Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lleò, M. d. M. Articles by Canepari, P. Search for Related Content PubMed PubMed Citation Articles by Lleò, M. d. M. Articles by Canepari, P.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, March 2003, p. 1154-1156, Vol. 47, No. 3
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.3.1154-1156.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Vancomycin Resistance Is Maintained in Enterococci in the Viable but Nonculturable State and after Division Is Resumed

Maria del Mar Lleò,^* Barbara Bonato, Caterina Signoretto, and Pietro Canepari

Dipartimento di Patologia—Sezione di Microbiologia, Università di Verona, 37134 Verona, Italy

Received 9 July 2002/ Returned for modification 8 October 2002/ Accepted 4 December 2002

Top Abstract Text References

 
Stressed vancomycin-resistant enterococci (VRE) can activate a survival strategy known as the viable but nonculturable (VBNC) state and are able to maintain vancomycin resistance. During restoration of division they continue to express the vancomycin resistance trait. We suggest that VBNC enterococci may constitute further reservoirs of VRE and therefore represent an additional risk for human health.

Top Abstract Text References

 
Enterococci form part of the normal human and animal intestinal microflorae and are considered markers of fecal contamination (19). When released into the environment, they frequently encounter adverse conditions which prevent cell division. In response to these conditions, enterococci are capable of activating a survival strategy known as the viable but nonculturable (VBNC) state (11-13). When in this phase, bacteria lose their ability to form colonies on culture media but are still viable and capable of metabolic activity (13) and gene expression (12) and show a specific protein profile (9) and cell wall modifications (18). Moreover, enterococcal VBNC cells, which maintain their pathogenic potential (17), may be able to resume division when permissive conditions are restored (11). These characteristics mean that VBNC cells are a potential risk for human health in that they might constitute a reservoir of infectious bacterial forms involved in disease transmission and persistence.

In recent years, enterococci have emerged as one of the leading causes of serious or life-threatening nosocomial infections (5). Because a number of enterococci are endowed with intrinsic resistance to several antibiotics, the emergence of vancomycin-resistant enterococci (VRE) has alarmed the infectious disease research and treatment community (15). Thus, it is of the utmost importance to identify parameters contributing to VRE dissemination and persistence. In Europe, suspected reservoirs related to animal husbandry and community ecologies seem to be primary sources of VRE. VRE have been consistently found in healthy volunteers (7) and in the environment, including sewage (20), animal feces (1, 3, 4), and animal products (4, 21). It has been postulated that VRE can spread from animals to humans via the food chain (2). In this context, the VBNC forms of enterococci, which probably represent a significant proportion of the bacterial populations in the natural environment (14), may constitute further reservoirs of VRE. We have investigated the possibility that vancomycin-resistant Enterococcus faecalis and Enterococcus faecium are capable of maintaining and expressing antibiotic resistance during the VBNC state and after resuming their divisional capability on returning to favorable environmental conditions.

Entry of VRE into the VBNC state. The strains used in this study are described in Table 1. The Van genotype of VRE was determined using primers selective for vancomycin resistance genes (16). To induce the VBNC state, exponentially growing cultures were used to inoculate oligotrophic microcosms consisting of filtered, autoclaved lake water (Lake Garda, Italy) at a final density of 10⁷ cells/ml as described previously (12, 13). One aliquot of each VRE culture was grown in the presence of a sub-MIC vancomycin concentration (32 µg/ml) to induce the vanA or vanB gene before lake water was inoculated. Inoculated microcosms, with 32 µg of vancomycin/ml added, were maintained at 4°C and monitored for CFU counts. Viability of the VBNC E. faecalis and E. faecium cells was tested either with a modified Kogure direct viable count method (10, 12) or by staining VBNC cells with a Live/Dead kit (Molecular Probes) as specified by the manufacturer. To investigate whether enterococci of animal and human origin were also capable of activating the VBNC state, we prepared lake water microcosms with exponentially growing, vancomycin-induced cells from the different VRE isolates described in Table 1. All of the strains belonging to each of the E. faecalis and E. faecium species reached the VBNC state in time periods (Table 2) similar to those previously seen for E. faecalis 56R and E. faecium VR1, respectively (11). The percentage of intact (Live/Dead staining) and viable (by the modified Kogure method) cells was also comparable to that obtained with E. faecalis 56R (about 50 to 60%) or with E. faecium VR1 (about 25 to 35%) after 1 month in the VBNC state. Only one of the isolates, E. faecium EFAV-15, failed to maintain a viable population similar to that previously reported (11). Thus, the time needed to lose culturability entirely depends on the identity of the enterococcal species but not on the presence of van genes or on the origin of the isolates.

