streptococci. Antimicrob. Agents Chemother.
51: 3056-3062
[Abstract]
[Full Text]
-
Brady, J. M., Stemper, M. E., Weigel, A., Chyou, P.-H., Reed, K. D., Shukla, S. K.
(2007). Sporadic "Transitional" Community-Associated Methicillin-Resistant Staphylococcus aureus Strains from Health Care Facilities in the United States. J. Clin. Microbiol.
45: 2654-2661
[Abstract]
[Full Text]
-
Sergio, D. M. B., Koh, T. H., Hsu, L.-Y., Ogden, B. E., Goh, A. L. H., Chow, P. K. H.
(2007). Investigation of meticillin-resistant Staphylococcus aureus in pigs used for research. J Med Microbiol
56: 1107-1109
[Abstract]
[Full Text]
-
Goering, R. V., McDougal, L. K., Fosheim, G. E., Bonnstetter, K. K., Wolter, D. J., Tenover, F. C.
(2007). Epidemiologic Distribution of the Arginine Catabolic Mobile Element among Selected Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates. J. Clin. Microbiol.
45: 1981-1984
[Abstract]
[Full Text]
-
Ossowski, K., Chun, R. H., Suskind, D., Baroody, F. M.
(2006). Increased Isolation of Methicillin-Resistant Staphylococcus aureus in Pediatric Head and Neck Abscesses.. Arch Otolaryngol Head Neck Surg
132: 1176-1181
[Abstract]
[Full Text]
-
Noto, M. J., Archer, G. L.
(2006). A Subset of Staphylococcus aureus Strains Harboring Staphylococcal Cassette Chromosome mec (SCCmec) Type IV Is Deficient in CcrAB-Mediated SCCmec Excision.. Antimicrob. Agents Chemother.
50: 2782-2788
[Abstract]
[Full Text]
-
Huang, H., Flynn, N. M., King, J. H., Monchaud, C., Morita, M., Cohen, S. H.
(2006). Comparisons of Community-Associated Methicillin-Resistant Staphylococcus aureus (MRSA) and Hospital-Associated MSRA Infections in Sacramento, California.. J. Clin. Microbiol.
44: 2423-2427
[Abstract]
[Full Text]
-
Goldstein, E. H., Hradecky, G., Vilke, G. M., Chan, T. C.
(2006). Impact of a Standardized Protocol to Address Methicillin-Resistant Staphylococcus aureus Skin Infections at a Large, Urban County Jail System. J Correct Health Care
12: 181-188
[Abstract]
-
Koessler, T., Francois, P., Charbonnier, Y., Huyghe, A., Bento, M., Dharan, S., Renzi, G., Lew, D., Harbarth, S., Pittet, D., Schrenzel, J.
(2006). Use of Oligoarrays for Characterization of Community-Onset Methicillin-Resistant Staphylococcus aureus.. J. Clin. Microbiol.
44: 1040-1048
[Abstract]
[Full Text]
-
Tenover, F. C., McDougal, L. K., Goering, R. V., Killgore, G., Projan, S. J., Patel, J. B., Dunman, P. M.
(2006). Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States. J. Clin. Microbiol.
44: 108-118
[Abstract]
[Full Text]
-
Vindel, A., Trincado, P., Gomez, E., Cabrera, R., Boquete, T., Sola, C., Valdezate, S., Saez-Nieto, J. A.
(2006). Prevalence and Evolution of Methicillin-Resistant Staphylococcus aureus in Spanish Hospitals between 1996 and 2002. J. Clin. Microbiol.
44: 266-270
[Abstract]
[Full Text]
-
(2005). Communicable Disease and Health Protection Quarterly Review: April to June 2005: From the Health Protection Agency, Centre for Infections. J Public Health (Oxf)
27: 392-396
[Full Text]
-
O'Brien, F. G., Coombs, G. W., Pearson, J. C., Christiansen, K. J., Grubb, W. B.
(2005). Type V Staphylococcal Cassette Chromosome mec in Community Staphylococci from Australia. Antimicrob. Agents Chemother.
49: 5129-5132
[Abstract]
[Full Text]
-
Qi, W., Ender, M., O'Brien, F., Imhof, A., Ruef, C., McCallum, N., Berger-Bachi, B.
(2005). Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus in Zurich, Switzerland (2003): Prevalence of Type IV SCCmec and a New SCCmec Element Associated with Isolates from Intravenous Drug Users. J. Clin. Microbiol.
