This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guerra, B.
Right arrow Articles by Helmuth, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guerra, B.
Right arrow Articles by Helmuth, R.

 Previous Article  |  Next Article 

Antimicrobial Agents and Chemotherapy, June 2003, p. 2059, Vol. 47, No. 6
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.6.2059.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

LETTER TO THE EDITOR

Multiple Resistance Mechanisms in Fluoroquinolone-Resistant Salmonella Isolates from Germany


arrow
LETTER
 
During the early 1990s, a clone of multiresistant Salmonella enterica serovar Typhimurium O5 negative (var. Copenhagen) of phage type DT204c predominated in Germany and neighboring countries within the calf-fattening industry. In addition to being resistant to ampicillin, kanamycin, tetracycline, chloramphenicol, and trimethoprim, these isolates were highly resistant to nalidixic acid (MIC > 128 µg/ml) and ciprofloxacin (MIC = 32 µg/ml) (4). Heisig et al. (3) showed that the clone had spread among humans and animals in Germany, and complementation experiments suggested that mutations in gyrA and gyrB were responsible for the high level of fluoroquinolone resistance. DNA sequencing of gyrA revealed two amino acid substitutions (Ser83->Ala and Asp87->Asn) (3).

Our recent molecular characterization of fluoroquinolone-resistance mechanisms in contemporary and old Salmonella strains showed that two such German isolates of bovine origin carried these gyrA mutations and a novel gyrB mutation together with a novel parC mutation in each strain. Both isolates (NRL608/93 and NRL154/94) were received at the German National Salmonella Reference Laboratory in the early 1990s, and the following MICs of fluoroquinolones were observed by the standard NCCLS broth dilution method (7): ciprofloxacin, 32 µg/ml; enrofloxacin, >128 µg/ml; levofloxacin, 16 and 8 µg/ml; moxifloxacin, 32 µg/ml; and ofloxacin, >128 µg/ml. In order to investigate the underlying resistance mechanisms, the quinolone resistance-determining regions (QRDRs) were amplified by using specific primers for gyrA and parC (6) and gyrB (F, ACTGGCGGACTGTCAGGAAC; B, TCTGACGATAGAAGAAGGTCAAC). Sequencing was carried out as described in reference 6. The most relevant findings were as follows. (i) Sequence analysis of the QRDR of the gyrA gene detected the mutations Ser83->Ala (TCC->GCC) and Asp87->Asn (GAC->AAC). (ii) Sequence analysis of the QRDR of gyrB showed in both isolates the novel mutation Ser464->Phe (TCC->TTC). This change may alter the hydrophobicity of the protein. In Salmonella, the substitution Ser464->Tyr in gyrB, which does not affect the local charge or hydrophobicity of the protein, had been described most frequently (2, 8). (iii) Sequence analysis of the QRDR of parC showed in both isolates the mutation Ser80->Ile (AGC->ATC). This parC substitution has frequently been described for high-level resistance to fluoroquinolones in Escherichia coli in combination with gyrA double mutations (8). Recently, Baucheron et al. (1) described this mutation for Belgian Salmonella isolates. (iv) Phenotypic analysis of the tolerance to the organic solvent cyclohexane (5) showed that both isolates were resistant. This cyclohexane resistance suggests the possession of broad-spectrum efflux pumps implicated in the high resistance to the hydrophilic fluoroquinolones as well. Although the contributions of the various genetic mechanisms described above to the fluoroquinolone resistance phenotype were not elucidated in our study, genetic work in other species (8) suggests their relevance.

The description of this particular clone is of special importance, since it was part of a wide animal outbreak and sporadic human infections (4). The isolation of multiresistant strains from cattle with at least four different genetic backgrounds (double mutation in gyrA, single mutation in gyrB, single mutation in parC, and the presumable presence of efflux pumps) implicated in fluoroquinolone resistance should be a cause of concern and be prevented in the future by decreasing selective pressure.


arrow
ACKNOWLEDGMENTS
 
We thank E. Junker, M. Jaber, and B. Hoog for their helpful assistance.  This work was supported by the grants of the Federal Institute for Risk Assessment, BfR (formerly BgVV, Ref. F501-28/1322-136).