View this table: [in this window] [in a new window]

TABLE 1. Characteristics of clinical and veterinary isolates of Enterococcus species

View this table: [in this window] [in a new window]

TABLE 2. Time needed to reach the VBNC state and maintenance of viability in clinical and veterinary enterococcal isolatesa

Detection of vanA and vanB mRNA as a marker of vancomycin resistance expression in enterococci during the VBNC state. M. M. Lleò et al. have recently shown that pbp5 mRNA of E. faecalis can be used as a marker of VBNC cell viability in that its presence constitutes an indication of gene expression (12). To test whether the vanA and vanB genes were expressed during the VBNC state, RNA was extracted from induced and noninduced cells maintained for 1 month in the VBNC state, as previously described (12). Two primers selected within the vanA gene (forward, 5'GGGAAAACGACAATTGC 3'; reverse, 5'GTACAATGCGGCCGTTA 3') or the vanB gene (forward, 5'GAATTGTCTGGTATCCCCTAT 3; reverse, 5'GACCTCGTTTAGAACGATGC 3') were used. The expected sizes of the amplification product were 730 bp and 580 bp for vanA and vanB, respectively. Reverse transcription-PCR (RT-PCR) experiments were also conducted using RNA extracted from 7-, 14-, and 28-day-old VBNC cells from some of the clinical and veterinary strains. As shown in Table 3, E. faecalis VBNC cells maintained their vanA and vanB gene expression capability for as long as 1 month of permanence in the VBNC state while the E. faecium VBNC cells conserved this capability for only 7 to 14 days. This is in agreement with previous data of Lleò et al. indicating that, unlike E. faecalis, E. faecium is hardly capable of maintaining viability when exposed to unfavorable conditions (11).

View this table: [in this window] [in a new window]

TABLE 3. Presence of vanA or vanB mRNAs (as detected by RT-PCR) in 7-, 14-, and 28-day-old VBNC cells from clinical and veterinary VRE isolatesa

Vancomycin response in VRE resuscitated from the VBNC state. Resuscitation experiments were attempted only when the counts in the microcosms which contained induced and noninduced enterococcal cells were lower than 0.1 CFU/ml, in which case most probable number (MPN) estimates were calculated (8). As a control, we used E. faecalis strain 56R, for which resuscitation ability from the VBNC state had already been demonstrated (11). Table 4 shows the results of the calculation of MPN estimates of numbers of revivable VBNC cells per millimeter of the original microcosms after 10 days of permanence in the VBNC state. The numbers of resuscitated cells were similar in the three microcosms containing E. faecalis 56R and induced and noninduced E. faecalis vanB VBNC cells. These results closely resemble those previously reported for enterococcal species (11). Moreover, the resuscitated E. faecalis vanB cells from the induced microcosm were also capable of resuming division when the resuscitation process occurred in tryptic soy broth containing vancomycin, indicating that the cells maintained the antibiotic-resistant phenotype. This result was confirmed by RT-PCR evidence that both vanA and vanB mRNAs were present in the resuscitated cells (data not shown). For a number of human and animal isolates of VRE (Table 4), the behavior of the E. faecalis strains and of the strains belonging to the E. faecium species resembled that observed in the reference strains, namely, E. faecalis V583 and E. faecium VR1. Although E. faecium VBNC cells hardly ever resuscitated, at least in our experimental conditions, those cells capable of resuming division were still vancomycin resistant. In light of these results, we suggest that during their life cycle, enterococci may be in a nonculturable phase which is activated when bacteria, present in animal and human feces, are released into the environment. These nonculturable cells might constitute an environmental reservoir of infectious, antibiotic-resistant cells for which we postulate a role in the transmission of VRE via recreational or drinking water and/or the food chain. Moreover, the reservoir of these nonculturable cells might constitute an additional risk for human health, in that they are undetectable when the microbiological quality of water and foods is monitored using current standard culture methods. For this reason, we suggest the additional use of molecular methods capable of detecting nonculturable bacteria.