43: 5164-5170
[Abstract]
[Full Text]
-
Kwon, N. H., Park, K. T., Moon, J. S., Jung, W. K., Kim, S. H., Kim, J. M., Hong, S. K., Koo, H. C., Joo, Y. S., Park, Y. H.
(2005). Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea. J Antimicrob Chemother
56: 624-632
[Abstract]
[Full Text]
-
Berglund, C., Molling, P., Sjoberg, L., Soderquist, B.
(2005). Multilocus Sequence Typing of Methicillin-Resistant Staphylococcus aureus from an Area of Low Endemicity by Real-Time PCR. J. Clin. Microbiol.
43: 4448-4454
[Abstract]
[Full Text]
-
Chapman, A. L.N., Greig, J. M., Innes, J. A., Hageman, J. C., Lynfield, R., Fridkin, S. K., Miller, L. G., Perdreau-Remington, F., Spellberg, B.
(2005). MRSA in the Community. NEJM
353: 530-532
[Full Text]
-
Donnio, P.-Y., Oliveira, D. C., Faria, N. A., Wilhelm, N., Le Coustumier, A., de Lencastre, H.
(2005). Partial Excision of the Chromosomal Cassette Containing the Methicillin Resistance Determinant Results in Methicillin-Susceptible Staphylococcus aureus. J. Clin. Microbiol.
43: 4191-4193
[Abstract]
[Full Text]
-
Said-Salim, B., Mathema, B., Braughton, K., Davis, S., Sinsimer, D., Eisner, W., Likhoshvay, Y., DeLeo, F. R., Kreiswirth, B. N.
(2005). Differential Distribution and Expression of Panton-Valentine Leucocidin among Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains. J. Clin. Microbiol.
43: 3373-3379
[Abstract]
[Full Text]
-
Shukla, S. K.
(2005). Community-Associated Methicillin-Resistant Staphylococcus aureus and Its Emerging Virulence. Clin Med Res
3: 57-60
[Full Text]
-
Peterson, M. L., Ault, K., Kremer, M. J., Klingelhutz, A. J., Davis, C. C., Squier, C. A., Schlievert, P. M.
(2005). The Innate Immune System Is Activated by Stimulation of Vaginal Epithelial Cells with Staphylococcus aureus and Toxic Shock Syndrome Toxin 1. Infect. Immun.
73: 2164-2174
[Abstract]
[Full Text]
-
Gonzalez, B. E., Martinez-Aguilar, G., Hulten, K. G., Hammerman, W. A., Coss-Bu, J., Avalos-Mishaan, A., Mason, E. O. Jr, Kaplan, S. L.
(2005). Severe Staphylococcal Sepsis in Adolescents in the Era of Community-Acquired Methicillin-Resistant Staphylococcus aureus. Pediatrics
115: 642-648
[Abstract]
[Full Text]
-
Cassat, J. E., Dunman, P. M., McAleese, F., Murphy, E., Projan, S. J., Smeltzer, M. S.
(2005). Comparative Genomics of Staphylococcus aureus Musculoskeletal Isolates. J. Bacteriol.
187: 576-592
[Abstract]
[Full Text]
-
van der Mee-Marquet, N., Domelier, A.-S., Girard, N., Quentin, R., the Bloodstream Infection Study Group of the Relai,
(2004). Epidemiology and Typing of Staphylococcus aureus Strains Isolated from Bloodstream Infections. J. Clin. Microbiol.
42: 5650-5657
[Abstract]
[Full Text]
-
Stemper, M. E., Shukla, S. K., Reed, K. D.
(2004). Emergence and Spread of Community-Associated Methicillin-Resistant Staphylococcus aureus in Rural Wisconsin, 1989 to 1999. J. Clin. Microbiol.
42: 5673-5680
[Abstract]
[Full Text]
-
Shukla, S. K., Stemper, M. E., Ramaswamy, S. V., Conradt, J. M., Reich, R., Graviss, E. A., Reed, K. D.
(2004). Molecular Characteristics of Nosocomial and Native American Community-Associated Methicillin-Resistant Staphylococcus aureus Clones from Rural Wisconsin. J. Clin. Microbiol.
42: 3752-3757
[Abstract]
[Full Text]
-
O'Brien, F. G., Lim, T. T., Chong, F. N., Coombs, G. W., Enright, M. C., Robinson, D. A., Monk, A., Said-Salim, B., Kreiswirth, B. N., Grubb, W. B.