arrow
REFERENCES
 
    1
  1. Baucheron, S., H. Imberechts, E. Chaslus-Dancla, and A. Cloeckaert. 2002. The AcrB multidrug transporter plays a major role in high level fluoroquinolone resistance in Salmonella enterica serovar Typhimurium phage type DT204. Microb. Drug. Res. 8:281-289.
    2. 2
  2. Cloeckaert, A., and E. Chaslus-Dancla. 2001. Mechanisms of quinolone resistance in Salmonella. Vet. Res. 32:291-300.[CrossRef][Medline]
    3. 3
  3. Heisig, P., B. Kratz, E. Halle, Y. Graser, M. Altwegg, W. Rabsch, and J. Faber. 1995. Identification of DNA gyrase A mutations in ciprofloxacin-resistant isolates of Salmonella typhimurium from men and cattle in Germany. Microb. Drug. Res. 1:211-218.
    4. 4
  4. Helmuth, R. 2000. Antibiotic resistance in Salmonella, p. 89-106. In C. Wray and A. Wray (ed.), Salmonella in domestic animals. CABI Publishing, Oxon, United Kingdom.
    5. 5
  5. Liebana, E., C. Clouting, C. A. Cassar, L. P. Randall, R. A. Walker, E. John Threlfall, F. A. Clifton-Hadley, A. M. Ridley, and R. H. Davies. 2002. Comparison of gyrA mutations, cyclohexane resistance, and the presence of class I integrons in Salmonella enterica from farm animals in England and Wales. J. Clin. Microbiol. 40:1481-1486.[Abstract/Free Full Text]
    6. 6
  6. Malorny, B., A. Schroeter, B. Guerra, and R. Helmuth. Incidence of quinolone resistance in veterinary Salmonella strains isolated in Germany between 1998 and 2001. Vet. Rec., in press.
    7. 7
  7. National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A5. National Committee for Clinical Laboratory Standards, Wayne, Pa.
    8. 8
  8. Piddock, L. J. V. 2002. Fluoroquinolone resistance in Salmonella serovars isolated from human and food animals. FEMS Microbiol. Rev. 26:3-16.[Medline]
Beatriz Guerra
Burkhard Malorny
Andreas Schroeter
Reiner Helmuth*
Federal Institute for Risk Assessment (BfR)
National Salmonella Reference Laboratory
Diedersdorfer Weg 1
D-12277 Berlin, Germany

* Phone: 49-30-8412-2233Fax: 49-30-8412-2953E-mail: r.helmuth{at}bfr.bund.de

Antimicrobial Agents and Chemotherapy, June 2003, p. 2059, Vol. 47, No. 6
0066-4804/03/$08.00+0     DOI: 10.1128/AAC.47.6.2059.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Kehrenberg, C., de Jong, A., Friederichs, S., Cloeckaert, A., Schwarz, S. (2007). Molecular mechanisms of decreased susceptibility to fluoroquinolones in avian Salmonella serovars and their mutants selected during the determination of mutant prevention concentrations. J Antimicrob Chemother 59: 886-892 [Abstract] [Full Text]  
  • CABRERA, R., RUIZ, J., RAMIREZ, M., BRAVO, L., FERNANDEZ, A., ALADUENA, A., ECHEITA, A., GASCON, J., ALONSO, P. L., VILA, J. (2006). DISSEMINATION OF SALMONELLA ENTERICA SEROTYPE AGONA AND MULTIDRUG-RESISTANT SALMONELLA ENTERICA SEROTYPE TYPHIMURIUM IN CUBA. Am J Trop Med Hyg 74: 1049-1053 [Abstract] [Full Text]  
  • Baucheron, S., Mouline, C., Praud, K., Chaslus-Dancla, E., Cloeckaert, A. (2005). TolC but not AcrB is essential for multidrug-resistant Salmonella enterica serotype Typhimurium colonization of chicks. J Antimicrob Chemother 55: 707-712 [Abstract] [Full Text]  
  • Baucheron, S., Chaslus-Dancla, E., Cloeckaert, A., Chiu, C.-H., Butaye, P. (2005). High-Level Resistance to Fluoroquinolones Linked to Mutations in gyrA, parC, and parE in Salmonella enterica Serovar Schwarzengrund Isolates from Humans in Taiwan. Antimicrob. Agents Chemother. 49: 862-863 [Full Text]  
  • Olliver, A., Valle, M., Chaslus-Dancla, E., Cloeckaert, A. (2005). Overexpression of the Multidrug Efflux Operon acrEF by Insertional Activation with IS1 or IS10 Elements in Salmonella enterica Serovar Typhimurium DT204 acrB Mutants Selected with Fluoroquinolones. Antimicrob. Agents Chemother. 49: 289-301 [Abstract] [Full Text]  
  • Marimon, J. M., Gomariz, M., Zigorraga, C., Cilla, G., Perez-Trallero, E. (2004). Increasing Prevalence of Quinolone Resistance in Human Nontyphoid Salmonella enterica Isolates Obtained in Spain from 1981 to 2003. Antimicrob. Agents Chemother. 48: 3789-3793 [Abstract] [Full Text]  
  • Cabrera, R., Ruiz, J., Marco, F., Oliveira, I., Arroyo, M., Aladuena, A., Usera, M. A., Jimenez De Anta, M. T., Gascon, J., Vila, J. (2004). Mechanism of Resistance to Several Antimicrobial Agents in Salmonella Clinical Isolates Causing Traveler's Diarrhea. Antimicrob. Agents Chemother. 48: 3934-3939 [Abstract] [Full Text]  
  • Eaves, D. J., Randall, L., Gray, D. T., Buckley, A., Woodward, M. J., White, A. P., Piddock, L. J. V. (2004). Prevalence of Mutations within the Quinolone Resistance-Determining Region of gyrA, gyrB, parC, and parE and Association with Antibiotic Resistance in Quinolone-Resistant Salmonella enterica. Antimicrob. Agents Chemother. 48: 4012-4015 [Abstract] [Full Text]  
  • Baucheron, S., Chaslus-Dancla, E., Cloeckaert, A. (2004). Role of TolC and parC mutation in high-level fluoroquinolone resistance in Salmonella enterica serotype Typhimurium DT204. J Antimicrob Chemother 53: 657-659 [Abstract] [Full Text]  

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guerra, B.
Right arrow Articles by Helmuth, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guerra, B.
Right arrow Articles by Helmuth, R.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»