View this table: [in this window] [in a new window]

TABLE 4. MPN estimates of numbers of cells resuscitated from the VBNC state in induced and noninduced E. faecalis vanB cells and in enterococcal clinical and veterinary isolates

 
This study was supported by grant 01.00255.PF49 (Target Project on Biotechnology) from the Consiglio Nazionale delle Ricerche (CNR) and by Cofin2000 from the Ministero dell'Istruzione, dell'Università e della Ricerca (MIUR), Rome, Italy.

 
* Corresponding author. Mailing address: Dipartimento di Patologia, Sezione di Microbiologia, Università di Verona, Strada Le Grazie 8, 37134 Verona, Italy. Phone: 39 045 8027194. Fax: 39 045 584606. E-mail: mlleo{at}univr.it.

Top Abstract Text References

 

1
1. Aarestrup, F. M. 1995. Occurrence of glycopeptide resistance among Enterococcus faecium isolated from conventional and ecological poultry farms. Microb. Drug Resist. 1:255-257.[Medline]
2
2. Bates, E. M., J. Z. Jordens, and D. T. Griffiths. 1994. Farm animals as a putative reservoir for vancomycin-resistant enterococcal infections in man. J. Antimicrob. Chemother. 34:507-516.[Abstract/Free Full Text]
3
3. Butaye, P., L. A. Devriese, H. Goossens, M. Ieven, and F. Haesebrouck. 1999. Enterococci with acquired vancomycin resistance in pigs and chickens of different age groups. Antimicrob. Agents Chemother. 43:365-366.[Abstract/Free Full Text]
4
4. Del Grosso, M., A. Caprioli, P. Chinzari, M. C. Fontana, G. Pezzotti, A. Manfrin, E. Di Giannatale, E. Goffredo, and A. Pantosti. 2000. Detection and characterization of vancomycin-resistant enterococci in farm animals and raw meat products in Italy. Microb. Drug Resist. 6:313-318.[Medline]
5
5. Edmond, M. B., J. F. Ober, J. D. Dawson, D. L. Weinbaum, and R. P. Wenzel. 1996. Vancomycin-resistant enterococcal bacteriemia: natural history and attributable mortality. Clin. Infect. Dis. 23:1234-1239.[Medline]
6
6. Evers, S., P. E. Reynolds, and P. Courvalin. 1994. Sequence of the vanB and ddl genes encoding D-alanine-D-lactate and D-alanine-D-alanine ligases in vancomycin resistant Enterococcus faecalis V583. Gene 140:97-102.[CrossRef][Medline]
7
7. Gordts, B., H. van Lauduyt, M. Ieven, P. Vandamme, and H. Goossens. 1995. Vancomycin-resistant enterococci colonizing the intestinal tracts of hospitalized patients. J. Clin. Microbiol. 33:2842-2846.[Abstract]
8
8. Halvorson, H. O., and N. R. Ziegler. 1933. Application of statistics to problems in bacteriology. J. Bacteriol. 25:101-121.[Free Full Text]
9
9. Heim, S., M. M. Lleò, B. Bonato, C. A. Guzman, and P. Canepari. 2002. The viable but nonculturable state and starvation are different stress responses of Enterococcus faecalis, as determined by proteome analysis. J. Bacteriol. 184:6739-6745.[Abstract/Free Full Text]
10
10. Kogure, K., U. Simidu, and N. Taga. 1979. A tentative direct microscopic method for counting living bacteria. Can. J. Microbiol. 25:415-420.[Medline]
11
11. Lleò, M. M., B. Bonato, M. C. Tafi, C. Signoretto, M. Boaretti, and P. Canepari. 2001. Resuscitation rate in different enterococcal species in the viable but nonculturable state. J. Appl. Microbiol. 91:1095-1102.[CrossRef][Medline]
12
12. Lleò, M. M., S. Pierobon, M. C. Tafi, C. Signoretto, and P. Canepari. 2000. mRNA detection by reverse transcription-PCR for monitoring viability over time in an Enterococcus faecalis viable but nonculturable population maintained in a laboratory microcosm. Appl. Environ. Microbiol. 66:4564-4567.[Abstract/Free Full Text]
13
13. Lleò, M. M., M. C. Tafi, and P. Canepari. 1998. Nonculturable Enterococcus faecalis cells are metabolically active and capable of resuming active growth. Syst. Appl. Microbiol. 21:333-339.[Medline]
14
14. Lleò, M. M., M. C. Tafi, C. Signoretto, C. Dal Cero, and P. Canepari. 1999. Competitive polymerase chain reaction for quantification of nonculturable Enterococcus faecalis cells in lake water. FEMS Microbiol. Ecol. 30:345-353.[Medline]
15
15. McDonald, L. C., M. J. Kuehnert, F. C. Tenover, and W. R. Jarvis. 1997. Vancomycin-resistant enterococci outside the health-care setting: prevalence, sources, and public health implications. Emerg. Dis. 3:311-317.
16
16. Miele, A., M. Bandera, and B. P. Goldstein. 1995. Use of primers selective for vancomycin resistance genes to determine van genotype in enterococci and to study gene organization in VanA isolates. Antimicrob. Agents Chemother. 39:1772-1778.[Abstract]
17
17. Pruzzo, C., R. Tarsi, M. M. Lleò, C. Signoretto, M. Zampini, R. R. Colwell, and P. Canepari. 2002. In vitro adhesion to human cells by viable but nonculturable Enterococcus faecalis. Curr. Microbiol. 45:105-110.[CrossRef][Medline]
18
18. Signoretto, C., M. M. Lleò, M. C. Tafi, and P. Canepari. 2000. Cell wall chemical composition of Enterococcus faecalis in the viable but nonculturable state. Appl. Environ. Microbiol. 66:1953-1959.[Abstract/Free Full Text]
19
19. Toranzos, G. A., and G. A. McFetters. 1997. Detection of indicator microorganisms in environmental freshwaters and drinking waters, p. 184-194. In C. J. Hurst, G. R. Knudsen, M. J. McInerney, L. D. Stetzenbach, and M. V. Walter (ed.), Manual of environmental microbiology. ASM Press, Washington, D.C.
20
20. Torres, C., J. A. Reguera, M. J. Sanmartin, J. C. Perez-Diaz, and F. Baquero. 1994. VanA-mediated vancomycin-resistant Enterococcus spp. in sewage. J. Antimicrob. Chemother. 33:553-561.[Abstract/Free Full Text]
21
21. Wegener, H. C., M. Madsen, N. Nielsen, and F. M. Aarestrup. 1997. Isolation of vancomycin-resistant Enterococcus faecium from food. Int. J. Food Microbiol. 35:57-66.[CrossRef][Medline]