(2004). Diversity among Community Isolates of Methicillin-Resistant Staphylococcus aureus in Australia. J. Clin. Microbiol.
42: 3185-3190
[Abstract]
[Full Text]
-
Francois, P., Renzi, G., Pittet, D., Bento, M., Lew, D., Harbarth, S., Vaudaux, P., Schrenzel, J.
(2004). A Novel Multiplex Real-Time PCR Assay for Rapid Typing of Major Staphylococcal Cassette Chromosome mec Elements. J. Clin. Microbiol.
42: 3309-3312
[Abstract]
[Full Text]
-
Oteo, J., Baquero, F., Vindel, A., Campos, J., on behalf of the Spanish members of The European A,
(2004). Antibiotic resistance in 3113 blood isolates of Staphylococcus aureus in 40 Spanish hospitals participating in the European Antimicrobial Resistance Surveillance System (2000-2002). J Antimicrob Chemother
53: 1033-1038
[Abstract]
[Full Text]
-
Mongkolrattanothai, K., Boyle, S., Murphy, T. V., Daum, R. S.
(2004). Novel Non-mecA-Containing Staphylococcal Chromosomal Cassette Composite Island Containing pbp4 and tagF Genes in a Commensal Staphylococcal Species: a Possible Reservoir for Antibiotic Resistance Islands in Staphylococcus aureus. Antimicrob. Agents Chemother.
48: 1823-1836
[Abstract]
[Full Text]
-
Diep, B. A., Sensabaugh, G. F., Somboona, N. S., Carleton, H. A., Perdreau-Remington, F.
(2004). Widespread Skin and Soft-Tissue Infections Due to Two Methicillin-Resistant Staphylococcus aureus Strains Harboring the Genes for Panton-Valentine Leucocidin. J. Clin. Microbiol.
42: 2080-2084
[Abstract]
[Full Text]
-
Dominguez, T. J.
(2004). It's Not a Spider Bite, It's Community-Acquired Methicillin-Resistant Staphylococcus aureus. J Am Board Fam Med
17: 220-226
[Full Text]
-
Donnio, P.-Y., Preney, L., Gautier-Lerestif, A.-L., Avril, J.-L., Lafforgue, N.
(2004). Changes in staphylococcal cassette chromosome type and antibiotic resistance profile in methicillin-resistant Staphylococcus aureus isolates from a French hospital over an 11 year period. J Antimicrob Chemother
53: 808-813
[Abstract]
[Full Text]
-
Liu, D., Liu, X. Y., Robinson, D., Burnett, C., Jackson, C., Seele, L., Veach, R. A., Downs, S., Collins, R. D., Ballard, D. W., Hawiger, J.
(2004). Suppression of Staphylococcal Enterotoxin B-induced Toxicity by a Nuclear Import Inhibitor. J. Biol. Chem.
279: 19239-19246
[Abstract]
[Full Text]
-
Dietrich, D. W., Auld, D. B., Mermel, L. A.
(2004). Community-Acquired Methicillin-Resistant Staphylococcus aureus in Southern New England Children. Pediatrics
113: e347-e352
[Abstract]
[Full Text]
-
Tacconelli, E., Venkataraman, L., De Girolami, P. C., D'Agata, E. M. C.
(2004). Methicillin-resistant Staphylococcus aureus bacteraemia diagnosed at hospital admission: distinguishing between community-acquired versus healthcare-associated strains. J Antimicrob Chemother
53: 474-479
[Abstract]
[Full Text]
-
Naimi, T. S., LeDell, K. H., Como-Sabetti, K., Borchardt, S. M., Boxrud, D. J., Etienne, J., Johnson, S. K., Vandenesch, F., Fridkin, S., O'Boyle, C., Danila, R. N., Lynfield, R.
(2003). Comparison of Community- and Health Care-Associated Methicillin-Resistant Staphylococcus aureus Infection. JAMA
290: 2976-2984
[Abstract]
[Full Text]
-
Dyke, K. G. H.
(2003). Staphylococcus research. Microbiology
149: 2697-2699
[Full Text]
-
Aires de Sousa, M., de Lencastre, H.
(2003). Evolution of Sporadic Isolates of Methicillin-Resistant Staphylococcus aureus (MRSA) in Hospitals and Their Similarities to Isolates of Community-Acquired MRSA. J. Clin. Microbiol.
41: 3806-3815
[Abstract]
[Full Text]