---

Antimicrobial Agents and Chemotherapy, March 2003, p. 1154-1156, Vol. 47, No. 3
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.3.1154-1156.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Matsuda, K., Tsuji, H., Asahara, T., Kado, Y., Nomoto, K. (2007). Sensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR. Appl. Environ. Microbiol. 73: 32-39 [Abstract] [Full Text]  
• Vora, G. J., Meador, C. E., Bird, M. M., Bopp, C. A., Andreadis, J. D., Stenger, D. A. (2005). Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp.. Proc. Natl. Acad. Sci. USA 102: 19109-19114 [Abstract] [Full Text]  
• Ramadhan, A A, Hegedus, E (2005). Survivability of vancomycin resistant enterococci and fitness cost of vancomycin resistance acquisition. J. Clin. Pathol. 58: 744-746 [Abstract] [Full Text]  
• Ballard, S. A., Grabsch, E. A., Johnson, P. D. R., Grayson, M. L. (2005). Comparison of Three PCR Primer Sets for Identification of vanB Gene Carriage in Feces and Correlation with Carriage of Vancomycin-Resistant Enterococci: Interference by vanB-Containing Anaerobic Bacilli. Antimicrob. Agents Chemother. 49: 77-81 [Abstract] [Full Text]  
• Signoretto, C., Burlacchini, G., Lleo, M. d. M., Pruzzo, C., Zampini, M., Pane, L., Franzini, G., Canepari, P. (2004). Adhesion of Enterococcus faecalis in the Nonculturable State to Plankton Is the Main Mechanism Responsible for Persistence of This Bacterium in both Lake and Seawater. Appl. Environ. Microbiol. 70: 6892-6896 [Abstract] [Full Text]  
• Sloan, L. M., Uhl, J. R., Vetter, E. A., Schleck, C. D., Harmsen, W. S., Manahan, J., Thompson, R. L., Rosenblatt, J. E., Cockerill, F. R. III (2004). Comparison of the Roche LightCycler vanA/vanB Detection Assay and Culture for Detection of Vancomycin-Resistant Enterococci from Perianal Swabs. J. Clin. Microbiol. 42: 2636-2643 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lleò, M. d. M. Articles by Canepari, P. Search for Related Content PubMed PubMed Citation Articles by Lleò, M. d. M. Articles by Canepari, P.